|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00323



1 Developmental Biology Programme, European Molecular Biology Laboratory,
Meyerhofstrasse 1, 69117 Heidelberg, Germany
2 Department of Molecular Cell and Developmental Biology, Mount Sinai School of
Medicine, 1 Gustave Levy Place, New York NY 10029, USA
* Present address: Institute of Molecular and Cell Biology, 30 Medical Drive,
117609 Singapore
Author for correspondence (e-mail:
cohen{at}embl-heidelberg.de)
Accepted 29 November 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Patterns formation, Drosophila, Antennae, Homothorax, Distal-less, Antennapedia, Spineless
| INTRODUCTION |
|---|
|
|
|---|
How is antennal identity specified? The homothorax (hth)
and Distal-less (Dll) genes have been shown to play a role
in antenna development. Dll encodes a homeodomain protein expressed
in distal leg and antenna that is required for development of distal
structures in both appendages (Cohen et
al., 1989
; Diaz-Benjumea et
al., 1994
; Gorfinkiel et al.,
1997
). Hypomorphic mutations that reduce Dll activity cause
transformation of antenna into leg (Cohen
and Jürgens, 1989a
; Cohen
and Jürgens, 1989b
). hth encodes a TALE-type
homeodomain protein expressed in the proximal parts of all imaginal discs. Hth
protein promotes nuclear localization of the PBC-class homeodomain protein
Extradenticle (Kurant et al.,
1998
; Pai et al.,
1998
; Rieckhof et al.,
1997
). In leg and wing discs, Hth is expressed and required only
in proximal structures (Azpiazu and Morata,
2000
; Casares and Mann,
1998
; Casares and Mann,
2000
; Wu and Cohen,
1999
). A similar role has been proposed for the vertebrate Hth
protein MEIS in limb development (Mercader
et al., 1999
). In contrast to the situation in the leg, Hth and
Dll expression overlap extensively in the antenna. This overlap has been
linked to antenna identity based on the observation that co-expression of Hth
and Dll can induce formation of antennal structures in the proximal regions of
the wing and leg discs (Casares and Mann,
1998
; Dong et al.,
2000
).
The spineless (ss) gene has been implicated in control of
antennal identity. ss mutants cause transformation of distal antenna
to leg (Struhl, 1982
).
ss encodes a bHLH PAS domain transcription factor, homologous to the
mammalian dioxin receptor (Duncan et al.,
1998
). ss is expressed transiently in distal domains of
the leg and antenna discs during the second larval instar, but is maintained
only in the distal antenna. This difference is ss regulation depends
on the activity of Hth and Dll (Dong et
al., 2002
). Ectopic expression of ss in the leg can cause
transformation towards antenna, indicating that ss expression in an
important determinant of antenna identity
(Duncan et al., 1998
). The
cut gene is also expressed differentially in leg and antenna
(Dong et al., 2002
), and when
misexpressed in distal antenna has been shown to cause misexpression of
Antennapedia and concomitant transformation towards leg
(Johnston et al., 1998
).
Although several genes have been implicated in antenna development on the
basis of mutant phenotypes and differential expression
(Duncan et al., 1998
;
Dong et al., 2002
), our
understanding of the control of antennal identity remains incomplete. We
report the identification of two genes, distal antenna (dan)
and distal antenna related (danr) that play roles in
antennal development. dan and danr encode nuclear proteins
that are expressed in the distal antenna imaginal disc, but not in leg. We
present evidence that Hth and Dll control Dan and Danr expression through
regulation of ss and cut. Loss of Dan and Danr function
causes defects in antenna development and partial transformation of distal
antennal structures towards leg. Ectopic expression of these genes in the leg
disc causes transformation of distal leg to antenna. These findings implicate
Dan and Danr as downstream effectors of ss in the specification of
distal elements of the antenna.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Isolation of mutants
For danrex35 and dan,danrex56,
EPg-35635 and EPg-J3-220 were recombined onto the same chromosome. Flies
containing the recombinant chromosome were identified by their darker eyes,
resulting from the presence of mini-w+ genes from each
EPg-element. They were obtained at a rate of one in approximately 200,000
screened. Standard methods were used to obtain flies from which both
EPg-elements were excised, and whose eyes were therefore white. Fragments
containing the breakpoints of the EPg-element excisions were obtained by PCR
and sequenced. Sequence of primers for EPg 35635 breakpoints were
GATTCGCAACCCAAAAGTGCAACC and ACTATGAACTACAACTACAACTA. Sequence of primers for
EPg J3-220 breakpoints were ATTGCGTCGTCTTCGTTGCA and TAAAGTCGCACGTCCACGAA.
