|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00312
1 Whitehead Institute, Massachusetts Institute of Technology, Cambridge, MA
02142, USA
2 Department of Biology, Massachusetts Institute of Technology, Cambridge, MA
02142, USA
* Author for correspondence (e-mail: rebay{at}wi.mit.edu)
Accepted 27 November 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Receptor tyrosine kinase, Nuclear export, ETS transcription factor, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
Both YAN and PNT-P2 appear to be evolutionarily conserved, serving as
critical regulators of RTK signaling in other systems, including mammals
(Hsu and Schulz, 2000
). For
example, the human orthologs, TEL and ETS1, respectively, are both
oncoproteins (Hsu and Schulz,
2000
). Like YAN, TEL functions as a transcriptional repressor
(Lopez et al., 1999
) and
appears to be regulated by phosphorylation
(Poirel et al., 1997
).
Translocations and deletions of the tel locus are the most frequent
chromosomal aberrations associated with leukemia, implying an important
function in proliferation control (reviewed by
Rubnitz et al., 1999
). The
transcriptional activator ETS1 acts as a positive effector of RAS/MAPK
signaling (Yang et al., 1996
)
and plays a significant role in mediating the invasiveness and angiogenesis of
a variety of cancers (reviewed by Dittmer
and Nordheim, 1998
).
YAN is a general inhibitor of RTK-mediated signaling in
Drosophila, functioning downstream of and negatively regulating
multiple RTK pathways in both neuronal and non-neuronal cell types
(Rebay and Rubin, 1995
).
Consistent with its role in mediating specific developmental transitions, YAN
expression is highly regulated (Lai and
Rubin, 1992
; Price and Lai,
1999
). In general, nuclear YAN expression is apparent in
undifferentiated tissues, but disappears abruptly as the cells begin to
differentiate (Lai and Rubin,
1992
; Price and Lai,
1999
). This pattern suggests that rapid degradation of YAN may
alleviate the YAN-mediated block to differentiation. Supporting such an
hypothesis, sequence analysis reveals YAN is rich in PEST sequences, a motif
characteristically found in proteins with short or dynamically regulated half
lives (Lai and Rubin, 1992
;
Rechsteiner and Rogers,
1996
).
Experiments both in vivo and in cultured cells have suggested that
phosphorylation of YAN by activated MAPK in response to RTK-initiated
signaling may serve as the trigger for dismantling the YAN-mediated block to
differentiation. Mutating the phosphoacceptor residues of the MAPK
phosphorylation consensus sites in YAN produces a constitutively `activated'
allele, YANACT, that cannot be downregulated
(Rebay and Rubin, 1995
). For
example, while wild-type Yan is rapidly excluded from the nucleus in
RAS/MAPK-stimulated cultured cells, YANACT remains nuclear. Further
mutational analyses indicated that the first MAPK phosphorylation consensus
site, Serine 127, is necessary for redistribution of YAN from the nucleus to
the cytoplasm in response to pathway activation in cultured cells. These data
have led to the hypothesis that a primary consequence of MAPK-mediated
phosphorylation might be nuclear export of YAN
(Rebay and Rubin, 1995
);
however, the mechanism and potential in vivo relevance have not been
determined.
MAPK-mediated recognition and phosphorylation of YAN at Serine 127 is
thought to be facilitated by a protein called Modulator of the Activity of ETS
(MAE) (Baker et al., 2001
).
Mechanistically, MAE binds to YAN via a protein-protein interaction motif
found at the N terminus of YAN and the C terminus of MAE
(Baker et al., 2001
), referred
to as the Pointed Domain (PD) (Klambt,
1993
). Interestingly, Baker et al.
(Baker et al., 2001
) also
suggest that MAE binds to the PD of PNT-P2, and enhances the transcriptional
activation of PNT-P2, leading them to propose that MAE promotes PNT-P2
phosphorylation by MAPK. Thus, they speculate that by promoting
phosphorylation events that simultaneously downregulate YAN and upregulate
PNT-P2, MAE facilitates downstream responses to RTK signaling.
Although it is clear that MAPK phosphorylation initiates YAN
downregulation, the ensuing events, with respect to both YAN and PNT-P2,
remain poorly understood. We show that nuclear export, via CRM1, is an
essential step in downregulating YAN both in cell culture and in vivo. In this
context, the PD of YAN plays a dual role in maintenance of nuclear
localization in the absence of signaling and regulation of nuclear export upon
RAS/MAPK activation. By manipulating the levels of mae expression in
cells co-expressing specifically designed structural variants of YAN, we
demonstrate that MAE plays a crucial role in mediating the nuclear export of
YAN, independent of its role in promoting MAPK phosphorylation. Consistent
with previous reports (Baker et al.,
2001
), we find that overexpression of MAE decreases
transcriptional repressor activity of YAN. However, whereas the
transcriptional activity of PNT-P2 was proposed to be stimulated by MAE
co-expression (Baker et al.,
2001
), we find that overexpression of MAE inhibits the ability of
PNT-P2 to activate transcription. Thus, we propose that MAE mediates
downregulation of both YAN and PNT-P2. In the case of YAN, MAE facilitates
MAPK-mediated phosphorylation and subsequent nuclear export, while in the case
of PNT-P2, MAE could participate in a negative feedback loop that attenuates
transcriptional activity.
| MATERIALS AND METHODS |
|---|
|
|
|---|
YAN
NES1, YAN
NES1,2,
YAN
NES3+PD, and YAN
N' have amino
acids 1-17, 1-48, 48-117 and 1-117 deleted, respectively. Unless otherwise
noted, these and all other constructs were expressed under the metallothionein
promoter using the plasmid pRMHa-3.
YANMut Ets was made using Stratagene's QuikChange Site-Directed Mutagenesis system with oligonucleotides 5' GGACTGGCAAAGTTGGGAGGCATCCAGGGGAACCATCTGTCC 3' and its reverse complement. The underlined nucleotides indicate the mutated base pairs, which result in W438G and K443G.
MYC-MAE was generated by PCR amplifying mae out of a cDNA library using primers 5' CAAGTGGAATCGAGCTATACC 3' and 5' CTATGATAGCAGGGCCATTGCTCGG 3'. The product was N-terminally tagged with a MYC epitope, verified by sequencing, and shuttled into both pRMHa-3 and pUAST.
pUAST flag PNT-P2 was generated by adding an N-terminal FLAG epitope tag to the full length PNT-P2 coding sequence.
The EBS-luciferase reporter was created by placing six tandem copies of an
ETS-binding site (O'Neill et al.,
1994
) upstream of the luciferase gene.
Additional subcloning details available upon request.
Immunohistochemistry
Fixation and staining of S2 cells and embryos were performed as previously
described (Fehon et al., 1990
;
Fehon et al., 1991
). S2 cells
staining was performed using Anti-YAN MAb 8B12 at 1:250 or anti-MYC MAb 9E10
(a gift from R. Fehon) at 1:100, with CY3-conjugated goat anti-mouse secondary
(1:10000) and DAPI (100 µg/ml at 1:5000). Staining of double-labeled
embryos was performed using 8B12 (1:750), CY3 goat anti-mouse (1:1000), rat
anti-ELAV MAb 7E8A10 (1:500), and CY2-conjugated goat anti-rat (1:2000). All
secondary antibodies were from Jackson ImmunoResearch. Monoclonal supernatants
were generated by growing hybridoma lines obtained from the Developmental
Studies Hybridoma Bank in DMEM supplemented with 10% fetal bovine serum and
10-% NCTC-109 (Gibco).
