|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00346
Department of Cell and Molecular Biology, Institute of Biochemistry and Biotechnology, Technical University of Braunschweig, 38106 Braunschweig, Germany
* Author for correspondence (e-mail: h.arnold{at}tu-bs.de)
Accepted 18 December 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Nkx2.9 transcription factor, Targeted gene disruption, Neuronal differentiation, Spinal accessory nerve, Mouse
| INTRODUCTION |
|---|
|
|
|---|
According to this model, progenitor cells that give rise to the most
ventral population of V3 interneurons are exposed to higher Shh concentrations
and express the transcription factors Nkx2.2, Nkx2.9 and Nkx6.1
(Barth and Wilson, 1995
;
Hartigan and Rubenstein, 1996
;
Pabst et al., 1998
;
Qiu et al., 1998
;
Shimamura et al., 1995
), while
the more dorsal progenitor cells of motoneurons encounter lower Shh signaling
activity and express Pax6. In mice that lack Pax6, these progenitor cells
generate neurons that are typical of higher Shh concentrations and are located
more ventrally (Ericson et al.,
1997b
; Osumi et al.,
1997
). In Nkx2.2-deficient mice, differentiated V3
interneurons are missing and the dorsally adjacent population of motoneuron
precursors expands ventrally, indicating that Nkx2.2 has a primary
role in ventral neuronal patterning
(Briscoe et al., 1999
).
Nkx2.2-expressing progenitors in the spinal cord generate a class of
neurons that express the basic helix-loop-helix transcription factors Sim1 and
Ngn3 (Fan et al., 1996
;
Sommer et al., 1996
), and give
rise to oligodendrocytes at later stages of development
(Qi et al., 2001
).
Accordingly, lack of Nkx2.2 also results in delayed development of
oligodendrocytes (Qi et al.,
2001
). Transformation of neuronal cell fate was further observed
in mice that lack the Nkx6.1 gene. These mutant mice contain
increased numbers of V1 neurons at the expense of MNs and V2 neurons
(Sander et al., 2000
). In line
with these observations, inactivation of Nkx2.1 that is expressed in ventral
domains of the telencephalon also results in ventral to dorsal transformation
of brain structures (Sussel et al.,
1999
). More recently, a function of Nkx2.1 in hypothalamus has
been demonstrated (Marin et al.,
2002
). Taken together, these various results suggest that Nkx
transcription factors are important for regional patterning and cell fate
determination within the ventral CNS in response to graded Shh signaling.
Interestingly, the NK2/vnd gene, a founding member of the NK gene
family in Drosophila (Kim and
Nirenberg, 1989
), also determines neuronal identity similar to
Nkx2 genes in the mouse. It has been shown that NK2/vnd in the fly is
necessary and sufficient to generate ventral cell fates, as mutants that lack
vnd function fail to form specific ventral neuroblasts
(McDonald et al., 1998
). Thus,
the role of NK/Nkx genes in dorsoventral patterning of the CNS seems to be
conserved during evolution.
Identification of the murine Nkx2.9 gene, a novel member of the
mammalian Nkx2 family, and its expression pattern in the ventral CNS during
mouse embryogenesis has been described previously
(Pabst et al., 1998
).
Nkx2.9 is structurally most closely related to Nkx2.2 and
both genes are expressed in largely overlapping domains, depending on Shh
during early stages of embryogenesis
(Pabst et al., 2000
). To
investigate the role of Nkx2.9, we generated a null mutation in mouse by
targeted gene disruption, and analyzed the resulting phenotype. Homozygous
Nkx2.9-deficient mutants were viable and fertile without overt
morphological or behavioral abnormalities. In contrast to Nkx2.2
mutant animals, the distribution of neuronal precursors and mature neurons
appeared unaffected in spinal cord of homozygous Nkx2.9 mutant mice,
whereas in the hindbrain the accessory nerve (XIth) was markedly reduced in
size compared with wild-type animals, and some mutants exhibited
morphologically abnormal vagal and glossopharyngeal nerves. Consistent with
these nerve defects, Nkx2.9 mutant embryos lacked most of the
migratory neuronal precursor cells that represent branchial motoneuron
progenitors of the spinal accessory nerve but contained more median motor
column neurons instead. These results are in line with the current model of a
combinatorial action of Nkx homeobox genes in specifying neuronal cell fates
along the dorsoventral axis within the CNS.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Genotyping of mice was routinely performed by PCR using the following primers in standard reactions: NkxMUTsense, AGCTCATTCCTCCCACTCATG; NkxWTsense, ACCACCGCTACAAGCTGAAGC; Nkx antisense, GGTGGTGCTAAGTGCTGGTAG. PCR conditions were 94°C for 2 minutes followed by 38 cycles of 94°C for 1 minute, 60°C for 45 seconds and 72°C for 1 minute. Wild-type and mutant alleles were identified as 289 bp and 400 bp DNA fragments, respectively.
