spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

doi: 10.1242/10.1242/dev.00323


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Emerald, B. S.
Right arrow Articles by Cohen, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Emerald, B. S.
Right arrow Articles by Cohen, S. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 130, 1171-1180 (2003)
Copyright © 2003 The Company of Biologists Limited

distal antenna and distal antenna related encode nuclear proteins containing pipsqueak motifs involved in antenna development in Drosophila

B. Starling Emerald1,*,{dagger}, Jennifer Curtiss2,{dagger}, Marek Mlodzik2 and Stephen M. Cohen1,{ddagger}

1 Developmental Biology Programme, European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg, Germany
2 Department of Molecular Cell and Developmental Biology, Mount Sinai School of Medicine, 1 Gustave Levy Place, New York NY 10029, USA
* Present address: Institute of Molecular and Cell Biology, 30 Medical Drive, 117609 Singapore

{ddagger} Author for correspondence (e-mail: cohen{at}embl-heidelberg.de)

Accepted 29 November 2002


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Legs and antennae are considered to be homologous appendages. The fundamental patterning mechanisms that organize spatial pattern are conserved, yet appendages with very different morphology develop. A genetic hierarchy for specification of antennal identity has been partly elucidated. We report identification of a novel family of genes with roles in antennal development. The distal antenna (dan) and distal antenna-related (danr) genes encode novel nuclear proteins that are expressed in the presumptive distal antenna, but not in the leg imaginal disc. Ectopic expression of dan or danr causes partial transformation of distal leg structure toward antennal identity. Mutants that remove dan and danr activity cause partial transformation of antenna toward leg identity. Therefore we suggest that dan and danr contribute to differentiation of antenna-specific characteristics. Antenna-specific expression of dan and danr depends on a regulatory hierarchy involving homothorax and Distal-less, as well as cut and spineless. We propose that dan and danr are effector genes that act downstream of these genes to control differentiation of distal antennal structures.

Key words: Patterns formation, Drosophila, Antennae, Homothorax, Distal-less, Antennapedia, Spineless


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The appendages of Drosophila are derived from imaginal discs, which proliferate during the larval stages and differentiate during the pupal stage to give rise to the adult structures. Segment-specific identity of the appendages is controlled through the action of homeotic selector genes. Homeotic genes are considered to be the genetic switches that govern the choice between alternative developmental programs leading, for example, to leg or antenna development. Antenna and leg are considered to be homologous structures because they can be interconverted through the action of homeotic genes (Gehring, 1966Go). For example, ectopic expression of Antennapedia (Antp) or other homeotic genes can transform antenna to leg (Gibson and Gehring, 1988Go; Struhl, 1981a; Yao et al., 1999Go; Zeng et al., 1993Go). By contrast, the antenna appears to develop without any input from homeotic genes (Kaufman et al., 1990Go). Indeed, mutants that lack the entire HOM-C complex in the flour beetle tribolium produce embryos in which all segments bear antenna-like appendages (Beeman, 1987Go; Stuart et al., 1991Go).

How is antennal identity specified? The homothorax (hth) and Distal-less (Dll) genes have been shown to play a role in antenna development. Dll encodes a homeodomain protein expressed in distal leg and antenna that is required for development of distal structures in both appendages (Cohen et al., 1989Go; Diaz-Benjumea et al., 1994Go; Gorfinkiel et al., 1997Go). Hypomorphic mutations that reduce Dll activity cause transformation of antenna into leg (Cohen and Jürgens, 1989aGo; Cohen and Jürgens, 1989bGo). hth encodes a TALE-type homeodomain protein expressed in the proximal parts of all imaginal discs. Hth protein promotes nuclear localization of the PBC-class homeodomain protein Extradenticle (Kurant et al., 1998Go; Pai et al., 1998Go; Rieckhof et al., 1997Go). In leg and wing discs, Hth is expressed and required only in proximal structures (Azpiazu and Morata, 2000Go; Casares and Mann, 1998Go; Casares and Mann, 2000Go; Wu and Cohen, 1999Go). A similar role has been proposed for the vertebrate Hth protein MEIS in limb development (Mercader et al., 1999Go). In contrast to the situation in the leg, Hth and Dll expression overlap extensively in the antenna. This overlap has been linked to antenna identity based on the observation that co-expression of Hth and Dll can induce formation of antennal structures in the proximal regions of the wing and leg discs (Casares and Mann, 1998Go; Dong et al., 2000Go).

The spineless (ss) gene has been implicated in control of antennal identity. ss mutants cause transformation of distal antenna to leg (Struhl, 1982Go). ss encodes a bHLH PAS domain transcription factor, homologous to the mammalian dioxin receptor (Duncan et al., 1998Go). ss is expressed transiently in distal domains of the leg and antenna discs during the second larval instar, but is maintained only in the distal antenna. This difference is ss regulation depends on the activity of Hth and Dll (Dong et al., 2002Go). Ectopic expression of ss in the leg can cause transformation towards antenna, indicating that ss expression in an important determinant of antenna identity (Duncan et al., 1998Go). The cut gene is also expressed differentially in leg and antenna (Dong et al., 2002Go), and when misexpressed in distal antenna has been shown to cause misexpression of Antennapedia and concomitant transformation towards leg (Johnston et al., 1998Go).