Transcription assays
Drosophila S2 cells were transfected using the calcium phosphate
method as previously described (Pascal and
Tjian, 1991
). pAc5.1-lacZ (Invitrogen) was used as a
transfection control. Transfected cells were harvested, washed with media, and
lysed by rocking at 4°C for 20 minutes in 250 µl of lysis buffer
(Tropix/Applied Biosystems). Quantitation of luciferase and
ß-galactosidase activity was carried out using a Luciferase Assay Kit
(Tropix/Applied Biosystems) or Galacto-Star Assay kit (Tropix/Applied
Biosystems) in a tube luminometer (EG&G Berthold AutoLumat LB953). Each
transfection was performed in quadruplicate, tested in triplicate and the data
points averaged. The average luciferase/ß-galactosidase signal for
EBS-luciferase alone was set to 1 and the experimental averages were
normalized relative to this value. Data were analyzed and graphed using
Microsoft Excel.
RNAi
dsRNAs were generated using PCR primers containing T7 polymerase
recognition sequences (5' GAATTAATACGACTCACTAT 3') at the 5'
ends followed by 21 nucleotides of the target sequence, and were designed to
span
500 bp of coding sequence (crm1 5'
T7-ATGGCGACAATGTTGACA 3', 5' T7-TTGTTCATGCACAGGC 3';
mae 5' CAAGTGGAATCGAGCTATACC 3', 5'
CTATGATAGCAGGGCCATTGC 3'). The PCR products were extracted from 1%
agarose gels and purified using Qiagen's QIAquick PCR purification kit. dsRNAs
were made according to the directions of Ambion's MEGAscript in vitro
transcription kit. RNAi experiments in S2 cells were performed by adding 10
µg of dsRNA to the transfection mix. Cells were analyzed at 3-7 days post
transfection, as determined for maximum effect (3 days for RNAi of
crm1 and 7 days for RNAi of mae). RNAi was injected into
embryos according to standard injection protocols
(Rebay et al., 1993
) at a
concentration of less than 5 µM.
Histology
Adult flies were prepared for scanning electron microscopy by fixation in
1% glutaraldehyde/1% paraformaldehyde in 0.1 M sodium phosphate (pH 7.2) for 2
hours. The fixed tissue was dehydrated through an ethanol series. Samples were
critical point dried, sputter coated, and pictures taken on a scanning
electron microscope (JEOL 5600LV). Fixation and tangential sections of adult
eyes was performed as previously described
(Tomlinson et al., 1987
).
Co-immunoprecipitation
Transfected cells were harvested, and lysed by rocking at 4°C for 20
minutes in 1 ml of lysis buffer [100 mM NaCl; 50 mM Tris, pH7.5; 2 mM EDTA; 2
mM EGTA; 1% NP-40 + one Complete, Mini protease inhibitor cocktail tablet
(Roche)/10 ml]. Clarified lysates were subjected to immunoprecipitation
(anti-MYC 1:50 for 3 hours at 4°C), followed by the addition of 20 µl
of Protein-A Sepharose beads (Zymed) (1.5 hours at 4°C). Beads were washed
twice with lysis buffer and twice with PBS. The immunoprecipitates were boiled
in 40 µl of 2xSDS buffer, and western blotting was carried out as
previously described (O'Neill et al.,
1994
) (anti-MYC 1:100, anti-YAN 1:500, anti-FLAG 1:50000).
| RESULTS |
|---|
|
|
|---|
|
Nuclear export is necessary for downregulation of YAN in vivo
Because cytoplasmic accumulation of YAN has never been detected in
developing Drosophila tissues (I. R., unpublished)
(Lai and Rubin, 1992
), it was
possible that the nuclear export demonstrated in S2 cultured cells
(Fig. 1A-C) did not reflect the
actual downregulation mechanism used in vivo. To address this, the SV40 large
T antigen nuclear localization signal (NLS)
(Kalderon et al., 1984
) was
inserted into YAN. Insertions were made either near the N terminus
(YANN' NLS) or in the middle of the protein (YANInt
NLS and YAN2x NLS) (Fig.
1D). As a control, a mutated, and hence non-functional, version of
the NLS (Kalderon et al.,
1984
) was inserted into the middle of the protein (YANMut
NLS). These constructs were placed under the control of the UAS
promoter, which allows expression both in cell culture and in vivo when
combined with an appropriate GAL4 driver
(Brand and Perrimon, 1993
).
We first demonstrated that the NLS insertions were capable of rendering YAN refractory to nuclear export in response to RAS/MAPK signaling in transiently transfected S2 cultured cells. In the presence of RASV12, the internal NLS insertions effectively overcame the export signals and completely restricted YAN to the nucleus (Fig. 1E-H). YANN' NLS appears less potent, presumably owing to insertion in a less accessible region of the protein, and only partially restricted YAN to the nucleus (Fig. 1I,J). The control experiment, in which YANMut NLS behaved indistinguishably from wild-type YAN, localizing to the nucleus in unstimulated cells (Fig. 1K) and becoming cytoplasmic in RASV12 stimulated cells (Fig. 1L), indicated that the insertion alone does not disrupt regulation of YAN localization. Given the reduced efficiency of the YANN' NLS insertion relative to that of YANInt NLS and YAN2x NLS, only the internal insertions were used for in vivo analyses.
Having demonstrated that insertion of a NLS tag is sufficient to prevent
nuclear export, transgenic flies expressing these constructs were generated
and used to examine the role of nuclear export of YAN in vivo. For these
experiments, ELAV GAL4 was used to drive expression in the central nervous
system (CNS), a tissue whose differentiation requires precisely timed
downregulation of YAN (Rebay and Rubin,
1995
). We reasoned that if nuclear export is necessary for
downregulation of YAN, restricting YAN to the nucleus should prevent this and
result in a phenotype resembling YANACT. Specifically, nuclear YAN
expression should be detected in the region of the developing brain and
ventral nerve cord of stage 11 embryos
(Fig. 2A,A') and CNS
development should be inhibited as visualized by reduced expression of
neuronal markers (Fig.
2A'') (Rebay and Rubin,
1995
). Alternatively, if nuclear export is not required, then the
NLS tagged YAN should be downregulated as effectively as overexpressed
wild-type YAN, resulting in a lack of YAN staining in the presumptive ventral
nerve cord and correspondingly normal CNS development
(Fig.
2B,B',B'').
|
Supporting the first model, expression of either YANInt NLS
(Fig. 2C,C',C'') or
YAN2x NLS (Fig.
2D,D',D'') resulted in a YANACT phenotype
(Fig. 2A,A',A'').