Some of the double excisions removed the entire sequence between the two
EPg-elements; breakpoints for these were obtained using a forward primer
upstream of EPg-35635 and a reverse primer downstream of EPg J3-220. Sequence
of primers for large deletion breakpoints were GATTCGCAACCCAAAAGTGCAACC and
TCTTGTGTCACCAATTCTTCA. The resulting products were sequenced along with the
rest. The danrex35 single mutant is missing 314 bp of
genomic DNA, including the EPg 35635 insertion point and extending 126 bp into
the danr ORF. Sequences surrounding the EPg J3-220 excision point in
danrex35 mutant DNA are completely wild type.
An EMS screen was carried out to isolate dan mutations. Male flies carrying EPgJ3-220 were mutagenized with 25 mM EMS and crossed to SdGal4 females. The EMS induced revertant danems3 was isolated by virtue of having normal wings, despite having overexpressed dan. danems3 DNA was cloned from homozygous mutant larvae by PCR using the following primer pairs:
Sequence analysis identified a single nucleotide alteration.
Genetic mosaics
Genotypes of larvae for danr mutant clones:
Genotypes of larvae for dan danr mutant clones:
hth mutant clones:
Dll mutant clones:
cut mutant clones:
Genotypes of larvae for ectopic expression clones:
Antibodies
The Dan ORF was PCR amplified (primers AAACATATGAACATCCGCATGGGC and
CTTTGAGCTCTTGCGACGGCGACT) and cloned into pET23a (Novagen) using NdeI
and SacI. The Danr ORF was PCR amplified (primers:
AGAAATGAATTCATGGATATCTCCGCCTAC and TATAATGTAGGGCTCGAGCCTGTTCGGCGTC) and cloned
into pET23a using EcoRI and XhoI. The C-terminally
HIS-tagged fusion proteins were expressed in bacteria and purified by
Ni2+ affinity chromatography under denaturing conditions. Rats and
mice were immunized using RIBI adjuvant at 3-week intervals. Antisera were
evaluated by immunostaining imaginal discs. Mouse anti-Antp is described
elsewhere (Condie et al.,
1991
). Mouse anti-Cut
(Blochlinger et al., 1990
),
Rabbit anti-Hth (Kurant et al.,
1998
), rat anti-Dll (Wu and
Cohen, 2000
) and mouse monoclonal anti-Dll
(Duncan et al., 1998
) were
also used.
RNA interference
Dan
A 1.2 kb fragment of the dan coding sequence was PCR amplified and
cloned as an EcoRI fragment into SympUAST for Gal4 dependent
expression of double stranded RNA
(Giordano et al., 2002
).
| RESULTS |
|---|
|
|
|---|
8500 EPg elements (Mata et al.,
2000
|
EPg J3-220 and EPg 35635 lie approximately 45 kb apart on chromosome 3R,
263 bp and 39 bp upstream of the predicted genes, CG11849 and CG13651
(Fig. 2A). To verify that the
predicted genes tagged by the EP-element insertions were responsible for the
observed overexpression phenotypes, we generated UAS-dan and
UAS-danr transgenic strains. Six independent
UAS-dan transformants and five independent UAS-danr
transformants were tested and found to be lethal when expressed with the
DllGal4 driver. However when expressed using
dppGal4, UAS-dan and UAS-danr
showed distal leg to antenna transformation
(Fig. 1C,D). Molecular markers
of antennal identity were also examined in the imaginal discs. The zinc-finger
protein Spalt is expressed in antenna, but not in leg discs
(Wagner-Bernholz et al.,
1991
). Ectopic expression of dan can induce limited
expression of Spalt in the leg disc (not shown), consistent with the observed
transformation toward antennal identity. These observations suggested a role
for dan and danr in specification of the identity of distal
antennal structures.
|
Dan and Danr encode proteins containing pipsqueak motifs
The predicted proteins encoded by dan and danr are
similar, showing 25% identity overall (Fig.
2B). This similarity extended through the entire sequence. In
addition, Dan has a C-terminal extension of more than 200 amino acids. The
most conserved region is a 64 amino acid sequence beginning with the N
terminus, where Dan and Danr share 92% identity. Within this region, both Dan
and Danr contain the newly identified `pipsqueak' motif (Siegmund et al.,
2002), a helix-turn-helix structure that is likely to be involved in DNA
binding (Fig. 2C). Outside the
pipsqueak motif, the Dan and Danr proteins contain no regions of significant
sequence similarity to other known proteins but show short blocks of strong
similarity to each other (Fig.