Although several genes have been implicated in antenna development on the basis of mutant phenotypes and differential expression (Duncan et al., 1998Go; Dong et al., 2002Go), our understanding of the control of antennal identity remains incomplete. We report the identification of two genes, distal antenna (dan) and distal antenna related (danr) that play roles in antennal development. dan and danr encode nuclear proteins that are expressed in the distal antenna imaginal disc, but not in leg. We present evidence that Hth and Dll control Dan and Danr expression through regulation of ss and cut. Loss of Dan and Danr function causes defects in antenna development and partial transformation of distal antennal structures towards leg. Ectopic expression of these genes in the leg disc causes transformation of distal leg to antenna. These findings implicate Dan and Danr as downstream effectors of ss in the specification of distal elements of the antenna.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Drosophila stocks
Strains used are described in the following references: Act5C>CD2>Gal4 (Pignoni and Zipursky, 1997Go), ct145, UAS-cut (Johnston et al., 1998Go), UAS-Dll (Wu and Cohen, 1999Go), DllGal4 (Gorfinkiel et al., 1997Go), hthC1 (Rieckhof et al., 1997Go), UAS-hth12 (Pai et al., 1998Go), dppGal4 (Morimura et al., 1996Go), ss1114.4 and UAS-ss (Duncan et al., 1998Go). For others, see http//www.flybase.bio.indiana.edu.82. The dan ORF was PCR amplified from EST LD02250 using the primers 5'-AAACATATGAACATCCGCATGGGC and 5'-CTTTGAGCTCTTGCGACGGCGACT and cloned as a NotI-XhoI fragment into pUAST (Brand and Perrimon, 1993Go). The danr ORF lacks introns and was PCR amplified from genomic DNA using the primers: 5'-AGAAATGAATTCATGGATATCTCCGCCTAC and 5'-TATAATCTCGAGTGTCTACTGTTCGGCGTC and cloned as an EcoRI-XhoI fragment into pUAST.

Isolation of mutants
For danrex35 and dan,danrex56, EPg-35635 and EPg-J3-220 were recombined onto the same chromosome. Flies containing the recombinant chromosome were identified by their darker eyes, resulting from the presence of mini-w+ genes from each EPg-element. They were obtained at a rate of one in approximately 200,000 screened. Standard methods were used to obtain flies from which both EPg-elements were excised, and whose eyes were therefore white. Fragments containing the breakpoints of the EPg-element excisions were obtained by PCR and sequenced. Sequence of primers for EPg 35635 breakpoints were GATTCGCAACCCAAAAGTGCAACC and ACTATGAACTACAACTACAACTA. Sequence of primers for EPg J3-220 breakpoints were ATTGCGTCGTCTTCGTTGCA and TAAAGTCGCACGTCCACGAA. Some of the double excisions removed the entire sequence between the two EPg-elements; breakpoints for these were obtained using a forward primer upstream of EPg-35635 and a reverse primer downstream of EPg J3-220. Sequence of primers for large deletion breakpoints were GATTCGCAACCCAAAAGTGCAACC and TCTTGTGTCACCAATTCTTCA. The resulting products were sequenced along with the rest. The danrex35 single mutant is missing 314 bp of genomic DNA, including the EPg 35635 insertion point and extending 126 bp into the danr ORF. Sequences surrounding the EPg J3-220 excision point in danrex35 mutant DNA are completely wild type.

An EMS screen was carried out to isolate dan mutations. Male flies carrying EPgJ3-220 were mutagenized with 25 mM EMS and crossed to SdGal4 females. The EMS induced revertant danems3 was isolated by virtue of having normal wings, despite having overexpressed dan. danems3 DNA was cloned from homozygous mutant larvae by PCR using the following primer pairs:

Sequence analysis identified a single nucleotide alteration.

Genetic mosaics
Genotypes of larvae for danr mutant clones:

Genotypes of larvae for dan danr mutant clones:

hth mutant clones:

Dll mutant clones:

cut mutant clones:

Genotypes of larvae for ectopic expression clones:

Antibodies
The Dan ORF was PCR amplified (primers AAACATATGAACATCCGCATGGGC and CTTTGAGCTCTTGCGACGGCGACT) and cloned into pET23a (Novagen) using NdeI and SacI. The Danr ORF was PCR amplified (primers: AGAAATGAATTCATGGATATCTCCGCCTAC and TATAATGTAGGGCTCGAGCCTGTTCGGCGTC) and cloned into pET23a using EcoRI and XhoI. The C-terminally HIS-tagged fusion proteins were expressed in bacteria and purified by Ni2+ affinity chromatography under denaturing conditions. Rats and mice were immunized using RIBI adjuvant at 3-week intervals. Antisera were evaluated by immunostaining imaginal discs. Mouse anti-Antp is described elsewhere (Condie et al., 1991Go). Mouse anti-Cut (Blochlinger et al., 1990Go), Rabbit anti-Hth (Kurant et al., 1998Go), rat anti-Dll (Wu and Cohen, 2000Go) and mouse monoclonal anti-Dll (Duncan et al., 1998Go) were also used.

RNA interference
Dan
A 1.2 kb fragment of the dan coding sequence was PCR amplified and cloned as an EcoRI fragment into SympUAST for Gal4 dependent expression of double stranded RNA (Giordano et al., 2002Go).


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ectopic expression of dan and danr induces leg to antenna transformation
distal antenna (dan) and distal antenna related (danr) were identified in a large-scale modular misexpression screen of ~8500 EPg elements (Mata et al., 2000Go), as insertions that caused abnormalities in wing development when expressed under sdGal4 control and small rough eyes when expressed under eyGal4 control (not shown). Expression of dan using EPg J3-220, under control of DllGal4 caused transformation of distal leg structures toward distal antennal identity (Fig. 1A,B). The claws, found on the tip of the fifth tarsal segment, were transformed into the distal-most part of the antenna, the arista (compare with the antenna in Fig. 1E.). In addition, there was some overall morphological abnormality of the tarsal region. Expression of danr from EPg35635 using DllGal4 caused loss of the claws but did not produce an overt transformation to arista (not shown).



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 1. Expression of Dan and Danr induces leg to antenna transformation. (A) Cuticle preparation showing wild-type tarsal segments and claws. (B) Scanning EM of the distal leg of a DllGal4 EPg3-220 fly. Note the absence of claws and presence of two aristae (arrow). Note that each claw produced an arista when Dan was expressed. In contrast to the leg, the antenna disc is not separated into A and P compartments by a lineage restriction until larval stages. The distalmost elements of A and P origin probably merge in antenna to make a single arista, which they cannot do in leg. (C,D) Distal legs from dppGal4 UAS-dan and dppGal4 UAS-danr animals. One claw was replaced by an arista in each case (arrows). (E) Wild-type antenna.