Analogous results were obtained in the eye (data not shown), where
downregulation of YAN is necessary for photoreceptor differentiation
(Lai and Rubin, 1992
),
indicating an essential role for nuclear export in downregulating YAN in
multiple cell types in vivo. The control construct, YANMut NLS,
exhibited wild-type YAN regulation (Fig.
2E,E') and neuronal differentiation
(Fig. 2E''). This
NLS-mediated restriction of YAN to the nucleus, and subsequent inhibition of
downregulation and differentiation, strongly suggests nuclear export plays a
central role in downregulation of YAN in vivo.
The PD is necessary for regulating the subcellular localization of
YAN
Having demonstrated a requirement for nuclear export in YAN downregulation
in vivo, we sought to determine which domains of YAN are involved. Analysis of
the YAN protein sequence (Lai and Rubin,
1992
) reveals three N-terminal leucine-rich putative nuclear
export sequences (NES) (Wen et al.,
1995
) that resemble canonical CRM1-binding sites
(Fornerod et al., 1997
)
(Fig. 1D). Two of the putative
NESs reside within the pointed domain (PD), suggesting this motif could be
involved in regulating export.
A series of deletion constructs was made and assayed for nuclear export
competence in S2 cultured cells. The deletion of the first NES
(YAN
NES1) or the first and second NES
(YAN
NES1,2) had no effect on regulated YAN localization
(Fig. 3A,B and D,E
respectively, when compared with Fig.
1A,B). Deletion of the third NES and the majority of the PD
(YAN
NES3+PD) resulted in partial export in the absence of
signaling and a slight increase in export upon RAS stimulation
(Fig. 3G,J,H,K). However,
strictly cytoplasmic localization was never seen with
YAN
NES3+PD. Export of these constructs appeared to be
regulated in the same manner as wild-type YAN, as inhibition of CRM1 resulted
in the deletions being restricted to the nucleus
(Fig. 3C,F,I). Finally, the
deletion of the whole N terminus (YAN
N'), including
all three NESs and the PD, localized to the nucleus and remained nuclear in
the presence of RASV12 (Fig.
3L,M). These results suggest that while individually the NESs may
be redundant for nuclear export, together the NESs mediate export. The data
also implicate the PD as necessary for regulated subcellular localization of
YAN.
|
Because phosphorylation by MAPK has been shown to be a prerequisite for
redistribution of YAN (Rebay and Rubin,
1995
), it was important to rule out the possibility that the
mislocalization of YAN
NES3+PD and
YAN
N' reflected an inability of the proteins to be
phosphorylated, rather than a defect in export. To test this, we used the
previously published observation that phosphorylation of YAN in response to
RAS/MAPK signaling abrogates the ability of YAN to repress PNT-P1-mediated
activation of an ETS reporter construct (O'Neill et al., 1995). If YAN cannot
be phosphorylated, as was shown for YANACT, then transcriptional
repression continues unabated even in the presence of RAS stimulation.
Therefore, to verify that YAN
NES3+PD and
YAN
N' are responsive to RAS/MAPK signaling,
transcriptional assays were performed. Both YAN
NES+PD, which
is partially exported in the absence of signaling, and
YAN
N', which is completely restricted to the nucleus,
were capable of repressing transcription, but not to the extent of wild-type
YAN (Fig. 3O). This repression
could be relieved by RASV12. The significant, albeit reduced,
transcriptional repression exhibited by these constructs argues that the
N-terminal deletions have not compromised the structure or function of the
remainder of the protein. It also suggests that the PD may play a role in
mediating transcriptional repression. Retention of normal RAS/MAPK
responsiveness indicates that both proteins are likely to be phosphorylated
and that their nuclear restriction reflects a specific failure in export. Thus
phosphorylation of YAN by MAPK, although it abrogates transcriptional
repression, is not sufficient to induce nuclear export; rather, nuclear export
of YAN requires a functional N terminus, presumably to mediate dynamic
interactions with CRM1 and possibly other co-factors in response to RAS/MAPK
stimulation.
MAE is necessary for YAN downregulation in vivo
We have shown that loss of the PD and NES motifs results in inappropriate
YAN localization. PDs are involved in protein-protein interactions
(Chakrabarti and Nucifora,
1999
; Carrere et al.,
1998
; Baker et al.,
2001
). MAE, a PD family member, has been shown in vitro to bind
YAN via a PD-PD interaction, leading to phosphorylation of YAN at Serine 127
(Baker et al., 2001
), the
phosphorylation site necessary for redistribution of YAN in S2 cultured cells
(Rebay and Rubin, 1995
). If
promoting YAN downregulation were its primary function, MAE would be predicted
to play a positive role in the RTK signaling cascade, although mae
mutations have not been isolated in RTK pathway genetic interaction screens
(e.g. Dickson et al., 1996
;
Karim et al., 1996
;
Rebay et al., 2000
;
Simon et al., 1991
).
To confirm that MAE contributes to RTK signaling in vivo, we looked first
for genetic interactions with known pathway components. Transgenic flies
expressing RASV12 under the control of the Sevenless promoter
(Sev-RASV12) exhibit rough adult eyes
(Karim et al., 1996
)
(Fig. 4B, compared with 4A).
Heterozygosity for mae, with either a P-element insertion
(l(2)k06602) or a deficiency uncovering the locus
(Df(2R)PC4), dominantly suppressed the Sev-RASV12 rough
eye phenotype (Fig. 4C,D),
consistent with the proposed function of MAE as a positive component of the
pathway. Quantitation of this suppression by counting the number of R7
photoreceptors per ommatidium in tangential adult eye sections confirmed the
interaction. Relative to the wild-type control which has 1.0 R7/ommatidium
(Fig. 4E), Sev-RASV12 exhibits 3.0 R7/ommatidium
(Fig. 4F), while
Sev-RASV12/l(2)k06602 and
Sev-RASV12/Df(2R)PC4 exhibit 2.0 R7/ommatidium and 1.6
R7/ommatidium, respectively (Fig.
4G,H). Further supporting a positive role in the pathway, a
reduction in dose of mae mildly enhanced the Sev-YANACT
rough eye phenotype (data not shown). The ability of mae to suppress
Sev-RASV12 and enhance Sev-YANACT suggests that loss of
mae function decreases signaling through the pathway and that MAE
plays a positive role in RTK signaling in vivo.
|
We then asked whether the reduced RTK signaling associated with loss of
mae function might result from improper YAN localization and
downregulation. Initially we addressed this question in S2 cultured cells,
where MAE has been shown to be endogenously expressed
(Baker et al., 2001
). RNAi of
mae resulted in restriction of YAN to the nucleus in the presence of
RASV12 (Table 1),
consistent with the model whereby MAE facilitates MAPK-mediated
phosphorylation of YAN as a prerequisite for nuclear export. To assess the
effect of mae loss of function in Drosophila, we examined
YAN localization in embryos homozygous for either l(2)k06602
(Fig. 4I,I'),
Df(2R)PC4 (data not shown) or transheterozygotes (data not shown).