2B) (F. Ciccarelli and P. Bork, personal communication).
Dan and Danr expression in the distal antenna imaginal disc
Antibodies were raised to the predicted Dan and Danr proteins. Both are
nuclear proteins, expressed in the eye-antenna disc
(Fig. 3A,B). Double labeling
with anti-Dan and anti-Danr showed that the two proteins are co-expressed in
the antenna (Fig. 3B). Both
proteins are also expressed in the brain and the eye region of the eye-antenna
disc (not shown, Fig. 3A).
Antibody labeling of other imaginal discs showed limited Dan expression in
small groups of cells in leg (Fig.
3C) and wing (not shown). These appear in the location of
prominent sense organ progenitors at relatively late stages of disc
development. Danr was not detected in other discs.
|
To define the domain of Dan and Danr expression in the antenna, a series of
double labeling experiments were performed with antibodies to other antennal
proteins. Homothorax (Hth) is expressed in the presumptive head capsule and in
antennal segments A1 to A3 (Casares and
Mann, 1998
). Hth overlaps with the proximal part of the Dan domain
(Fig. 3D). Distal-less (Dll) is
expressed in a distal domain comprising A2, A3 and the arista
(Diaz-Benjumea et al., 1994
).
Dll overlaps the Dan domain, but extends further proximally. Cut is expressed
in the proximal part of the antenna
(Johnston et al., 1998
), in a
domain that does not overlap expression of Dan
(Fig. 3F). In optical
cross-section there appears to be one row of cells with low expression of Dan
at the interface between these domains. The domain of Dan/Danr expression
appears to coincide with the domain in which expression of ss
transcript has been reported (Duncan et
al., 1998
). Antibody to Spineless protein is not available,
precluding a more precise comparison.
The relationship between Dan, Hth and Dll expression suggests that the Dan domain corresponds to segment A3 and the arista and that Cut is expressed in A1 and A2 as well as the head capsule. Thus, in addition to the broadly overlapping domains of Hth and Dll, the antenna is subdivided into adjacent and perhaps mutually exclusive proximal and distal domains reflected by ss, Cut and Dan/Danr expression (Fig. 3G). Although we favor the view that the reciprocal expression of Dan/Danr and Cut is likely to define the border between antenna segments A2 and A3, we note that it is difficult to be precise about the location of the border before overt segmentation. The possibility exists that Dan and ss expression may extend into distal A2.
Regulation of Dan by hth and Dll
The overlap between Hth and Dll has been proposed to define antennal
identity, because co-expression of the two proteins in ectopic locations can
induce formation of ectopic arista structures in other discs
(Casares and Mann, 1998
;
Dong et al., 2000
). To ask
whether Hth and Dll have a role in defining the non-overlapping expression
domains of Cut and Dan/Danr, we examined clones of cells lacking hth
or Dll activity in the antenna. Dan expression was lost in cells
mutant for hthc1 in the region where the two expression
domains overlap (Fig. 4A). This
suggests that Hth activity is required for Dan expression. Likewise, clones of
cells lacking Dll activity lost Dan expression in the distal region
of the disc (Fig. 4B). We noted
that many Dll mutant clones were found adjacent to the edge of the
Dan domain (arrows, Fig. 4B),
suggesting that loss of Dan may cause these clones to sort out proximally.
Thus both Dll and Hth are required for Dan expression.
|
Ectopic expression of Hth in the leg disc under dppGal4
control, induced Dan expression in distal, Dll-expressing cells
(Fig. 4C). Based on earlier
work (Wu and Cohen, 1999
), we
know that Hth-expressing cells sort out from the distal region of the disc.
This is also visible in the GFP labeled cells in
Fig. 4C. Nonetheless,
dppGal4 directed expression of Hth induced Dan expression
in distal cells. This raises the possibility of a non-autonomous effect of Hth
expression leading to sustained Dan expression. Ectopic expression of Dll in
the leg disc under dppGal4 control, induced Dan expression
in proximal, Hth-expressing cells (Fig.
4D). In this case, ectopic Dan was limited to cells expressing the
Gal4 driver.