 

EPg J3-220 and EPg 35635 lie approximately 45 kb apart on chromosome 3R, 263 bp and 39 bp upstream of the predicted genes, CG11849 and CG13651 (Fig. 2A). To verify that the predicted genes tagged by the EP-element insertions were responsible for the observed overexpression phenotypes, we generated UAS-dan and UAS-danr transgenic strains. Six independent UAS-dan transformants and five independent UAS-danr transformants were tested and found to be lethal when expressed with the DllGal4 driver. However when expressed using dppGal4, UAS-dan and UAS-danr showed distal leg to antenna transformation (Fig. 1C,D). Molecular markers of antennal identity were also examined in the imaginal discs. The zinc-finger protein Spalt is expressed in antenna, but not in leg discs (Wagner-Bernholz et al., 1991Go). Ectopic expression of dan can induce limited expression of Spalt in the leg disc (not shown), consistent with the observed transformation toward antennal identity. These observations suggested a role for dan and danr in specification of the identity of distal antennal structures.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 2. EPg J3-220 and EPg 35635 target the dan and danr genes, which encode related pipsqueak-motif-containing proteins. (A) (Top) the genomic region containing the dan and danr genes. The insertion points of EPg J3-220 and EPg 35635 (green triangles) lie ~45 kb apart. Predicted genes in the region are shown in blue. (Middle) Red arrowheads indicate the positions of the primer pairs used for genomic PCR to determine the breakpoints of excision mutations; broken red lines between each primer pair indicate the predicted wild-type sizes of the genomic PCR fragments. (Bottom) Boxes show the extent of the genomic regions deleted in the dan danrex56 and danrex35 alleles. (B) Alignment of the Dan and Danr sequences showing regions of similarity. Note that the two proteins are most similar at the N terminus. The amino acid change in danems3 is indicated in red above the alignment. (C) Alignment of pipsqueak motifs from Dan, Danr, Drosophila Pipsqueak, and the transposases Drosophila Pogo and human CENP-B. Asterisks below the alignment indicate identical residues; colons and periods indicate conserved residues (ClustalW). The arrow indicates the residue mutated in danems3.

 

Dan and Danr encode proteins containing pipsqueak motifs
The predicted proteins encoded by dan and danr are similar, showing 25% identity overall (Fig. 2B). This similarity extended through the entire sequence. In addition, Dan has a C-terminal extension of more than 200 amino acids. The most conserved region is a 64 amino acid sequence beginning with the N terminus, where Dan and Danr share 92% identity. Within this region, both Dan and Danr contain the newly identified `pipsqueak' motif (Siegmund et al., 2002), a helix-turn-helix structure that is likely to be involved in DNA binding (Fig. 2C). Outside the pipsqueak motif, the Dan and Danr proteins contain no regions of significant sequence similarity to other known proteins but show short blocks of strong similarity to each other (Fig. 2B) (F. Ciccarelli and P. Bork, personal communication).

Dan and Danr expression in the distal antenna imaginal disc
Antibodies were raised to the predicted Dan and Danr proteins. Both are nuclear proteins, expressed in the eye-antenna disc (Fig. 3A,B). Double labeling with anti-Dan and anti-Danr showed that the two proteins are co-expressed in the antenna (Fig. 3B). Both proteins are also expressed in the brain and the eye region of the eye-antenna disc (not shown, Fig. 3A). Antibody labeling of other imaginal discs showed limited Dan expression in small groups of cells in leg (Fig. 3C) and wing (not shown). These appear in the location of prominent sense organ progenitors at relatively late stages of disc development. Danr was not detected in other discs.



View larger version (98K):
[in this window]
[in a new window]
 
Fig. 3. Dan and Danr expression. (A) Eye-antenna disc showing Dan protein expression. (B) Dan (green) and Danr (red) expression in the antenna region of an eye-antenna disc. (C) Dan expression in the leg disc. A small group of cells in the location of sense organ precursors are labeled late in development. (D) Dan and Hth (red) expression in the antenna. (E) Dan and Dll (blue) expression in the antenna. (F) Dan and Cut (purple) in the antenna. An optical cross-section across the region indicated by the arrow is shown below. (G) Schematic representation of the expression domains of Hth, Dll, Cut, Dan/Danr and the inferred domain of spineless (SS) expression with reference to antenna segments.

 

To define the domain of Dan and Danr expression in the antenna, a series of double labeling experiments were performed with antibodies to other antennal proteins. Homothorax (Hth) is expressed in the presumptive head capsule and in antennal segments A1 to A3 (Casares and Mann, 1998Go). Hth overlaps with the proximal part of the Dan domain (Fig. 3D). Distal-less (Dll) is expressed in a distal domain comprising A2, A3 and the arista (Diaz-Benjumea et al., 1994Go). Dll overlaps the Dan domain, but extends further proximally. Cut is expressed in the proximal part of the antenna (Johnston et al., 1998Go), in a domain that does not overlap expression of Dan (Fig. 3F). In optical cross-section there appears to be one row of cells with low expression of Dan at the interface between these domains. The domain of Dan/Danr expression appears to coincide with the domain in which expression of ss transcript has been reported (Duncan et al., 1998Go). Antibody to Spineless protein is not available, precluding a more precise comparison.

The relationship between Dan, Hth and Dll expression suggests that the Dan domain corresponds to segment A3 and the arista and that Cut is expressed in A1 and A2 as well as the head capsule. Thus, in addition to the broadly overlapping domains of Hth and Dll, the antenna is subdivided into adjacent and perhaps mutually exclusive proximal and distal domains reflected by ss, Cut and Dan/Danr expression (Fig. 3G). Although we favor the view that the reciprocal expression of Dan/Danr and Cut is likely to define the border between antenna segments A2 and A3, we note that it is difficult to be precise about the location of the border before overt segmentation. The possibility exists that Dan and ss expression may extend into distal A2.