ß-Galactosidase and neurofilament staining, and in situ
hybridization on whole-mount embryos
Isolated embryos were briefly rinsed with phosphate-buffered saline (PBS).
For ß-galactosidase staining, embryos were fixed in 0.2% glutaraldehyde
dissolved in PBS containing 5 mM EGTA and 2 mM MgCl2 for 15
minutes, washed three times for 15 minutes each in PBS containing 5 mM EGTA, 2
mM MgCl2, 0.01% NP-40 and 0.1% sodium desoxycholate. Staining was
performed in the same buffer with 10 mM K3Fe(CN)6, 10 mM
K4Fe(CN)6 and 0.5 mg/ml X-Gal at 37°C. Tissue
staining was evaluated after dehydration in graded ethanol and clearing the
embryos in benzylethanol/benzaldehyde in 2:1 ratio. For whole-mount in situ
hybridization and antibody staining, embryos were fixed in 4% paraformaldehyde
(PFA) at 4°C overnight, dehydrated in graded methanol and stored at
20°C. For the actual experiments, embryos were rehydrated, bleached
with 6% H2O2 in PBT (PBS containing 0.01% Tween-20),
treated with Proteinase K dissolved in PBT (1 µg/ml) for 10 minutes, washed
in PBT containing 10 mg/ml glycine, and rewashed three times in PBT. Embryos
were then refixed in 4% PFA/0.2% glutaraldehyde dissolved in PBT for 20
minutes followed by three washes in PBT. For whole-mount staining of
neurofilaments, embryos were blocked with 10% horse serum in PBT overnight at
4°C and then incubated with the first antibody (partially purified IgG
clone 2H3 from Developmental Studies Hybridoma Bank of Iowa, DSHB) diluted
1:900 in 10% horse serum/PBT. After incubation, embryos were washed five times
for 1 hour each with 10% horse serum/PBT and then overnight in PBT alone.
Incubations with second antibody (HRP anti mouse from Vector Laboratories) and
washing were carried out as described above (1:300 anti-serum dilution in
PBT). The staining solution contained 0.1 mg DAB and 0.5 µl
H2O2 per ml PTB. Whole-mount in situ hybridization was
performed as described previously (Bober et
al., 1994
). Riboprobes for Shh, Nkx2.2, Nkx2.9, Dbx2, Nkx6.1,
Pax3, Pax6 and Pax7 have been described previously
(Pabst et al., 2000
;
Sander et al., 2000
).
Staining for ß-galactosidase and acetylcholinesterase on tissue
sections
Dissected tissues were cryoprotected in 30% sucrose/PBS without prior
fixation and frozen on dry ice in OCT. Cryosections (14 µm) were collected
on coated glass slides and dried at 50°C for 1 hour. ß-Galactosidase
staining was performed as described above for whole-mount preparations except
that fixation and washing steps lasted only 5 minutes. Sections for
acetylcholinesterase staining were hydrated in PBS and incubated in 65 mM
sodium acetate (pH 6.0), 5 mM sodium citrate, 3 mM copper sulfate, 0.5 mM
potassium ferricyanide and 0.5 mg/ml acetylthiocholine iodide for 2 hours at
37°C.
Immunohistochemistry
Embryos were fixed as described above, dehydrated in graded ethanol,
treated with xylene alone, followed by a 1:1 mixture of xylene and paraffin
wax, and then embedded in paraffin wax. Paraffin blocks were cut at 6 µm
and then collected on Vectabond-coated glass slides. Each slide was
photographed to select sections of the identical the anteroposterior level
from different embryos. Paired sections were then used for double
immunofluorescence staining with two monoclonal mouse antibodies. Slides were
dewaxed and endogenous peroxidase activity was abolished by incubation in a
9:1 mixture of methanol and H2O2 for 1 hour. Sections
were then incubated in blocking solution (0.1% Triton-X100, 10% horse serum in
PBS) for 2 hours. The first antibody was applied over night at 4°C.