YAN is not downregulated in mae mutant embryos, which exhibit nuclear
expression in the brain and ventral nerve cord (compare
Fig. 4I,I' with
4J,J'). Consistent with the presence of aberrant YAN
expression in the CNS, neuronal differentiation was inhibited in mae
mutants (compare Fig. 4I'' with
4J''). RNAi of mae performed in embryos produced
identical phenotypes (data not shown). We therefore conclude that mae
function is necessary to downregulate YAN in vivo.
|
MAE is required for nuclear export of YAN independent of its role in
facilitating MAPK phosphorylation
Previous work has shown that MAPK-mediated phosphorylation of YAN is
necessary for nuclear export, with Serine127 serving as the key
phosphorylation site (Rebay and Rubin,
1995
). MAE is thought to be necessary for phosphorylation of YAN
at this site (Baker et al.,
2001
), and our results suggest that MAE is also required for
nuclear export. We therefore wanted to determine whether the role of MAE in
export was simply a secondary consequence of it being necessary for
phosphorylation, or whether it reflected an independent requirement.
To address this, we needed to establish an experimental context in which
nuclear export of YAN is uncoupled from the RAS/MAPK signal that normally
triggers it. We reasoned that localization of YAN to the DNA was likely to be
necessary for proper regulation of subcellular localization, perhaps by
masking the N-terminal NES sequences from recognition by CRM1. Therefore, we
introduced two point mutations into the ETS domain of YAN (W439G and K443G,
YANMut ETS) that have been shown previously to be important for DNA
binding but not for nuclear localization
(Kodandapani et al., 1996
).
YANMut Ets, which is no longer able to bind DNA, might be
accessible to CRM1, even in the absence of RAS/MAPK signaling, and might
therefore be constitutively exported, providing us with a situation in which
export was uncoupled from signaling.
We found that even in the absence of RASV12 activation, YANMut ETS localized to the cytoplasm in S2 cultured cells, indicating that YAN must be bound to DNA to maintain its nuclear localization (Table 1). Furthermore, inhibition of CRM1-mediated export resulted in localization of YANMut ETS to the nucleus (Table 1), suggesting YANMut ETS initially localized properly to the nucleus but because of its inability to bind DNA was promptly exported. Thus, under conditions in which YAN is not phosphorylated by MAPK, CRM1-mediated nuclear export regulates localization of YANMut ETS. Colocalization and coimmunoprecipitation experiments confirmed that the point mutations in YANMut ETS do not compromise its ability to bind MAE (data not shown).
We exploited these findings to ask whether MAE plays a role in nuclear
export separate from that proposed by Baker et al.
(Baker et al., 2001
) in
facilitating phosphorylation. We found that RNAi of mae restricted
YANMut Ets to the nucleus (Table
1). This suggests that MAE has a second function with respect to
CRM1-mediated nuclear export of YAN, independent of its earlier role in
promoting YAN phosphorylation in response to RAS/MAPK signaling.
RAS/MAPK signaling regulates MAE localization by modulating
interactions with its binding partners YAN and PNT-P2
Our results indicate that MAE plays a significant role in the
downregulation of YAN, both in cell culture and in vivo. To investigate the
function(s) and regulation of MAE in more detail, we first asked whether the
RAS/MAPK pathway might directly control the subcellular localization of MAE.
To address this question, a MYC-epitope tagged MAE was generated and expressed
in S2 cultured cells. We found that MAE was ubiquitously expressed throughout
the cell in both the absence and presence of RASV12
(Fig. 5C,D). Furthermore,
inhibition of CRM1-mediated nuclear export had no effect on MAE subcellular
localization (Fig. 5E,F),
consistent with its predicted ability to diffuse freely through the nuclear
pore based on its small (
19 kDa) size and lack of a recognizable NES.
Therefore, the localization of MAE does not appear to be influenced directly
by RAS/MAPK signaling, nor is it dependent upon CRM1-mediated export.
|
These results led us to hypothesize that any dynamic RAS/MAPK-mediated regulation of MAE was likely to be mediated through specific interactions with its binding partners, YAN and PNT-P2. Therefore, we looked for RASV12-induced changes in MAE localization in cells co-transfected with YAN and PNT-P2. Co-transfection of YAN with MAE alters MAE distribution. In the absence of RASV12, MAE was predominantly nuclear (Fig. 5G), because it is bound to YAN (Fig. 5A, lane 2), and then became both nuclear and cytoplasmic in the presence of RASV12 (Fig. 5H). This suggests that MAPK phosphorylation of YAN may result in destabilization of the YAN-MAE complex, allowing MAE to reassume uniform distribution. Co-immunoprecipitation experiments supported this interpretation, as the amount of YAN bound to MAE appeared to be significantly reduced in RASV12-stimulated cells (Fig. 5A, compare lane 4 with lane 2; note that the total amount of YAN present is comparable with and without RASV12, lanes 1 and 3).
We speculated that destabilization of the YAN-MAE complex upon RAS/MAPK activation might require intervention from an additional YAN-binding partner, potentially CRM1. To address this possibility, we examined the effects of inhibiting CRM1-mediated export in RASV12-stimulated cells expressing YAN and MAE. Under these conditions, MAE remains nuclear, suggesting that interactions with CRM1 or some other associated factor, is needed to dissociate MAE from YAN (Fig. 5O). These results indicate that MAE localization is dependent on a dynamic balance between its own expression level, the expression level of YAN, the presence of additional YAN binding partners and RAS/MAPK signaling.
To characterize further the interaction between YAN and MAE, we analyzed
MAE localization when co-transfected with several different mutants of YAN. It
has been shown in vitro that MAE interacts with YAN via a PD-PD interaction
(Baker et al., 2001
). To
confirm this, we examined MAE localization in the presence of
YAN
N' and found that MAE was ubiquitously expressed
throughout the cell (Fig.
5I,J). Therefore, restriction of MAE to the nucleus by YAN
requires the PD. We also looked at MAE localization in
YANACT-expressing cells. YANACT cannot be phosphorylated
by MAPK and therefore remains restricted to the nucleus in the presence of
RASV12. Co-transfection of YANACT restricted MAE to the
nucleus in the absence and presence of RASV12
(Fig. 5K,L), suggesting
phosphorylation of YAN is necessary for redistribution of MAE.
Because YAN appears to play a significant role in regulating MAE
localization, we next asked whether PNT-P2, the other known binding partner of
MAE (Baker et al., 2001
), might
also be involved. Co-transfection of PNT-P2 and MAE resulted in restriction of
MAE to the nucleus and formation of a MAE-PNT-P2 complex that can be
co-immunoprecipitated in the absence and presence of RASV12
(Fig. 5M,N; Fig. 5B, lanes 2,4). Together
these results suggest that MAE localization is not subject to direct
regulation by CRM1 and RAS/MAPK signaling, but is determined by the presence
or absence of nuclear binding partners YAN and PNT-P2 in accordance with
changing signaling conditions.
MAE inhibits both the ability of YAN to repress transcription and the
ability of PNT-P2 to activate transcription
Baker et al. (Baker et al.,
2001
) have proposed that overexpression of MAE inhibits the
ability of YAN to repress transcription and stimulates the ability of PNT-P2
to activate transcription. Because their work placed these Drosophila
proteins in a potentially physiologically inappropriate mammalian cultured
cell environment, we felt it was important to test the function of MAE in the
Drosophila system used in our assays. With respect to regulation of
YAN-mediated repression, our results concur with those of Baker et al.