Regulation of Dan by hth and Dll
The overlap between Hth and Dll has been proposed to define antennal identity, because co-expression of the two proteins in ectopic locations can induce formation of ectopic arista structures in other discs (Casares and Mann, 1998Go; Dong et al., 2000Go). To ask whether Hth and Dll have a role in defining the non-overlapping expression domains of Cut and Dan/Danr, we examined clones of cells lacking hth or Dll activity in the antenna. Dan expression was lost in cells mutant for hthc1 in the region where the two expression domains overlap (Fig. 4A). This suggests that Hth activity is required for Dan expression. Likewise, clones of cells lacking Dll activity lost Dan expression in the distal region of the disc (Fig. 4B). We noted that many Dll mutant clones were found adjacent to the edge of the Dan domain (arrows, Fig. 4B), suggesting that loss of Dan may cause these clones to sort out proximally. Thus both Dll and Hth are required for Dan expression.



View larger version (103K):
[in this window]
[in a new window]
 
Fig. 4. Regulation of Dan by Hth and Dll. (A) Dan expression in hthc1 mutant clones. (Boxed region) The three channels are shown separately at right. The clone was marked by the absence of GFP (green) and Hth protein (red). (B) Dan expression in DllSA1 mutant clones. The three channels are shown separately on the right of the region indicated by an arrowhead. The clone was marked by the absence of GFP (green) and Dll protein (red). Other Dll mutant clones sorted out towards the edge of the Dan domain (arrows). (C) Ectopic expression of Dan (blue) in the distal leg when Hth was misexpressed (Hth expression was marked by co-expression of GFP. Hth-expressing cells sort out from the distal region by this stage (see Wu and Cohen, 1999Go). Dan expression shown alone in the inset. (D) Ectopic expression (arrow) of Dan (green) in the proximal leg [overlapping Hth (red)], when Dll was misexpressed (Dll not shown).

 

Ectopic expression of Hth in the leg disc under dppGal4 control, induced Dan expression in distal, Dll-expressing cells (Fig. 4C). Based on earlier work (Wu and Cohen, 1999Go), we know that Hth-expressing cells sort out from the distal region of the disc. This is also visible in the GFP labeled cells in Fig. 4C. Nonetheless, dppGal4 directed expression of Hth induced Dan expression in distal cells. This raises the possibility of a non-autonomous effect of Hth expression leading to sustained Dan expression. Ectopic expression of Dll in the leg disc under dppGal4 control, induced Dan expression in proximal, Hth-expressing cells (Fig. 4D). In this case, ectopic Dan was limited to cells expressing the Gal4 driver.

These observations indicate that the regulatory relationship between Hth, Dll and Dan (Danr) is complex. Dll and Hth are each required for Dan expression. However, it is clear that Dan is not expressed in every cell in which Hth and Dll are co-expressed in the antenna. All Dan-expressing distal antenna cells express Dll but not all express Hth. Our observations point to a non-autonomous effect of Hth on Dan expression, which may explain how Hth can be required for sustained expression of Dan in distal cells where Hth is not expressed.

Regulation of Dan by ss and cut
ss is expressed in the distal antenna in a domain similar to that of Dan/Danr (Duncan et al., 1998Go). ss mutants cause transformation of distal antenna to tarsus, suggesting a role in antennal identity (Burgess and Duncan, 1990Go; Struhl, 1982Go). To ask whether ss regulates Dan and Danr, we examined antenna discs from spinelessaristapedia (ssa) mutants. ssa alleles appears to be reduce ss activity specifically in the antenna. Dan expression was lost from the distal part of ssa mutant antennal discs (Fig. 5A). Loss of Dan expression in ssa mutant antenna discs coincided with ectopic expression of Antennapedia (Fig. 5B). We note that these expression domains appear to be non-overlapping. Ectopic expression of Antennapedia has been shown previously to be sufficient to cause transformation of antenna to leg (Gibson and Gehring, 1988Go). The observation of ectopic Antp in the distal part of the third antennal segment (within the Dan domain) may explain the homeotic transformation of distal A3 and arista in the ss mutant. We next asked whether ss was sufficient to induce Dan and Danr expression in the leg disc. Ectopic expression of ss in randomly positioned clones of cells caused expression of Dan and Danr in the wing and leg discs (Fig. 5C and not shown). These observations suggest that ss defines the domain of Dan and Danr expression.



View larger version (102K):
[in this window]
[in a new window]
 
Fig. 5. Regulation of Dan by ss and Cut. (A) Dll and Dan expression in a spinelessaristapedia mutant antenna. Note the partial loss of Dan expression. (B) Loss of Dan expression in a spinelessaristapedia mutant antenna correlates with ectopic Antp expression (red). (C) Regions of a wing and leg disc. Ectopic expression of ss in clones of Gal4-expressing cells (labeled by co-expression of GFP, shown in red) induced ectopic Dan expression (green). (D) Ectopic ss expression in the antenna under ptcGAL4 control repressed Cut (purple) and caused ectopic expression of Dan (green). Arrow and arrowhead show reduced Cut expression where ss was expressed. (E) Dan expression in cut145 mutant clones (marked by the absence of ß-gal, red). Boxed area: Dan and Dan + Dll expression shown at higher magnification at right. Arrow indicates mutant clone in which Dan was not ectopically expressed proximally.

 

Next, we examined the relationship between ss and Cut. Ectopic expression of ss using ptcGal4 caused ectopic expression of Dan and repression of Cut expression (Fig. 5D). Repression of Cut was stronger on one side of the disc (arrow versus arrowhead) and was associated with antenna duplication. Dan was repressed in the region indicated by the arrow in multiple optical sections, indicating that this is not an artifact of the abnormal folding of the disc. Ectopic expression of Dan or Danr had no effect on Cut expression (not shown), suggesting that ss may act directly to regulate Cut. The ability of ss to repress Cut, contrasts with the observation by Dong et al. (Dong et al., 2002Go) that cut expression is normal in ss mutants. It is possible that there are redundant mechanisms for Cut repression, one of which is mediated by ss.

To ask whether Cut regulates Dan and Danr expression we examined clones of cells lacking cut activity, generated using the null allele cut145 and the FLP-FRT system. cut145 mutant clones did not cause ectopic expression of Dan in proximal regions of the antenna disc (arrow, Fig. 5E), but did show limited expansion of the Dan domain in the region where Dll is expressed (inset, Fig. 5E). We observed comparable effects on Danr expression in cut mutant clones (not shown). Ectopic expression of Cut in the Dan domain using Act>CD2>Gal4 caused repression of Dan (not shown).