These observations indicate that the regulatory relationship between Hth, Dll and Dan (Danr) is complex. Dll and Hth are each required for Dan expression. However, it is clear that Dan is not expressed in every cell in which Hth and Dll are co-expressed in the antenna. All Dan-expressing distal antenna cells express Dll but not all express Hth. Our observations point to a non-autonomous effect of Hth on Dan expression, which may explain how Hth can be required for sustained expression of Dan in distal cells where Hth is not expressed.
Regulation of Dan by ss and cut
ss is expressed in the distal antenna in a domain similar to that
of Dan/Danr (Duncan et al.,
1998
). ss mutants cause transformation of distal antenna
to tarsus, suggesting a role in antennal identity
(Burgess and Duncan, 1990
;
Struhl, 1982
). To ask whether
ss regulates Dan and Danr, we examined antenna discs from
spinelessaristapedia (ssa) mutants.
ssa alleles appears to be reduce ss activity
specifically in the antenna. Dan expression was lost from the distal part of
ssa mutant antennal discs
(Fig. 5A). Loss of Dan
expression in ssa mutant antenna discs coincided with
ectopic expression of Antennapedia (Fig.
5B). We note that these expression domains appear to be
non-overlapping. Ectopic expression of Antennapedia has been shown previously
to be sufficient to cause transformation of antenna to leg
(Gibson and Gehring, 1988
).
The observation of ectopic Antp in the distal part of the third antennal
segment (within the Dan domain) may explain the homeotic transformation of
distal A3 and arista in the ss mutant. We next asked whether
ss was sufficient to induce Dan and Danr expression in the leg disc.
Ectopic expression of ss in randomly positioned clones of cells
caused expression of Dan and Danr in the wing and leg discs
(Fig. 5C and not shown). These
observations suggest that ss defines the domain of Dan and Danr
expression.
|
Next, we examined the relationship between ss and Cut. Ectopic
expression of ss using ptcGal4 caused ectopic
expression of Dan and repression of Cut expression
(Fig. 5D). Repression of Cut
was stronger on one side of the disc (arrow versus arrowhead) and was
associated with antenna duplication. Dan was repressed in the region indicated
by the arrow in multiple optical sections, indicating that this is not an
artifact of the abnormal folding of the disc. Ectopic expression of Dan or
Danr had no effect on Cut expression (not shown), suggesting that ss
may act directly to regulate Cut. The ability of ss to repress Cut,
contrasts with the observation by Dong et al.
(Dong et al., 2002
) that cut
expression is normal in ss mutants. It is possible that there are
redundant mechanisms for Cut repression, one of which is mediated by
ss.
To ask whether Cut regulates Dan and Danr expression we examined clones of cells lacking cut activity, generated using the null allele cut145 and the FLP-FRT system. cut145 mutant clones did not cause ectopic expression of Dan in proximal regions of the antenna disc (arrow, Fig. 5E), but did show limited expansion of the Dan domain in the region where Dll is expressed (inset, Fig. 5E). We observed comparable effects on Danr expression in cut mutant clones (not shown). Ectopic expression of Cut in the Dan domain using Act>CD2>Gal4 caused repression of Dan (not shown).
Taken together these results suggest that distal expression of ss limits the expression domain of Cut to the proximal antenna. ss is required for Dan and Danr expression in distal antenna. At present it is not possible to determine whether expression of Dan and Danr in response to ss is mediated directly or indirectly by repression of Cut. However, we favor the view that it is direct because removal of Cut did not cause extensive ectopic expression of Dan.
dan and danr are required for distal antennal
identity
ss mutants lead to ectopic expression of Antennapedia and
concomitant loss of Dan/Danr expression
(Fig. 5) and cause a strong
phenotypic transformation of distal A3 and arista to tarsus
(Fig. 6A,B). To determine
whether morphological transformation depends on loss of Dan/Danr, we made use
of Gal4 to direct Dan expression in the ss mutant discs. As shown in
Fig. 6C,
ptcGal4 directed expression of Dan caused strong
suppression of the arista-to-tarsus transformation in the ss mutant
antenna. ptcGal4 is expressed in a stripe of cells
adjacent to the AP boundary in the antenna region of the disc. Dan expression
did not repress ectopic expression of Antp in the ptcGal4
stripe of the mutant discs (Fig.