HRP-conjugated anti-mouse antibody was then added, diluted 1:200 in blocking
solution and the slides were developed using FITC-labeled tyramide as
substrate according to the instructions of the manufacturer (NEN). To prevent
crossreactivity with the next antibody, pre-stained sections were incubated in
a 1:20 dilution of sheep anti-mouse Fab fragments (Dianova) in blocking
solution for 1 hour. Subsequently the second primary antibody was applied in
blocking solution for 2 hours at room temperature and visualized with
Cyanin3-coupled anti-mouse antibody (Sigma). Mouse monoclonal antibodies
against Nkx2.2, Isl1(clone 2D6), Pax6 and Lim3 were obtained from DSHB.
Dilutions (1:500) of partially purified IgG fractions were used for the first
and 1:100 dilutions for the second reaction. Phox2b detection with rabbit
Phox2b antiserum was performed as described previously
(Pattyn et al., 1997
).
| RESULTS |
|---|
|
|
|---|
Crosses of heterozygous Nkx2.9 parents produced homozygous offspring with the expected Mendelian frequency (Fig. 1B). The mutants appeared morphologically normal and showed no signs of grossly altered behavior over the observation period of more than 1 year. Using RT-PCR, Nkx2.9 transcripts were readily detectable in brains of wild-type animals and at a reduced level in heterozygous but not in homozygous mutants (Fig. 1C). The same results were obtained by whole-mount in situ hybridization of embryos using a Nkx2.9-specific riboprobe (data not shown). These observations confirmed that the gene disruption has caused a Nkx2.9-null mutation.
Expression of the Nkx2.9/lacZ reporter gene in heterozygous
and homozygous mutants
First, we analyzed the expression pattern of the
Nkx2.9/lacZ reporter gene in heterozygous embryos in order
to test whether it recapitulated endogenous Nkx2.9 expression, as
previously determined by in situ hybridization
(Pabst et al., 1998
). Weak
ß-gal activity was first detected in E8.0 embryos in the most ventral
aspect of the neural tube along the entire neural axis. Expression persisted
until E9.5, mimicking the endogenous Nkx2.9 pattern
(Fig. 2A,B). In E11.5 and E12.5
embryos, lacZ activity was still present along the anteroposterior
axis (Fig. 2C,D) continuing
until E17.5 in the caudal spinal cord (data not shown). The developmental
timecourse of this pattern was not entirely consistent with the previously
reported downregulation of Nkx2.9 transcripts in neural tube beginning at E10
(Briscoe et al., 1999
;
Pabst et al., 1998
). Whether
the difference in temporal expression reflects high stability of ß-gal
transcripts or protein, or disturbance of regulatory elements within the
mutated Nkx2.9 locus remains to be clarified. In late embryonic and early
postnatal stages (E17.5 to P3), lacZ activity was found in
hypothalamus and in the third ventricle, prominently in the subfornical organ.
Expression in the subfornical organ and the median eminence remained
detectable in brains of adult mice. Additional lacZ activity was
observed in lung epithelium of embryos and adult animals (data not shown).
|
The lacZ expression pattern in spinal cord of heterozygous and homozygous embryos at E10.5 was essentially the same, suggesting that Nkx2.9 activity is not required to establish progenitors of V3 interneurons that express the gene in wild-type animals (Fig. 2E,F and data not shown). In the hindbrain, however, a subtle change in the lacZ pattern of expression was apparent (Fig. 2E,F). Although a region of very low ß-gal staining at the level of rhombomeres 3 and 4 was seen in heterozygous animals, the corresponding area in homozygous embryos showed intensified activity in a dorsally expanded domain. This may indicate that a pool of distinct neuronal progenitor cells was expanded or alternatively the reporter gene was aberrantly expressed in the absence of Nkx2.9 protein. During later developmental stages (E13.5 to E17.5), and in early postnatal and adult brains, however, this difference in Nkx2.9 expression was no longer observed. Taken together the data of the reporter gene expression suggested that Nkx2.9 is not essential to establish or maintain the early neuronal progenitor cells from which V3 neurons and branchial motoneurons are generated.
Neuronal differentiation in the spinal cord is not affected by the
Nkx2.9 mutation
In spinal cord, Nkx2.9, like Nkx2.2, is expressed in the
ventral domain of neuronal progenitors that give rise to V3 interneurons. This
domain has been referred to as `x'-region or p3-domain
(Yamada et al., 1991
). To
search for a potential phenotype of the Nkx2.9-deficient mouse, we analyzed
the distribution of neuronal cell types within the spinal cord at forelimb and
hindlimb levels of heterozygous and homozygous E10.5 mutant embryos, using
whole-mount in situ hybridization and antibody staining for the appropriate
marker molecules.