(Baker et al., 2001
). In
Drosophila S2 cells, overexpression of MAE inhibited YAN-mediated
transcriptional repression, and slightly enhanced the
RASV12-mediated removal of transcriptional repression
(Fig. 6A).
|
However, our results disagree with the conclusion of Baker et al.
(Baker et al., 2001
) that MAE
stimulates the ability of PNT-P2 to activate transcription. We found that
overexpression of MAE completely inhibited PNT-P2 mediated activation of
transcription (Fig. 6B).
Therefore, MAE could have a role in downregulating, rather than stimulating,
the ability of PNT-P2 to activate transcription.
| DISCUSSION |
|---|
|
|
|---|
Regulation of YAN localization in the absence of RAS/MAPK activation:
achieving a balance between nuclear retention and nuclear export
In unstimulated or undifferentiated cells, YAN localizes to the nucleus
(Lai and Rubin, 1992
;
Rebay and Rubin, 1995
). For
both YAN and its mammalian ortholog TEL, the DNA-binding domain serves as a
nuclear localization sequence (NLS) (I. R., unpublished)
(Poirel et al., 1997
). We have
shown that upon RTK stimulation, YAN is actively exported from the nucleus via
CRM1 recognition of its N-terminal NES motif. The presence of both NLS and NES
motifs within YAN raises the question of how each domain is either recognized
or masked under different signaling conditions.
Our results lead us to propose that proper YAN subcellular localization
involves dynamic regulation of its DNA-binding affinity via modulation of
protein-protein interactions in response to changing RTK signaling levels.
Consistent with this model, we find that nuclear localization requires that
YAN be bound to the DNA, as a mutation that abolishes DNA binding
(Kodandapani et al., 1996
),
YANMut ETS, results in CRM1-dependent cytoplasmic accumulation of
YAN. The PD, an N-terminal protein-protein interaction motif, also plays a
pivotal role in determining the subcellular localization of YAN, as loss of
the PD (YAN
NES3+PD) results in partial CRM1-mediated export
in the absence of signaling. In addition, YAN
NES3+PD
exhibits a 30% decrease in repression activity relative to wild-type YAN,
suggesting a weaker or less productive interaction with DNA. Together these
data suggest that PD-mediated protein-protein interactions may be crucial in
facilitating productive DNA binding and/or masking inappropriate CRM1
recognition of the NESs.
Our finding that PD-mediated interactions are crucial for the
transcriptional repression ability of YAN agrees with similar experiments with
TEL (Lopez et al., 1999
), but
disagrees with the results of Baker et al.
(Baker et al., 2001
) who find
that compromised PD function has no significant effect on the transcriptional
repression of YAN. Presumably, this discrepancy reflects the use of the
mammalian Cos7 cell line to study YAN
(Baker et al., 2001
), as
opposed to the more physiologically relevant Drosophila S2 cell line
used in our experiments.
One explanation for how the PD of YAN might be involved in DNA-binding
affinity, transcriptional repression and maintenance of nuclear localization
comes from structural studies of the PD of TEL. This work suggests that DNA
binding and transcriptional repression may be mediated by a PD-PD
homo-oligomeric complex of TEL that wraps the target DNA around itself
(Kim et al., 2001
). Because
the residues necessary for TEL oligomerization are conserved in YAN
(Jousset et al., 1997
), and
YAN has been shown to self-associate via its PD (I. R., unpublished), it is
possible that oligomerization of YAN could be critical for DNA binding/nuclear
localization.
In addition to promoting homotypic YAN-YAN interactions, PD-mediated
binding to heterologous proteins may also influence YAN localization and
activity. MAE, the only protein known to interact with the PD of YAN
(Baker et al., 2001
), appears
to serve such a function. Co-immunoprecipitation experiments confirmed that
MAE can bind to YAN in the absence of signaling, and showed that the complex
is destabilized in the presence of RAS/MAPK activation. However, because MAE
inhibits YAN-mediated transcriptional repression, we expect that, in the
absence of signaling, not all YAN will be bound to MAE. The finding that MAE
can also be co-immunoprecipitated with PNT-P2, suggests a mechanism for
sequestering MAE away from YAN to allow efficient repression and prevent
inappropriate differentiation in the absence of signaling.
Regulation of YAN localization in response to RAS/MAPK activation:
shifting the balance towards nuclear export
Upon activation of the RAS/MAPK cascade, dual phosphorylated MAPK enters
the nucleus and phosphorylates YAN, triggering a cascade of events that
ultimately leads to the removal of transcriptional repression. Recent work by
Baker et al. (Baker et al.,
2001
) demonstrated that MAE is needed for MAPK-mediated
phosphorylation of YAN at Serine 127 in vitro, the same site previously shown
to be critical for initiating YAN downregulation both in cell culture and in
vivo (Rebay and Rubin, 1995
).
Our study sheds new light on the sequence of steps in this process.
We show that CRM1-mediated nuclear export is a necessary step in
downregulation of YAN. How is this achieved? Our results support a model
whereby in response to pathway stimulation, the PNT-P2-MAE complex is
phosphorylated, releasing PNT-P2 to activate transcription and MAE to interact
with YAN. Binding to MAE inhibits the transcriptional repression of YAN (this
work), and may facilitate phosphorylation of serine 127 by activated MAPK
(Baker et al., 2001
), although
the order in which these two events happen remains to be determined. Our data
suggest MAE then plays a third role in presenting YAN to CRM1, thereby
promoting nuclear export.
In support of this model, loss of mae function, both in vivo and
in cell culture, restricts YAN to the nucleus. However, as MAPK
phosphorylation of YAN is a prerequisite for export
(Rebay and Rubin, 1995
) and
requires MAE (Baker et al.,
2001
), our result could simply reflect a failure of YAN to be
phosphorylated. Arguing against this, RNAi of mae also results in
nuclear retention of YANMut ETS, which normally localizes to the
cytoplasm in a CRM1-dependent manner, even in the absence of RAS stimulation.
Thus, in a situation where MAPK phosphorylation is not involved, MAE plays an
active role in presenting YAN to CRM1. We therefore favor the interpretation
that MAE has an essential function in regulating nuclear export, independent
of its earlier postulated role in facilitating MAPK phosphorylation of
YAN.
These same two events mediated by MAE, MAPK phosphorylation and CRM1
recognition of YAN, in turn lead to destabilization of the YAN-MAE complex.
For example, inhibition of CRM1-mediated export results in MAE remaining
nuclear when co-transfected with YAN, even upon RASV12 stimulation.