6D). This suggests that Dan can direct antennal differentiation in
the presence of Antp, and overcome the ability of Antp to cause transformation
to tarsus. Remarkably, this transformation can affect the entire distal
arista, even though ectopic Dan is expressed in only a subset of
Antp-expressing cells. These observations suggest that Dan plays an important
role in specification of antennal identity.
|
To assess the roles of dan and danr in antenna
development in more detail, deletions that remove one or both genes
(Fig. 2A) were examined. Larvae
homozygous for these deletions are viable. danrex35 is a
small deletion that removes part of the Danr coding sequence
(Fig. 2A). Antibody staining
revealed loss of Danr protein in clones of cells mutant for
danrex35 (Fig.
7G). Interestingly, Dan protein was upregulated in these clones.
Expression of both proteins was lost in homozygous dan
danrex56 mutant clones
(Fig. 7H), which removes
45 kb between the two original P-element insertions
(Fig. 2A). In both deletion
homozygotes, the third antennal segment was reduced in size and developed
ectopic bristles (Fig. 7A-C).
In dan danrex56 animals the third antennal segment was
generally smaller and more ectopic bristles were produced. In addition, the
basal cylinder of the arista was enlarged and produced bracted bristles
(arrow, Fig. 7C). Bracted
bristles are typical of the distal leg and suggest partial transformation of
antenna towards leg in the mutant tissue. A similar transformation of the
basal cylinder was observed in mosaic antennae derived from ey-FLP
danrex35/Minute heterozygous animals
(Fig. 7E). The transformation
associated with dan danrex56 homozygous clones was
similar, but slightly stronger (Fig.
7F).
|
Although many dan danr double mutant excisions were recovered, none was singly mutant for dan alone. To generate a dan mutant we performed a screen for EMS-induced revertants of the dan gain-of-function phenotype in the wing. One allele was recovered. Sequence analysis revealed a change of amino acid residue 45 from glutamate to lysine. This alteration lies in the conserved pipsqueak domain and affects a residue thought to be important for DNA binding of a related protein (Fig. 2C). When expressed in the leg disc under control of DllGal4, danems3 caused loss of the claws, but did not cause transformation to arista, suggesting a weaker gain of function phenotype than the wild-type protein (not shown). Thus, danems3 appears to be a hypomorphic allele that reduces but does not eliminate Dan activity. danems3 homozygotes were viable and showed a mild antenna defect, including an occasional ectopic bristle in the third antennal segment (Fig. 8A). A stronger ectopic bristle phenotype was obtained when Dan activity was reduced using a Gal4 inducible construct that directs expression of a double-stranded dan RNA (Fig. 8B; DllGal4; sympUAST-dan). To verify that the inducible RNAi caused reduction of Dan protein levels, sympUAST-dan was expressed in the antenna disc using dppGal4. Dan protein levels were reduced in the RNAi-expressing cells, but Danr levels were unaffected (Fig. 8C).
|
Together, these observations suggest that both Dan and Danr contribute to specification of antennal identity. danr single mutants produce a partial transformation of arista to tarsus. A similar, but slightly stronger phenotype results when both dan and danr are deleted. Reduced dan activity in the danems3 mutants or reduced Dan expression caused by RNA interference produced a milder version of the same phenotype.
An additional line of evidence to indicate that both genes contribute to distal antenna identity comes from examining genetic interactions with spinelessaristapedia. As noted above, ssa mutants lost Dan/Danr expression and expressed Antennapedia ectopically in the antenna disc (Fig. 5D,F). Restoring Dan expression was able to partially suppress the transformation to antenna, implicating Dan as an effector of ssa function. We therefore examined the consequences of removing one copy each of Dan and Danr in a ss mutant background. The spineless114.4 allele shows a mild transformation of the basal capsule of the arista when heterozygous, suggesting that the reduced level of ss activity in this allele is not sufficient to support normal development (Fig. 9A). Removing one copy of danr using the danrex35 deletion in this background caused a modest increase in the size of the basal capsule and in the number of ectopic bristles (Fig. 9B). The dan danrex56 deletion caused a stronger phenotype, with the basal capsule adopting a two-segment structure with multiple bracted bristles and obvious tarsal morphology (Fig. 9C). Flies heterozygous for the dan danrex56 deletion are morphologically normal. Thus, reduction of both Dan and Danr gene dose led to a more severe phenotype under conditions where ss activity was limiting. Even more extreme arista transformation phenotypes were observed when one copy of ss was removed in animals homozygous for the dan danrex56 deletion (Fig. 9G).
|
We also observed genetic interactions with Dll. Double heterozygotes for danr and Dll or dan danr and Dll showed ectopic tarsal bristles in the basal capsule of the arista (Fig. 9D-F; in this case the phenotypes were similar in strength). We note that the ss/dan danr double heterozygotes produced a more complete transformation phenotype than the dan danr homozygous mutants. This raises the possibility that there may be additional genes acting downstream from ss to specify antennal identity.