The most ventral cell population in the neural tube forms the floorplate
that expresses Shh and the transcription factor HNF3ß. Expression of both
floorplate markers was unchanged in Nkx2.9 mutants, suggesting that
Nkx2.9 has no role in the formation and maintenance of floorplate
(Fig. 3A,B; data not shown).
The dorsally adjacent p3 domain of V3 progenitor cells is characterized by
co-expression of Nkx2.9, Nkx2.2 and Nkx6.1, and the lack of Pax6 that
is expressed dorsolateral to the p3 domain throughout the neural tube.
Immunofluorescence staining showed that the pattern of Nkx2.2
expression was indistinguishable in heterozygous and homozygous
Nkx2.9 mutant mice (Fig.
3C,D,G,H). Likewise, the expression domains of the
Nkx2.9-lacZ reporter gene and Nkx6.1 were unaltered in mutant embryos
(Fig. 2E,F; data not shown).
Moreover, the number of cells within the p3-domain appeared unchanged
(Fig. 3). The ventral boundary
of the Pax6-expressing domain was maintained at its normal position
(Fig. 3G,H), and more dorsally
located progenitor regions, as exemplified by the expression pattern of Dbx2
for V1 neuronal precursors, were also unaffected in Nkx2.9 mutants
(Fig. 3K,L). In situ
hybridization with a variety of additional probes for marker transcripts
within the neural tube, including Pax3, Pax6, Pax7, Nkx6.1 and Nkx2.2,
confirmed the normal patterning of spinal cord in Nkx2.9 mutant
embryos (data not shown). In Nkx2.2-deficient mice, V3 progenitors
failed to differentiate and the number of somatic motoneurons was increased
with many of them located next to the floorplate within the p3 domain
(Briscoe et al., 1999
). To test
thoroughly whether a similar cell fate transformation occurred in
Nkx2.9 mutants, we investigated the distribution of both neuronal
cell types in E10.5 and E11.0 embryos by in situ hybridization using a
Sim1-specific probe and immunofluorescence staining using neurogenin 3 (Ngn3),
islet 1 (Isl1) and Nkx2.2 antibodies. The Sim1 expression domain was unchanged
in the mutant, indicating that V3 neurons had been established normally
(Fig. 3I,J). This was confirmed
by the normal staining pattern for Ngn3, which also labels V3 neurons (data
not shown). There was also no difference in the relative location or number of
Isl1-positive and Nkx2.2-expressing cells between heterozygous and
homozygous Nkx2.9 mutants, indicating that somatic motoneurons were
formed correctly in their defined territory
(Fig. 3C-F). It should be
mentioned, however, that on sections through more-caudal segments of spinal
cord (at and posterior to hindlimb level), we occasionally but consistently
found single Isl1-positive cells within the Nkx2.2 domain of
Nkx2.9 mutants (Fig.
3F). This was never observed in wild-type embryos
(Fig. 3E). Significantly, the
individual Isl1-positive cells within the Nkx2.2 domain failed to
express Nkx2.2, suggesting that expression of both genes within one
cell is mutually exclusive. Whether in the absence of Nkx2.9 these
putative motoneurons were generated within the wrong domain or became
misplaced by migration is not clear. All observations taken together indicate
that Nkx2.9 function is not essential to establish or maintain the p3-domain
in spinal cord nor to generateV3 neurons. Dorsoventral patterning of the
spinal cord and the determination of neuronal cell subtypes occurred correctly
in the absence of Nkx2.9, with the exception of few motoneurons that
occasionally appeared within the Nkx2.2 domain in posterior segments
of the spinal cord.
|
Nkx2.9 mutants show defects of the spinal accessory
nerve
Progenitors in the p3 domain of the hindbrain also co-express
Nkx2.9 and Nkx2.2 but give rise to branchio-visceral
motoneurons rather than to V3 neurons, as they do in the spinal cord
(Ericson et al., 1997b
;
Tanabe et al., 1998
).