Taken together these results suggest that distal expression of ss limits the expression domain of Cut to the proximal antenna. ss is required for Dan and Danr expression in distal antenna. At present it is not possible to determine whether expression of Dan and Danr in response to ss is mediated directly or indirectly by repression of Cut. However, we favor the view that it is direct because removal of Cut did not cause extensive ectopic expression of Dan.

dan and danr are required for distal antennal identity
ss mutants lead to ectopic expression of Antennapedia and concomitant loss of Dan/Danr expression (Fig. 5) and cause a strong phenotypic transformation of distal A3 and arista to tarsus (Fig. 6A,B). To determine whether morphological transformation depends on loss of Dan/Danr, we made use of Gal4 to direct Dan expression in the ss mutant discs. As shown in Fig. 6C, ptcGal4 directed expression of Dan caused strong suppression of the arista-to-tarsus transformation in the ss mutant antenna. ptcGal4 is expressed in a stripe of cells adjacent to the AP boundary in the antenna region of the disc. Dan expression did not repress ectopic expression of Antp in the ptcGal4 stripe of the mutant discs (Fig. 6D). This suggests that Dan can direct antennal differentiation in the presence of Antp, and overcome the ability of Antp to cause transformation to tarsus. Remarkably, this transformation can affect the entire distal arista, even though ectopic Dan is expressed in only a subset of Antp-expressing cells. These observations suggest that Dan plays an important role in specification of antennal identity.



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 6. Dan acts downstream of ss. (A,B) Cuticle preparation of the antenna from a ss mutant. The arista is transformed to tarsus. (B is a higher magnification of A.) (C) Cuticle preparation of the antenna from a ss mutant expressing Dan under ptcGal4 control. Much of the distal arista is normal in morphology (compare with Fig. 1F). (D) ss mutant eye-antenna disc expressing Dan under ptcGal4 control. Dan (green) was repressed distally where Antp (red) was ectopically expressed (compare with Fig. 3A,B; Fig. 5F). Note that ectopic Dan (in the ptcGal4 expressing cells, blue) did not repress Antp expression.

 

To assess the roles of dan and danr in antenna development in more detail, deletions that remove one or both genes (Fig. 2A) were examined. Larvae homozygous for these deletions are viable. danrex35 is a small deletion that removes part of the Danr coding sequence (Fig. 2A). Antibody staining revealed loss of Danr protein in clones of cells mutant for danrex35 (Fig. 7G). Interestingly, Dan protein was upregulated in these clones. Expression of both proteins was lost in homozygous dan danrex56 mutant clones (Fig. 7H), which removes ~45 kb between the two original P-element insertions (Fig. 2A). In both deletion homozygotes, the third antennal segment was reduced in size and developed ectopic bristles (Fig. 7A-C). In dan danrex56 animals the third antennal segment was generally smaller and more ectopic bristles were produced. In addition, the basal cylinder of the arista was enlarged and produced bracted bristles (arrow, Fig. 7C). Bracted bristles are typical of the distal leg and suggest partial transformation of antenna towards leg in the mutant tissue. A similar transformation of the basal cylinder was observed in mosaic antennae derived from ey-FLP danrex35/Minute heterozygous animals (Fig. 7E). The transformation associated with dan danrex56 homozygous clones was similar, but slightly stronger (Fig. 7F).



View larger version (111K):
[in this window]
[in a new window]
 
Fig. 7. dan danr mutant phenotypes. (A) Wild-type antenna. (B,C) Antennae from danrex35 and danr danex56 homozygous mutants. Arrowheads indicate reduced third antennal segments with ectopic bristles. Arrow indicates ectopic bristles on the enlarged basal capsule of the arista. (D) Wild-type arista: basal capsule. (E) Basal capsule of the arista from an eyFlp; FRT82B danrex35/FRT82B M+ armlacZ animal. Note the two-segmented appearance and the bracted bristles (arrow). (F) Basal capsule from an eyFlp; FRT82B dan danrex56/FRT82B M armlacZ animal. Note the clear segmentation of the basal capsule and the bracted bristles (arrow). (G,H) Antenna region of eye-antenna discs carrying danrex35 or dan danrex56 homozygous mutant clones (arrows). Clones were labeled by the absence of ß-gal protein (blue). Danr protein is shown in red; Dan protein in green. (G) Note upregulation of Dan in the Danr mutant clone. (H) Dan and Danr were both absent.

 

Although many dan danr double mutant excisions were recovered, none was singly mutant for dan alone. To generate a dan mutant we performed a screen for EMS-induced revertants of the dan gain-of-function phenotype in the wing. One allele was recovered. Sequence analysis revealed a change of amino acid residue 45 from glutamate to lysine. This alteration lies in the conserved pipsqueak domain and affects a residue thought to be important for DNA binding of a related protein (Fig. 2C). When expressed in the leg disc under control of DllGal4, danems3 caused loss of the claws, but did not cause transformation to arista, suggesting a weaker gain of function phenotype than the wild-type protein (not shown). Thus, danems3 appears to be a hypomorphic allele that reduces but does not eliminate Dan activity. danems3 homozygotes were viable and showed a mild antenna defect, including an occasional ectopic bristle in the third antennal segment (Fig. 8A). A stronger ectopic bristle phenotype was obtained when Dan activity was reduced using a Gal4 inducible construct that directs expression of a double-stranded dan RNA (Fig. 8B; DllGal4; sympUAST-dan). To verify that the inducible RNAi caused reduction of Dan protein levels, sympUAST-dan was expressed in the antenna disc using dppGal4. Dan protein levels were reduced in the RNAi-expressing cells, but Danr levels were unaffected (Fig. 8C).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 8. dan mutant phenotype. (A) Antenna from a danrems3 homozygous mutant. Note the single ectopic bristle in the third segment (arrow). (B) Antenna from a fly expressing dan double stranded RNA under DllGal4 control. Arrows indicate ectopic bristles. (C) Eye-antenna disc from a larva expressing dan double stranded RNA under dppGal4 control (green). Dan protein (red) was reduced. Danr protein (blue) was unaffected. Dan and Danr expression in the boxed area is shown separately on the right.