| DISCUSSION |
|---|
|
|
|---|
|
Loss of Hth activity has been shown to cause transformation of arista to
tarsus (Casares and Mann,
1998
), presumably because of loss of ss. It has been
suggested that uniform expression of Hth in second and early third instar
antennae might be responsible for its role in specification of distal antenna
identity. However, our results indicate that Hth can have a non-autonomous
effect on the expression of Dan in the antenna. As described previously,
Hth-expressing cells sort out from the distal part of the leg
(Wu and Cohen, 1999
).
Nonetheless they were able to induce Dan expression in cells that remained
integrated in the distal leg. This observation is best explained by a
non-autonomous induction of Dan in response to a signal from Hth-expressing
cells. Responsiveness to this signal apparently requires Dll, which limits it
to the distal region. These effects are presumably mediated by regulation of
ss, which is required for Dan and Danr expression. These observations
provide an explanation for the apparently non-autonomous role of Hth together
with Dll in the distal antenna.
ss is also required to induce Dan and Danr and to repress Antp
expression. Repression of Antennapedia may be mediated in part by repression
of Cut (Johnston et al.,
1998
). Our findings implicate Dan and Danr as downstream effectors
of ss that promote development of distal antennal structures.
Remarkably, we find that expression of Dan or Danr under Gal4 control can
restore antenna development and prevent transformation of antenna to leg in
the ss mutant, even when Antp is present. A striking feature of these
results is that there appears to be non-autonomous activity. Transformation
was blocked in cells expressing Dan and Danr, as well as in nearby cells that
did not express these proteins. The identity of the genes responsible for
these non-autonomous effects in antenna specification remains to be
determined. In view of recent reports of non-autonomous effects of vein/EGFR
signaling in development of distal leg pattern
(Campbell, 2002
;
Galindo et al., 2002
), it will
be of interest to learn if there is a link to this pathway in the
non-autonomous effects of Dan and Danr.
Dan/Danr pipsqueak motif
What are the molecular functions of Dan and Danr? The `pipsqueak motifs'
found near the N terminus of Dan and Danr are most closely related to those in
the `transposase group' of pipsqueak motif proteins, which includes the Pogo
transposase and human centromere protein B (CENP-B)
(Siegmund and Lehmann, 2002
).
The pipsqueak motifs of both Pogo and CENP-B are DNA-binding domains.
NMR-spectroscopy of the CENP-B pipsqueak motif demonstrates that it has a
helix-turn-helix structure (Iwahara et
al., 1998
; Wang et al.,
1999
). Interestingly, the glutamate residue that has been
transformed to a lysine in the pipsqueak motif of the
danems3 allele lies at the same position as the arginine
that is required for DNA binding by the Pogo pipsqueak motif
(Wang et al., 1999
). Thus, the
danems3 mutation may interfere with Dan function by
abrogating the ability of Dan to bind DNA, or changing its specificity.
Although these data suggest that Dan/Danr bind to DNA, it remains unclear
whether they act as sequence-specific transcription factors or more general
chromatin modification factors. Biochemical analysis of Dan/Danr and
identification of interacting proteins will be required to address this issue
in detail.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
These authors contributed equally to this work | REFERENCES |
|---|
|
|
|---|
Azpiazu, N. and Morata, G. (2000). Function and regulation of homothorax in the wing imaginal disc of Drosophila. Development 127,2685 -2693.[Abstract]
Beeman, R. W. (1987). A homeotic cluster in the red flour beetle. Nature 327,247 -249.[CrossRef]
Blochlinger, K., Bodmer, R., Jan, L. Y. and Jan, Y. N.
(1990). Patterns of expression of cut, a protein required for
external sensory organ development in wild type and cut mutant Drosophila
embryos. Genes Dev. 4,1322
-1331.