Interestingly, the correct formation of branchial, visceral and somatic
motoneurons in hindbrain of Nkx2.2-deficient mice was not affected,
probably because of the overlapping expression of Nkx2.9 and
functional redundancy of both transcription factors
(Briscoe et al., 1999
). To test
whether Nkx2.9 may have a role in specifying neuronal cell types in hindbrain,
we first analyzed the nerve pattern in the cranial region of E10.5 and E11.5
embryos by whole-mount immunostaining using the anti-neurofilament antibody
2H3. Although most cranial nerves appeared unaffected in homozygous mutant
embryos, the spinal accessory nerve (XIth) containing axons of purely
branchial motoneurons was abnormal. The bundle of axon trajectories of this
nerve was consistently thinner and shorter in homozygous Nkx2.9
mutants than in wild-type animals (Fig.
4A-D). A significant fraction of mutant embryos showed additional
abnormalities of the glossopharyngeal (IXth) and vagal (Xth) nerves, which
appeared to be partially fused and axons, particularly in the vagal nerve,
were reduced compared with wild-type animals
(Fig. 4A-D). The truncation of
the spinal accessory nerve was even more pronounced in E11.5 mutant embryos
(Fig. 4E-H). The hypoglossal
nerve (XIIth), a somatic motor nerve, and the cervical motor nerves were
morphologically unaltered with normal ventral axon projections. These
observations were a first indication that the Nkx2.9 null-mutation
affected the normal formation of some cranial nerves, most notably those
containing axons of the branchial motoneuron subtype. By contrast, nerves of
the somatic motoneuron type appeared to be normal. It is important to note,
however, that the Nkx2.9 mutation did not cause complete absence of
any brainstem nerves but rather seemed to result in a partial loss of neurons,
presumably of a particular subtype.
|
Branchial motoneuron progenitors are reduced in Nkx2.9
mutants
Significantly, the most visibly affected nerve in mutant embryos, the
nervus accessorius (XIth) consists of branchial motoneurons in line with the
expression of Nkx2.9 in progenitor cells of this neuronal subtype. The
branchial motoneurons of the spinal accessory nucleus (SAN) are generated in
the ventral neural tube at the C4-C3 level
(Krammer et al., 1987
;
Liinamaa et al., 1997
)
together with somatic motoneurons of the median motor column (MMC)
(Callister et al., 1987
) and
phrenic motoneurons (Goshgarian and
Rafols, 1981
). At midgestation, cell bodies of MMC neurons are
located in a ventromedial position and project axons ventrally through
segmental motor nerves, while SAN neurons migrate to a dorsolateral position
and project axons via the spinal accessory nerve. These spinal accessory
neurons express Isl1 but not Isl2 and Lim3/Lhx3, whereas MMCs express Isl1
together with Isl2 and Lim3 (Ericson et
al., 1997b
).
We analyzed the neuronal progenitor cell populations at different hindbrain levels and in the anterior spinal cord. Immunostaining of E10.5 embryos with Isl1-specific antibody revealed no significant difference in total numbers of Isl1-positive cells in the ventromedial position between wild-type and homozygous mutant embryos, suggesting that motoneurons were generated in the absence of Nkx2.9, occupying the correct domain dorsally adjacent to the Nkx2.2-expressing cells (Fig. 5A,B). If anything, a slight but statistically not significant increase of Isl1-positive cells was observed in the mutant. On serial transverse sections through the spinal cord at C4-C3 level, however, the number of laterally migrating Isl1-positive cells representing immature SANs was drastically reduced (Fig. 5). Cell counts showed 60 to 70% loss of these cells in Nkx2.9-null mutant embryos compared with wild-type or heterozygous animals. We also determined the number of Isl1/Lim3 co-expressing somatic motoneurons of the MMC and found a marked increase of these cells in mutant embryos by approximately the same margin by which branchial motoneurons of the SAN were decreased (Fig. 5C,D). From these results, we conclude that lack of Nkx2.9 causes the formation of supernumerary somatic motoneurons of the MMC at the expense of branchial motoneurons at the level of C3-C4, consistent with fewer axons projecting from the SAN into the spinal accessory nerve.
|
In order to test whether this also applies to other progenitors of the
branchial motor column, we performed immunostaining on serial transverse
sections through hindbrain of E10.5 embryos, employing Phox2b-specific
antibodies that mark visceral and branchial motoneurons and Isl1-specific
antibodies that label postmitotic motoneurons
(Pattyn et al., 2000
;
Pattyn et al., 1997
). At the
level of rhombomeres 4/5, both wild-type and mutant embryos displayed the
normal pattern of Phox2b-positive cells in the ventral, lateral and dorsal
domains, and in a dorsoventral string of cells at the lateral aspect of the
neural tube that probably correspond to the presumptive motoneurons of the
facial nucleus (Fig. 6A,E).