 

Together, these observations suggest that both Dan and Danr contribute to specification of antennal identity. danr single mutants produce a partial transformation of arista to tarsus. A similar, but slightly stronger phenotype results when both dan and danr are deleted. Reduced dan activity in the danems3 mutants or reduced Dan expression caused by RNA interference produced a milder version of the same phenotype.

An additional line of evidence to indicate that both genes contribute to distal antenna identity comes from examining genetic interactions with spinelessaristapedia. As noted above, ssa mutants lost Dan/Danr expression and expressed Antennapedia ectopically in the antenna disc (Fig. 5D,F). Restoring Dan expression was able to partially suppress the transformation to antenna, implicating Dan as an effector of ssa function. We therefore examined the consequences of removing one copy each of Dan and Danr in a ss mutant background. The spineless114.4 allele shows a mild transformation of the basal capsule of the arista when heterozygous, suggesting that the reduced level of ss activity in this allele is not sufficient to support normal development (Fig. 9A). Removing one copy of danr using the danrex35 deletion in this background caused a modest increase in the size of the basal capsule and in the number of ectopic bristles (Fig. 9B). The dan danrex56 deletion caused a stronger phenotype, with the basal capsule adopting a two-segment structure with multiple bracted bristles and obvious tarsal morphology (Fig. 9C). Flies heterozygous for the dan danrex56 deletion are morphologically normal. Thus, reduction of both Dan and Danr gene dose led to a more severe phenotype under conditions where ss activity was limiting. Even more extreme arista transformation phenotypes were observed when one copy of ss was removed in animals homozygous for the dan danrex56 deletion (Fig. 9G).



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 9. Genetic interaction between ss, Dll, dan and danr. (A) Basal capsule of spineless114.4 heterozygous arista shows a mild defect (compare with Fig. 7D). (B) spineless114.4/danrex35 double heterozygote. (C) spineless114.4/dan danrex56 double heterozygote. Note the two-segmented appearance and bracted bristles. (D) DllSA1/+ heterozygote. The basal capsule appears nearly normal. (E) DllSA1/+ danrex35/+ double heterozygote. (F) DllSA1/+ dan danrex56/+ double heterozygote. Stout ectopic bristles were formed on the basal capsule. (G) spineless114.4 dan danrex56/dan danrex56 antenna. Note the more extensive transformation of arista to tarsus.

 

We also observed genetic interactions with Dll. Double heterozygotes for danr and Dll or dan danr and Dll showed ectopic tarsal bristles in the basal capsule of the arista (Fig. 9D-F; in this case the phenotypes were similar in strength). We note that the ss/dan danr double heterozygotes produced a more complete transformation phenotype than the dan danr homozygous mutants. This raises the possibility that there may be additional genes acting downstream from ss to specify antennal identity.


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Non-autonomous effects of Hth and Dan/Danr in distal antenna
Insect antennae develop in the absence of input from HOM-C genes (Beeman, 1987Go; Stuart et al., 1991Go). In the anterior head of Drosophila where Antennapedia-complex and Bithorax complex genes are not expressed, expression of hth and Dll overlaps and promotes antenna development (Casares and Mann, 1998Go; Dong et al., 2000Go; Dong et al., 2002Go). One consequence of overlapping expression of Dll and Hth is sustained expression of ss in the distal antenna. ss is expressed in the leg and antenna discs in second instar, but its expression is not maintained in the leg (Duncan et al., 1998Go). ss is expressed within the Dll domain in distal antenna, but does not overlap Hth in the arista (Fig. 10).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 10. Genetic regulatory hierarchy in the antenna. Summary of the regulatory relationships controlling antenna identity. spineless plays a central role in specification of distal antenna by repression of Antp and induction of Dan and Danr expression. Dan and Danr can direct distal antenna development when misexpressed in distal leg, and can override the effects of ectopic Antp in the antenna.

 

Loss of Hth activity has been shown to cause transformation of arista to tarsus (Casares and Mann, 1998Go), presumably because of loss of ss. It has been suggested that uniform expression of Hth in second and early third instar antennae might be responsible for its role in specification of distal antenna identity. However, our results indicate that Hth can have a non-autonomous effect on the expression of Dan in the antenna. As described previously, Hth-expressing cells sort out from the distal part of the leg (Wu and Cohen, 1999Go). Nonetheless they were able to induce Dan expression in cells that remained integrated in the distal leg. This observation is best explained by a non-autonomous induction of Dan in response to a signal from Hth-expressing cells. Responsiveness to this signal apparently requires Dll, which limits it to the distal region. These effects are presumably mediated by regulation of ss, which is required for Dan and Danr expression. These observations provide an explanation for the apparently non-autonomous role of Hth together with Dll in the distal antenna.

ss is also required to induce Dan and Danr and to repress Antp expression. Repression of Antennapedia may be mediated in part by repression of Cut (Johnston et al., 1998Go). Our findings implicate Dan and Danr as downstream effectors of ss that promote development of distal antennal structures. Remarkably, we find that expression of Dan or Danr under Gal4 control can restore antenna development and prevent transformation of antenna to leg in the ss mutant, even when Antp is present. A striking feature of these results is that there appears to be non-autonomous activity. Transformation was blocked in cells expressing Dan and Danr, as well as in nearby cells that did not express these proteins. The identity of the genes responsible for these non-autonomous effects in antenna specification remains to be determined. In view of recent reports of non-autonomous effects of vein/EGFR signaling in development of distal leg pattern (Campbell, 2002Go; Galindo et al., 2002Go), it will be of interest to learn if there is a link to this pathway in the non-autonomous effects of Dan and Danr.