Brand, A. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]
Burgess, E. A. and Duncan, I. (1990). Direct control of antennal identity by the spineless-aristapedia gene of Drosophila. Mol. Gen. Genet. 221,347 -352.[Medline]
Campbell, G. (2002). Distalization of the Drosophila leg by graded EGF-receptor activity. Nature 418,781 -785.[CrossRef][Medline]
Casares, F. and Mann, R. S. (1998). Control of antennal versus leg development in Drosophila. Nature 392,723 -726.[CrossRef][Medline]
Casares, F. and Mann, R. S. (2000). A dual role for homothorax in inhibiting wing blade development and specifying proximal wing identities in Drosophila. Development 127,1499 -1508.[Abstract]
Cohen, S. M., Brönner, G., Küttner, F., Jürgens, G. and Jäckle, H. (1989). Distal-less encodes a homoeodomain protein required for limb development in Drosophila.Nature 338,432 -434.[CrossRef][Medline]
Cohen, S. M. and Jürgens, G. (1989a). Proximal-distal pattern formation in Drosophila: cell autonomous requirement for Distal-less gene activity in limb development. EMBO J. 8,2045 -2055.[Medline]
Cohen, S. M. and Jürgens, G. (1989b). Proximal-distal pattern formation in Drosophila: graded requirement for Distal-less gene activity during limb development in Drosophila. Roux's Archiv. Dev. Biol. 198,157 -169.
Condie, J. M., Mustard, J. A. and Brower, D. (1991). Generation of anti-Antennapedia monoclonal antibodies and Antennapedia expression in imaginal discs. Dros. Inf. Serv. 70,52 -54.
Diaz-Benjumea, F. J., Cohen, B. and Cohen, S. M. (1994). Cell interactions between compartments establishes the proximal-distal axis of Drosophila limbs. Nature 372,175 -179.[CrossRef][Medline]
Dong, P. D., Chu, J. and Panganiban, G. (2000). Coexpression of the homeobox genes Distal-less and homothorax determines Drosophila antennal identity. Development 127,209 -216.[Abstract]
Dong, P. D., Dicks, J. S. and Panganiban, G.
(2002). Distal-less and homothorax regulate multiple targets to
pattern the Drosophila antenna. Development
129,1967
-1974.
Duncan, D. M., Burgess, E. A. and Duncan, I.
(1998). Control of distal antennal identity and tarsal
development in Drosophila by spineless-aristapedia, a homolog of the mammalian
dioxin receptor. Genes Dev.
12,1290
-1303.
Galindo, M. I., Bishop, S. A., Greig, S. and Couso, J. P.
(2002). Leg patterning driven by proximal-distal interactions and
EGFR signaling. Science
297,256
-259.
Gehring, W. (1966). Bildung eines vollstandigen Mittelbeines mit Sternopleura in der Antennenregion bei der Mutante Nasobemia (Ns) von Drosophila melanogaster. Arch. Julius Klaus Stift Vererbungsforsch Sozialanthropol Rassenhyg 41, 44-54.
Gibson, G. and Gehring, W. J. (1988). Head and
thoracic transformation caused by ectopic expression of Antennapedia
during Drosophila development. Development
102,657
-675.
Giordano, E., Rendina, R., Peluso, I. and Furia, M.
(2002). RNAi triggered by symmetrically transcribed transgenes in
Drosophila melanogaster. Genetics
160,637
-648.
Gorfinkiel, N., Morata, G. and Guerrero, I.
(1997). The homeobox gene Distal-less induces ventral appendage
development in Drosophila. Genes Dev.
11,2259
-2271.
Iwahara, J., Kigawa, T., Kitagawa, K., Masumoto, H., Okazaki, T. and Yokoyama, S. (1998). A helix-turn-helix structure unit in human centromere protein B (CENP-B). EMBO J. 17,827 -837.[CrossRef][Medline]
Johnston, L. A., Ostrow, B. D., Jasoni, C. and Blochlinger,
K. (1998). The homeobox gene cut interacts genetically with
the homeotic genes proboscipedia and Antennapedia.
Genetics 149,131
-142.
Kaufman, T. C., Seeger, M. A. and Olsen, G. (1990). Molecular and genetic organisation of the Antennapedia gene complex of Drosophila melanogaster. In Genetic Regulatory Hierarchies in Development, Vol.27 (ed. T. R. F. Wright), pp.309 -362. San Diego: Academic Press.