Because we have shown that MAE localization is not directly regulated by CRM1
or by RAS pathway activation, we interpret this result to indicate that CRM1
is needed to disrupt the YAN-MAE complex. It has recently been shown that in
certain cases, phosphorylation of the cargo protein is necessary for CRM1
recognition (Ishida et al.,
2002
). In agreement with this, in the presence of
RASV12, MAE remains nuclear when expressed with YANACT,
which has all the MAPK phosphoacceptor residues mutated to alanine. This leads
to the model that phosphorylation of YAN, when in the YAN-MAE complex, leads
to interaction with the exportin CRM1. This in turn disrupts the YAN-MAE
complex, with YAN being actively exported by CRM1, and MAE being free to
diffuse uniformly throughout the cell.
A negative feedback loop attenuates PNT-P2 activity in response to
RTK signaling
The ultimate outcome of this complex series of events is abrogation of
YAN-mediated repression of target genes and freeing the promoters for
interaction with POINTED. In unstimulated cells, unphosphorylated PNT-P2
localizes to the nucleus in a complex with MAE, but is effectively out
competed for binding to target gene promoters by YAN
(Flores et al., 2000
;
Halfon et al., 2000
;
Xu et al., 2000
). Upon
activation of the RAS/MAPK cascade, phosphorylation of PNT-P2 transforms it
into a potent transcriptional activator
(O'Neill et al., 1994
). Baker
et al. (Baker et al., 2001
)
show in vitro experiments in which MAE binding to PNT-P2 leads to activation
of transcription, and assume that this occurs via MAE promoting MAPK
phosphorylation, and hence activation, of PNT-P2. However Seidel and Graves
(Seidel and Graves, 2002
)
demonstrate that PNT-P2 contains a MAPK binding site, suggesting PNT-P2
interacts directly with MAPK without requiring a facilitator protein.
Consistent with this second scenario, we find that MAE inhibits PNT-P2
transcriptional activation. However, it is formally possible that MAE could
have dual and antagonistic roles with respect to PNT-P2 regulation, first
stimulating its activity by promoting MAPK phosphorylation and later limiting
its ability to activate transcription. Definitive validation of either model
will require in vivo analysis of the role of MAE with respect to PNT-P2
regulation.
Superficially, this proposed role in antagonizing PNT-P2 function seems to disagree with the finding that loss of mae function suppresses the rough eye phenotype of Sev-RASV12. However, in the absence of MAE, YAN cannot be downregulated. Thus, the effect of loss of mae function on PNT-P2 regulation is irrelevant in this context, as the target sites will still be occupied by YAN. However, the dual function of MAE as both a positive and a negative regulator of RTK signaling may explain the relatively weak suppression of Sev-RASV12 and the fact that it has not been isolated in any of the numerous RTK pathway based genetic modifier screens.
In summary, our data lead to a model (Fig. 7) in which, in unstimulated cells, YAN binds with high affinity to the DNA (Fig. 7A) and blocks PNT-P2 from contacting and activating the promoters of downstream target genes (Fig. 7D). Upon stimulation by RAS, MAPK phosphorylation of YAN and PNT-P2 allows CRM1 to interact with and export YAN, in a process that disrupts YAN and MAE binding (Fig. 7C) and disrupts the PNT-P2-MAE complex, allowing PNT-P2 to bind to the DNA and activate transcription (Fig. 7E). Free MAE could then interact again with PNT-P2, resulting either in its removal from the DNA, inhibition of transcriptional activation or interaction with a phosphatase that returns it to an inactive state (Fig. 7F). Thus, a negative feedback loop would be created to prevent runaway signaling by PNT-P2. An alternative, and not necessarily mutually exclusive, mechanism with respect to PNT-P2, is that the interaction of MAE with PNT-P2 might prevent efficient phosphorylation by MAPK, thereby limiting the pool of activated PNT-P2 and keeping the signaling response in check. It is likely that additional co-factors that bind MAE, YAN and/or PNT-P2 will be required for fine-tuning activation and downregulation in response to changing RTK signaling conditions.
|
Evolutionarily conserved mechanisms of YAN downregulation
Precise regulation of RTK pathway activity appears crucial for achieving a
proper balance between cellular proliferation, differentiation and survival in
all metazoan animals. Excessive or continuous activation of the pathway has
been linked to carcinogenesis in mammals, underscoring the importance of
tightly controlled signaling. For example, numerous deletions and
translocations involving TEL, the mammalian ortholog of YAN, have been
associated with leukemias, and in some cases with solid tumors (reviewed by
Rubnitz et al., 1999
). Our
studies indicate striking similarities between the regulation of TEL and YAN.
Like YAN, TEL localizes to the nucleus
(Poirel et al., 1997
), where
it functions as a transcriptional repressor
(Lopez et al., 1999
). YAN and
TEL both require the PD for maintaining nuclear localization and
transcriptional repression (YAN
N3+PD, this study)
(Chakrabarti et al., 2000
).
Both proteins become phosphorylated in response to activation of signaling
cascades (O'Neill et al.,
1994
; Poirel et al.,
1997
). Although the functional consequences of TEL phosphorylation
remain to be investigated, our results predict that phosphorylation may
downregulate TEL repression activity.
In the context of TEL downregulation, it is interesting to note that no
mammalian orthologs of mae have been identified yet. However, a
second mammalian TEL-like gene, referred to as TEL2 or TELB, has been isolated
(Gu et al., 2001
;
Poirel et al., 2000
). TEL2
also functions as a transcriptional repressor, is capable of oligomerizing
with itself and with TEL, and may thus serve as a regulator of TEL
(Poirel et al., 2000
;
Potter et al., 2000
). Of
particular interest with respect to our work defining the role of MAE, TEL2
encodes six splice variants, one of which, TEL2a, yields a protein with just
the PD (Gu et al., 2001
).
TEL2a closely resembles the structure of MAE, and BLAST results show that the
PD of MAE is most closely related to the PD of TEL2, with 39% identity and 51%
similarity. Thus, it seems likely that TEL2a may regulate TEL activity by a
mechanism similar to that used by MAE for regulating YAN. With respect to the
interactions we have demonstrated between PNT-P2 and MAE, it will be
interesting to investigate whether TEL2a also interacts with and regulates
other PD containing ETS family transcriptional activators, such as ETS1, the
mammalian ortholog of PNT-P2.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Baker, D. A., Mille-Baker, B., Wainwright, S. M., Ish-Horowicz, D. and Dibb, N. J. (2001). Mae mediates MAP kinase phosphorylation of Ets transcription factors in Drosophila. Nature 411,330 -334.[CrossRef][Medline]
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]
Carrere, S., Verger, A., Flourens, A., Stehelin, D. and Duterque-Coquillaud, M. (1998). Erg proteins, transcription factors of the Ets family, form homo, heterodimers and ternary complexes via two distinct domains. Oncogene 16,3261 -3268.[CrossRef][Medline]
Chakrabarti, S. R. and Nucifora, G. (1999). The leukemia-associated gene TEL encodes a transcription repressor which associates with SMRT and mSin3A. Biochem. Biophys. Res. Commun. 264,871 -877.[CrossRef][Medline]
Chakrabarti, S. R., Sood, R., Nandi, S. and Nucifora, G.
(2000). Posttranslational modification of TEL and TEL/AML1 by
SUMO-1 and cell-cycle-dependent assembly into nuclear bodies. Proc.
Natl. Acad. Sci. USA 97,13281
-13285.