Dan/Danr pipsqueak motif
What are the molecular functions of Dan and Danr? The `pipsqueak motifs' found near the N terminus of Dan and Danr are most closely related to those in the `transposase group' of pipsqueak motif proteins, which includes the Pogo transposase and human centromere protein B (CENP-B) (Siegmund and Lehmann, 2002Go). The pipsqueak motifs of both Pogo and CENP-B are DNA-binding domains. NMR-spectroscopy of the CENP-B pipsqueak motif demonstrates that it has a helix-turn-helix structure (Iwahara et al., 1998Go; Wang et al., 1999Go). Interestingly, the glutamate residue that has been transformed to a lysine in the pipsqueak motif of the danems3 allele lies at the same position as the arginine that is required for DNA binding by the Pogo pipsqueak motif (Wang et al., 1999Go). Thus, the danems3 mutation may interfere with Dan function by abrogating the ability of Dan to bind DNA, or changing its specificity. Although these data suggest that Dan/Danr bind to DNA, it remains unclear whether they act as sequence-specific transcription factors or more general chromatin modification factors. Biochemical analysis of Dan/Danr and identification of interacting proteins will be required to address this issue in detail.


    ACKNOWLEDGMENTS
 
We thank Antonio Giraldez for identifying the J3-220 EPg element; Uli Weihe for help with some experiments needed for revision of the manuscri; Ian Duncan for ss mutant flies and cDNA; E. Giordano for the sympUAST vector; U. Weber, A. Jenny, P. Bork and F. Ciccarelli for help with sequence alignment; and B. Dickson for eyFLP. This work was supported in part by NIH grant GM62917 to M. M.