Kurant, E., Pai, C. Y., Sharf, R., Halachmi, N., Sun, Y. H. and Salzberg, A. (1998). Dorsotonals/homothorax, the Drosophila homologue of meis1, interacts with extradenticle in patterning of the embryonic PNS. Development 125,1037 -1048.[Abstract]
Mata, J., Curado, S., Ephrussi, A. and Rorth, P. (2000). Tribbles coordinates mitosis and morphogenesis in Drosophila by regulating string/CDC25 proteolysis. Cell 101,511 -522.[CrossRef][Medline]
Mercader, N., Leonardo, E., Azpiazu, N., Serrano, A., Morata, G., Martinez, C. and Torres, M. (1999). Conserved regulation of proximodistal limb axis development by Meis1/Hth. Nature 402,425 -429.[CrossRef][Medline]
Morimura, S., Maves, L., Chen, Y. and Hoffmann, F. M. (1996). decapentaplegic overexpression affects Drosophila wing and leg imaginal disc development and wingless expression. Dev. Biol. 177,136 -151.[CrossRef][Medline]
Pai, C. Y., Kuo, T. S., Jaw, T. J., Kurant, E., Chen, C. T.,
Bessarab, D. A., Salzberg, A. and Sun, Y. H. (1998). The
Homothorax homeoprotein activates the nuclear localization of another
homeoprotein, extradenticle, and suppresses eye development in Drosophila.
Genes Dev. 12,435
-446.
Pignoni, F. and Zipursky, S. L. (1997). Induction of Drosophila eye development by decapentaplegic. Development 124,271 -278.[Abstract]
Rieckhof, G. E., Casares, F., Ryoo, H. D., Abu-Shaar, M. and Mann, R. S. (1997). Nuclear translocation of extradenticle requires homothorax, which encodes an extradenticle-related homeodomain protein. Cell 91,171 -183.[CrossRef][Medline]
Siegmund, T. and Lehmann, M. (2002). The Drosophila Pipsqueak protein defines a new family of helix-turn-helix DNA-binding proteins. Dev. Genes Evol. 212,152 -157.[CrossRef][Medline]
Struhl, G. (1981). A homoeotic mutation transforming leg to antenna in Drosophila. Nature 292,635 -638.[CrossRef][Medline]
Struhl, G. (1982).
Spineless-aristapedia: a homeotic gene that does not control the
development of specific compartments in Drosophila.Genetics 102,737
-749.
Stuart, J. J., Brown, S. J., Beeman, R. W. and Denell, R. E. (1991). A deficiency of the Homeotic Complex of the beetle Tribolium. Nature 350,72 -74.[CrossRef][Medline]
Wagner-Bernholz, J. T., Wilson, C., Gibson, G., Schuh, R. and
Gehring, W. J. (1991). Identification of target genes of the
homeotic gene Antennapedia by enhancer detection. Genes
Dev. 5,2467
-2480.
Wang, H., Hartswood, E. and Finnegan, D. J.
(1999). Pogo transposase contains a putative helix-turn-helix DNA
binding domain that recognises a 12 bp sequence within the terminal inverted
repeats. Nucleic Acids Res.
27,455
-461.
Wu, J. and Cohen, S. M. (1999). Proximal distal axis formation in the Drosophila leg: primary subdivision into proximal and distal domains by Homothorax, Teashirt and Distal-less expression. Development 126,109 -117.[Abstract]
Wu, J. and Cohen, S. M. (2000). Proximal distal axis formation in the Drosophila leg: distinct functions of teashirt and homothorax in the proximal leg. Mech. Dev. 94, 47-56.[CrossRef][Medline]
Yao, L. C., Liaw, G. J., Pai, C. Y. and Sun, Y. H. (1999). A common mechanism for antenna-to-Leg transformation in Drosophila: suppression of homothorax transcription by four HOM-C genes. Dev. Biol. 211,268 -276.[CrossRef][Medline]
Zeng, W., Andrew, D. J., Mathies, L. D., Horner, M. A. and Scott, M. P. (1993). Ectopic expression and function of the Antp and Scr homeotic genes: the N terminus of the homeodomain is critical to functional specificity. Development 118,339 -352.[Abstract]
This article has been cited by other articles:
![]() |
G. Lebreton, C. Faucher, D. L. Cribbs, and C. Benassayag Timing of Wingless signalling distinguishes maxillary and antennal identities in Drosophila melanogaster Development, July 1, 2008; 135(13): 2301 - 2309. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. McMillan and C. A. Bradfield The Aryl Hydrocarbon Receptor sans Xenobiotics: Endogenous Function in Genetic Model Systems Mol. Pharmacol., September 1, 2007; 72(3): 487 - 498. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. C. Grieder, I. Charlafti, U. Kloter, H. Jackle, U. Schafer, and W. J. Gehring Misexpression Screen in Drosophila melanogaster Aiming to Reveal Novel Factors Involved in Formation of Body Parts Genetics, April 1, 2007; 175(4): 1707 - 1718. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||