Dickson, B. J., van der Straten, A., Dominguez, M. and Hafen, E. (1996). Mutations modulating Raf signaling in Drosophila eye development. Genetics 142,163 -171.[Abstract]
Dittmer, J. and Nordheim, A. (1998). Ets transcription factors and human disease. Biochim. Biophys. Acta 1377,F1 -F11.[Medline]
Fehon, R. G., Kooh, P. J., Rebay, I., Regan, C. L., Xu, T., Muskavitch, M. A. and Artavanis-Tsakonas, S. (1990). Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF homologous genes in Drosophila.Cell 61,523 -534.[CrossRef][Medline]
Fehon, R. G., Johansen, K., Rebay, I. and Artavanis-Tsakonas,
S. (1991). Complex cellular and subcellular regulation of
notch expression during embryonic and imaginal development of
Drosophila: implications for notch function. J. Cell
Biol. 113,657
-669.
Flores, G. V., Duan, H., Yan, H., Nagaraj, R., Fu, W., Zou, Y., Noll, M. and Banerjee, U. (2000). Combinatorial signaling in the specification of unique cell fates. Cell 103, 75-85.[CrossRef][Medline]
Fornerod, M., Ohno, M., Yoshida, M. and Mattaj, I. W. (1997). CRM1 is an export receptor for leucine-rich nuclear export signals. Cell 90,1051 -1060.[CrossRef][Medline]
Gabay, L., Scholz, H., Golembo, M., Klaes, A., Shilo, B. Z. and Klambt, C. (1996). EGF receptor signaling induces pointed P1 transcription and inactivates Yan protein in the Drosophila embryonic ventral ectoderm. Development 122,3355 -3362.[Abstract]
Gu, X., Shin, B.-H., Akbarali, Y., Weiss, A., Boltax, J.,
Oettgen, P. and Libermann, T. A. (2001). Tel-2 is a novel
transcriptional repressor related to the Ets factor Tel/ETV-6. J.
Biol. Chem. 276,9421
-9436.
Halfon, M. S., Carmena, A., Gisselbrecht, S., Sackerson, C. M., Jimenez, F., Baylies, M. K. and Michelson, A. M. (2000). Ras pathway specificity is determined by the integration of multiple signal-activated and tissue-restricted transcription factors. Cell 103,63 -74.[CrossRef][Medline]
Hsu, T. and Schulz, R. A. (2000). Sequence and functional properties of Ets genes in the model organism Drosophila. Oncogene 19,6409 -6416.[CrossRef][Medline]
Ishida, N., Hara, T., Kamura, T., Yoshida, M., Nakayama, K. and
Nakayama, K. I. (2002). Phosphorylation of p27Kip1 on serine
10 is required for its binding to CRM1 and nuclear export. J. Biol.
Chem. 277,14355
-14358.
Jousset, C., Carron, C., Boureux, A., Quang, C. T., Oury, C., Dusanter-Fourt, I., Charon, M., Levin, J., Bernard, O. and Ghysdael, J. (1997). A domain of TEL conserved in a subset of ETS proteins defines a specific oligomerization interface essential to the mitogenic properties of the TEL-PDGFR beta oncoprotein. EMBO J. 16, 69-82.[CrossRef][Medline]
Kalderon, D., Roberts, B. L., Richardson, W. D. and Smith, A. E. (1984). A short amino acid sequence able to specify nuclear location. Cell 39,499 -509.[CrossRef][Medline]
Karim, F. D., Chang, H. C., Therrien, M., Wassarman, D. A., Laverty, T. and Rubin, G. M. (1996). A screen for genes that function downstream of Ras1 during Drosophila eye development. Genetics 143,315 -329.[Abstract]
Kim, C. A., Phillips, M. L., Kim, W., Gingery, M., Tran, H. H., Robinson, M. A., Faham, S. and Bowie, J. U. (2001). Polymerization of the SAM domain of TEL in leukemogenesis and transcriptional repression. EMBO J. 20,4173 -4182.[CrossRef][Medline]
Klambt, C. (1993). The Drosophila gene
pointed encodes two ETS-like proteins which are involved in the
development of the midline glial cells. Development
117,163
-176.
Kodandapani, R., Pio, F., Ni, C. Z., Piccialli, G., Klemsz, M., McKercher, S., Maki, R. A. and Ely, K. R. (1996). A new pattern for helix-turn-helix recognition revealed by the PU.1 ETS-domain-DNA complex. Nature 380,456 -460.[CrossRef][Medline]
Lai, Z. C. and Rubin, G. M. (1992). Negative control of photoreceptor development in Drosophila by the product of the yan gene, an ETS domain protein. Cell 70,609 -620.[CrossRef][Medline]
Lai, Z. C., Fetchko, M. and Li, Y. (1997). Repression of Drosophila photoreceptor cell fate through cooperative action of two transcriptional repressors Yan and Tramtrack. Genetics 147,1131 -1137.[Abstract]
Lopez, R. G., Carron, C., Oury, C., Gardellin, P., Bernard, O.
and Ghysdael, J. (1999). TEL is a sequence-specific
transcriptional repressor. J. Biol. Chem.
274,30132
-30138.
Marshall, C. J. (1994). MAP kinase kinase kinase, MAP kinase kinase and MAP kinase. Curr. Opin. Genet. Dev. 4,82 -89.[CrossRef][Medline]
O'Neill, E. M., Rebay, I., Tjian, R. and Rubin, G. M. (1994). The activities of two Ets-related transcription factors required for Drosophila eye development are modulated by the Ras/MAPK pathway. Cell 78,137 -147.[CrossRef][Medline]
Pascal, E. and Tjian, R. (1991). Different
activation domains of Sp1 govern formation of multimers and mediate
transcriptional synergism. Genes Dev.
5,1646
-1656.
Poirel, H., Lopez, R. G., Lacronique, V., Della Valle, V., Mauchauffe, M., Berger, R., Ghysdael, J. and Bernard, O. A. (2000). Characterization of a novel ETS gene, TELB, encoding a protein structurally and functionally related to TEL. Oncogene 19,4802 -4806.[CrossRef][Medline]
Poirel, H., Oury, C., Carron, C., Duprez, E., Laabi, Y., Tsapis, A., Romana, S. P., Mauchauffe, M., le Coniat, M., Berger, R., Ghysdael, J. and Bernard, O. A. (1997). The TEL gene products: nuclear phosphoproteins with DNA binding properties. Oncogene 14,349 -357.[CrossRef][Medline]
Potter, M. D., Buijs, A., Kreider, B., van Rompaey, L. and
Grosveld, G. C. (2000). Identification and characterization
of a new human ETS-family transcription factor, TEL2, that is expressed in
hematopoietic tissues and can associate with TEL1/ETV6.
Blood 95,3341
-3348.