    Footnotes
 
{dagger} These authors contributed equally to this work Back


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Azpiazu, N. and Morata, G. (2000). Function and regulation of homothorax in the wing imaginal disc of Drosophila. Development 127,2685 -2693.[Abstract]
Beeman, R. W. (1987). A homeotic cluster in the red flour beetle. Nature 327,247 -249.[CrossRef]
Blochlinger, K., Bodmer, R., Jan, L. Y. and Jan, Y. N. (1990). Patterns of expression of cut, a protein required for external sensory organ development in wild type and cut mutant Drosophila embryos. Genes Dev. 4,1322 -1331.[Abstract/Free Full Text]
Brand, A. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]
Burgess, E. A. and Duncan, I. (1990). Direct control of antennal identity by the spineless-aristapedia gene of Drosophila. Mol. Gen. Genet. 221,347 -352.[Medline]
Campbell, G. (2002). Distalization of the Drosophila leg by graded EGF-receptor activity. Nature 418,781 -785.[CrossRef][Medline]
Casares, F. and Mann, R. S. (1998). Control of antennal versus leg development in Drosophila. Nature 392,723 -726.[CrossRef][Medline]
Casares, F. and Mann, R. S. (2000). A dual role for homothorax in inhibiting wing blade development and specifying proximal wing identities in Drosophila. Development 127,1499 -1508.[Abstract]
Cohen, S. M., Brönner, G., Küttner, F., Jürgens, G. and Jäckle, H. (1989). Distal-less encodes a homoeodomain protein required for limb development in Drosophila.Nature 338,432 -434.[CrossRef][Medline]
Cohen, S. M. and Jürgens, G. (1989a). Proximal-distal pattern formation in Drosophila: cell autonomous requirement for Distal-less gene activity in limb development. EMBO J. 8,2045 -2055.[Medline]
Cohen, S. M. and Jürgens, G. (1989b). Proximal-distal pattern formation in Drosophila: graded requirement for Distal-less gene activity during limb development in Drosophila. Roux's Archiv. Dev. Biol. 198,157 -169.
Condie, J. M., Mustard, J. A. and Brower, D. (1991). Generation of anti-Antennapedia monoclonal antibodies and Antennapedia expression in imaginal discs. Dros. Inf. Serv. 70,52 -54.
Diaz-Benjumea, F. J., Cohen, B. and Cohen, S. M. (1994). Cell interactions between compartments establishes the proximal-distal axis of Drosophila limbs. Nature 372,175 -179.[CrossRef][Medline]
Dong, P. D., Chu, J. and Panganiban, G. (2000). Coexpression of the homeobox genes Distal-less and homothorax determines Drosophila antennal identity. Development 127,209 -216.[Abstract]
Dong, P. D., Dicks, J. S. and Panganiban, G. (2002). Distal-less and homothorax regulate multiple targets to pattern the Drosophila antenna. Development 129,1967 -1974.[Abstract/Free Full Text]
Duncan, D. M., Burgess, E. A. and Duncan, I. (1998). Control of distal antennal identity and tarsal development in Drosophila by spineless-aristapedia, a homolog of the mammalian dioxin receptor. Genes Dev. 12,1290 -1303.[Abstract/Free Full Text]
Galindo, M. I., Bishop, S. A., Greig, S. and Couso, J. P. (2002). Leg patterning driven by proximal-distal interactions and EGFR signaling. Science 297,256 -259.[Abstract/Free Full Text]
Gehring, W. (1966). Bildung eines vollstandigen Mittelbeines mit Sternopleura in der Antennenregion bei der Mutante Nasobemia (Ns) von Drosophila melanogaster. Arch. Julius Klaus Stift Vererbungsforsch Sozialanthropol Rassenhyg 41, 44-54.
Gibson, G. and Gehring, W. J. (1988). Head and thoracic transformation caused by ectopic expression of Antennapedia during Drosophila development. Development 102,657 -675.[Abstract/Free Full Text]
Giordano, E., Rendina, R., Peluso, I. and Furia, M. (2002). RNAi triggered by symmetrically transcribed transgenes in Drosophila melanogaster. Genetics 160,637 -648.[Abstract/Free Full Text]
Gorfinkiel, N., Morata, G. and Guerrero, I. (1997). The homeobox gene Distal-less induces ventral appendage development in Drosophila. Genes Dev. 11,2259 -2271.[Abstract/Free Full Text]
Iwahara, J., Kigawa, T., Kitagawa, K., Masumoto, H., Okazaki, T. and Yokoyama, S. (1998). A helix-turn-helix structure unit in human centromere protein B (CENP-B). EMBO J. 17,827 -837.[CrossRef][Medline]
Johnston, L. A., Ostrow, B. D., Jasoni, C. and Blochlinger, K. (1998). The homeobox gene cut interacts genetically with the homeotic genes proboscipedia and Antennapedia. Genetics 149,131 -142.[Abstract/Free Full Text]
Kaufman, T. C., Seeger, M. A. and Olsen, G. (1990). Molecular and genetic organisation of the Antennapedia gene complex of Drosophila melanogaster. In Genetic Regulatory Hierarchies in Development, Vol.27 (ed. T. R. F. Wright), pp.309 -362. San Diego: Academic Press.
Kurant, E., Pai, C. Y., Sharf, R., Halachmi, N., Sun, Y. H. and Salzberg, A. (1998). Dorsotonals/homothorax, the Drosophila homologue of meis1, interacts with extradenticle in patterning of the embryonic PNS. Development 125,1037 -1048.[Abstract]
Mata, J., Curado, S., Ephrussi, A. and Rorth, P. (2000). Tribbles coordinates mitosis and morphogenesis in Drosophila by regulating string/CDC25 proteolysis. Cell 101,511 -522.[CrossRef][Medline]
Mercader, N., Leonardo, E., Azpiazu, N., Serrano, A., Morata, G., Martinez, C. and Torres, M. (1999). Conserved regulation of proximodistal limb axis development by Meis1/Hth. Nature 402,425 -429.[CrossRef][Medline]
Morimura, S., Maves, L., Chen, Y. and Hoffmann, F. M. (1996). decapentaplegic overexpression affects Drosophila wing and leg imaginal disc development and wingless expression. Dev. Biol. 177,136 -151.[CrossRef][Medline]
Pai, C. Y., Kuo, T. S., Jaw, T. J., Kurant, E., Chen, C. T., Bessarab, D. A., Salzberg, A. and Sun, Y. H. (1998). The Homothorax homeoprotein activates the nuclear localization of another homeoprotein, extradenticle, and suppresses eye development in Drosophila. Genes Dev. 12,435 -446.[Abstract/Free Full Text]
Pignoni, F. and Zipursky, S. L. (1997). Induction of Drosophila eye development by decapentaplegic. Development 124,271 -278.[Abstract]
Rieckhof, G. E., Casares, F., Ryoo, H. D., Abu-Shaar, M. and Mann, R. S. (1997). Nuclear translocation of extradenticle requires homothorax, which encodes an extradenticle-related homeodomain protein. Cell 91,171 -183.[CrossRef][Medline]
Siegmund, T. and Lehmann, M. (2002). The Drosophila Pipsqueak protein defines a new family of helix-turn-helix DNA-binding proteins. Dev. Genes Evol. 212,152 -157.[CrossRef][Medline]
Struhl, G. (1981). A homoeotic mutation transforming leg to antenna in Drosophila. Nature 292,635 -638.[CrossRef][Medline]
Struhl, G. (1982). Spineless-aristapedia: a homeotic gene that does not control the development of specific compartments in Drosophila.Genetics 102,737 -749.[Abstract/Free Full Text]
Stuart, J. J., Brown, S. J., Beeman, R. W. and Denell, R. E. (1991). A deficiency of the Homeotic Complex of the beetle Tribolium. Nature 350,72 -74.[CrossRef][Medline]
Wagner-Bernholz, J. T., Wilson, C., Gibson, G., Schuh, R. and Gehring, W. J. (1991). Identification of target genes of the homeotic gene Antennapedia by enhancer detection. Genes Dev. 5,2467 -2480.[Abstract/Free Full Text]
Wang, H., Hartswood, E. and Finnegan, D. J. (1999). Pogo transposase contains a putative helix-turn-helix DNA binding domain that recognises a 12 bp sequence within the terminal inverted repeats. Nucleic Acids Res. 27,455 -461.[Abstract/Free Full Text]
Wu, J. and Cohen, S. M. (1999). Proximal distal axis formation in the Drosophila leg: primary subdivision into proximal and distal domains by Homothorax, Teashirt and Distal-less expression. Development 126,109 -117.[Abstract]
Wu, J. and Cohen, S. M. (2000). Proximal distal axis formation in the Drosophila leg: distinct functions of teashirt and homothorax in the proximal leg. Mech. Dev. 94, 47-56.[CrossRef][Medline]
Yao, L. C., Liaw, G. J., Pai, C. Y. and Sun, Y. H. (1999). A common mechanism for antenna-to-Leg transformation in Drosophila: suppression of homothorax transcription by four HOM-C genes. Dev. Biol. 211,268 -276.[CrossRef][Medline]
Zeng, W., Andrew, D. J., Mathies, L. D., Horner, M. A. and Scott, M. P. (1993). Ectopic expression and function of the Antp and Scr homeotic genes: the N terminus of the homeodomain is critical to functional specificity. Development 118,339 -352.[Abstract]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Mol Biol EvolHome page
R. Bao and M. Friedrich
Molecular Evolution of the Drosophila Retinome: Exceptional Gene Gain in the Higher Diptera
Mol. Biol. Evol., June 1, 2009; 26(6): 1273 - 1287.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
G. Lebreton, C. Faucher, D. L. Cribbs, and C. Benassayag
Timing of Wingless signalling distinguishes maxillary and antennal identities in Drosophila melanogaster
Development, July 1, 2008; 135(13): 2301 - 2309.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. J. McMillan and C. A. Bradfield
The Aryl Hydrocarbon Receptor sans Xenobiotics: Endogenous Function in Genetic Model Systems
Mol. Pharmacol., September 1, 2007; 72(3): 487 - 498.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
N. C. Grieder, I. Charlafti, U. Kloter, H. Jackle, U. Schafer, and W. J. Gehring
Misexpression Screen in Drosophila melanogaster Aiming to Reveal Novel Factors Involved in Formation of Body Parts
Genetics, April 1, 2007; 175(4): 1707 - 1718.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Emerald, B. S.
Right arrow Articles by Cohen, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Emerald, B. S.
Right arrow Articles by Cohen, S. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?