Price, M. D. and Lai, Z. (1999). The yan gene is highly conserved in Drosophila and its expression suggests a complex role throughout development. Dev. Genes Evol. 209,207 -217.[CrossRef][Medline]
Rebay, I. and Rubin, G. M. (1995). Yan functions as a general inhibitor of differentiation and is negatively regulated by activation of the Ras1/MAPK pathway. Cell 81,857 -866.[CrossRef][Medline]
Rebay, I., Fehon, R. G. and Artavanis-Tsakonas, S. (1993). Specific truncations of Drosophila Notch define dominant activated and dominant negative forms of the receptor. Cell 74,319 -329.[CrossRef][Medline]
Rebay, I., Chen, F., Hsiao, F., Kolodziej, P. A., Kuang, B. H.,
Laverty, T., Suh, C., Voas, M., Williams, A. and Rubin, G. M.
(2000). A genetic screen for novel components of the
Ras/Mitogen-activated protein kinase signaling pathway that interact with the
yan gene of Drosophila identifies split ends, a new RNA recognition
motif-containing protein. Genetics
154,695
-712.
Rechsteiner, M. and Rogers, S. W. (1996). PEST sequences and regulation by proteolysis. Trends Biochem. Sci. 21,267 -271.[CrossRef][Medline]
Rubnitz, J. E., Pui, C. H. and Downing, J. R. (1999). The role of TEL fusion genes in pediatric leukemias. Leukemia 13,6 -13.[CrossRef][Medline]
Seidel, J. J., and Graves, B. J. (2002). An
ERK2 docking site in the Pointed domain distinguishes a subset of ETS
transcription factors. Genes Dev.
16, 127-37.
Simon, M. A., Bowtell, D. D., Dodson, G. S., Laverty, T. R. and Rubin, G. M. (1991). Ras1 and a putative guanine nucleotide exchange factor perform crucial steps in signaling by the sevenless protein tyrosine kinase. Cell 67,701 -716.[CrossRef][Medline]
Tan, P. B. and Kim, S. K. (1999). Signaling specificity: the RTK/RAS/MAP kinase pathway in metazoans. Trends Genet 15,145 -149.[CrossRef][Medline]
Tomlinson, A., Bowtell, D. D., Hafen, E. and Rubin, G. M. (1987). Localization of the sevenless protein, a putative receptor for positional information, in the eye imaginal disc of Drosophila. Cell 51,143 -150.[CrossRef][Medline]
Wen, W., Meinkoth, J. L., Tsien, R. Y. and Taylor, S. S. (1995). Identification of a signal for rapid export of proteins from the nucleus. Cell 82,463 -473.[CrossRef][Medline]
Wolff, B., Sanglier, J. J. and Wang, Y. (1997). Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo-cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV-1) Rev protein and Rev-dependent mRNA. Chem. Biol. 4,139 -147.[CrossRef][Medline]
Xu, C., Kauffmann, R. C., Zhang, J., Kladny, S. and Carthew, R. W. (2000). Overlapping activators and repressors delimit transcriptional response to receptor tyrosine kinase signals in the Drosophila eye. Cell 103,87 -97.[CrossRef][Medline]
Yang, B. S., Hauser, C. A., Henkel, G., Colman, M. S., van Beveren, C., Stacey, K. J., Hume, D. A., Maki, R. A. and Ostrowski, M. C. (1996). Ras-mediated phosphorylation of a conserved threonine residue enhances the transactivation activities of c-Ets1 and c-Ets2. Mol. Cell Biol. 16,538 -547.[Abstract]
Zipursky, S. L. and Rubin, G. M. (1994). Determination of neuronal cell fate: lessons from the R7 neuron of Drosophila. Annu. Rev. Neurosci. 17,373 -397.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. G. Roukens, M. Alloul-Ramdhani, S. Moghadasi, M. Op den Brouw, and D. A. Baker Downregulation of Vertebrate Tel (ETV6) and Drosophila Yan Is Facilitated by an Evolutionarily Conserved Mechanism of F-Box-Mediated Ubiquitination Mol. Cell. Biol., July 1, 2008; 28(13): 4394 - 4406. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. McNeill, G. M. Craig, and J. M. Bateman Regulation of Neurogenesis and Epidermal Growth Factor Receptor Signaling by the Insulin Receptor/Target of Rapamycin Pathway in Drosophila Genetics, June 1, 2008; 179(2): 843 - 853. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Roukens, M. Alloul-Ramdhani, A. C. O. Vertegaal, Z. Anvarian, C. I. A. Balog, A. M. Deelder, P. J. Hensbergen, and D. A. Baker Identification of a New Site of Sumoylation on Tel (ETV6) Uncovers a PIAS-Dependent Mode of Regulating Tel Function Mol. Cell. Biol., April 1, 2008; 28(7): 2342 - 2357. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-Z. Shilo Regulating the dynamics of EGF receptor signaling in space and time Development, September 15, 2005; 132(18): 4017 - 4027. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Sundaram The love-hate relationship between Ras and Notch Genes & Dev., August 15, 2005; 19(16): 1825 - 1839. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Song, M. Nie, F. Qiao, J. U. Bowie, and A. J. Courey Antagonistic regulation of Yan nuclear export by Mae and Crm1 may increase the stringency of the Ras response Genes & Dev., August 1, 2005; 19(15): 1767 - 1772. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mutsuddi, B. Chaffee, J. Cassidy, S. J. Silver, T. L. Tootle, and I. Rebay Using Drosophila to Decipher How Mutations Associated With Human Branchio-Oto-Renal Syndrome and Optical Defects Compromise the Protein Tyrosine Phosphatase and Transcriptional Functions of Eyes Absent Genetics, June 1, 2005; 170(2): 687 - 695. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Qiao and J. U. Bowie The Many Faces of SAM Sci. Signal., May 31, 2005; 2005(286): re7 - re7. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Foulds, M. L. Nelson, A. G. Blaszczak, and B. J. Graves Ras/Mitogen-Activated Protein Kinase Signaling Activates Ets-1 and Ets-2 by CBP/p300 Recruitment Mol. Cell. Biol., December 15, 2004; 24(24): 10954 - 10964. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Miley, D. Fantz, D. Glossip, X. Lu, R. M. Saito, R. E. Palmer, T. Inoue, S. van den Heuvel, P. W. Sternberg, and K. Kornfeld Identification of Residues of the Caenorhabditis elegans LIN-1 ETS Domain That Are Necessary for DNA Binding and Regulation of Vulval Cell Fates Genetics, August 1, 2004; 167(4): 1697 - 1709. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gallio, C. Englund, P. Kylsten, and C. Samakovlis Rhomboid 3 orchestrates Slit-independent repulsion of tracheal branches at the CNS midline Development, August 1, 2004; 131(15): 3605 - 3614. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Prescott, K. S. N. Koto, M. Singh, and A. Gutierrez-Hartmann The ETS Transcription Factor ESE-1 Transforms MCF-12A Human Mammary Epithelial Cells via a Novel Cytoplasmic Mechanism Mol. Cell. Biol., June 15, 2004; 24(12): 5548 - 5564. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Le Gallic, L. Virgilio, P. Cohen, B. Biteau, and G. Mavrothalassitis ERF Nuclear Shuttling, a Continuous Monitor of Erk Activity That Links It to Cell Cycle Progression Mol. Cell. Biol., February 1, 2004; 24(3): 1206 - 1218. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||