Likewise, Isl1-positive cells appeared unchanged in the mutant
(Fig. 6B,F). In keeping with
the normal appearance of the facial nerve in mutants, this result suggests
that lack of Nkx2.9 does not affect all branchial motoneurons but rather a
subset. Similar immunostaining at more caudal level (r7), where progenitors of
the nucleus ambiguus arise, also did not show statistically significant
differences of Phox2b- and Isl1-positive cells between wild-type and mutant
embryos, suggesting that normal numbers of motoneurons have been born
(Fig. 6C,D,G,H).
|
Analysis of brainstem nuclei in adult mutant mice
Given the reduced number of branchial motoneuron progenitors of the SAN in
mutant mouse embryos, the altered morphology of the accessory nerve, and the,
albeit not fully penetrant, alterations of the vagal and glossopharyngeal
nerves, we sought to analyze the corresponding mature neurons in brain stem of
adult animals. Nuclei projecting branchio-efferent fibers to the
glossopharyngeal (IX), vagus (X) and the cranial region of the spinal
accessory (XI) nerves are located in the nucleus ambiguus, while the spinal
region of the XIth brainstem nerve is classically said to come from the SAN.
Visceral motoneurons of the vagus are located in the dorsal motor nucleus of
the vagus (dmnX). We performed cell counts using Nissl staining and
immunohistochemistry for acetylcholineesterase on serial transverse sections
through hindbrain of adult mice and found no significant differences in the
size of the dmnX and the nucleus ambiguus between wild-type and mutant mice
(Fig. 7A,C,F,H). Significantly,
however, immunostaining of parallel sections for Phox2b revealed a drastic
reduction of Phox2b-positive cells in the nucleus ambiguus of mutant mice,
whereas the number of these cells appeared unchanged in the dmnX
(Fig. 7E,J). These results then
suggest that Nkx2.9 is essential for maintenance of Phox2b expression and
probably terminal differentiation of branchial motoneurons, while Phox2b
expression in visceral motoneurons of the dmnX is apparently not dependent on
Nkx2.9. A differentiation defect of branchial motoneurons in the nucleus
ambiguus would be consistent with the mutant phenotype of the vagus and
glossopharyngeus nerves in the Nkx2.9 mutant. Unfortunately, the SAN
located in the rostral spinal cord was not amenable to this type of analysis
in our hands, because these neurons do not form a conspicuous nucleus.
|
| DISCUSSION |
|---|
|
|
|---|
In mice that lack the Nkx2.2 gene, neurons that normally arise in
territories of the neural tube that are exposed to lower Shh activity now form
ectopically in more ventral domains with higher Shh activity
(Briscoe et al., 1999
). This
observation has been interpreted as ventral-to-dorsal transformation of
progenitor cell fates. Lack of Nkx2.2, however, does not affect the
establishment of neuronal cells in ventral spinal cord but rather seems to
control their position-specific differentiation. Interestingly, a similar
switch in neuronal cell fate has been observed in Drosophila that
lack the NK2/vnd gene, suggesting that NK2 functions have been conserved
during evolution (McDonald et al.,
1998
). Mice carrying the Nkx2.9 mutation, as reported
here, do not show the transformation of neuronal cell fates in the spinal cord
with the exception of few individual Isl1-positive putative motoneurons that
are located ectopically within the Nkx2.2 domain of the posterior
neural tube. Why these rare and misfated cells arise is not clear, but it may
either reflect a crucial threshold level of Nkx2.2 or a very small
subpopulation of cells which normally express Nkx2.9 only.
Nkx2.9 mutant mice develop the normal V3 neuron progenitor domain
(p3-domain) but also form the correct compartments of mature V3 neurons and
somatic motoneurons, as judged by the expression of Sim1, and maintenance of
the normal Nkx2.2 and Isl1-positive cell domains. These results clearly
demonstrate that, unlike Nkx2.2, Nkx2.9 is not required to generate V3 neurons
from P3-domain progenitors. A likely explanation of this phenotype is the
overlapping expression and redundant activity of Nkx2.2 that may substitute
for the missing Nkx2.9. Indeed, individual overexpression of Nkx2.2 or
Nkx2.9 is sufficient to induce the expression of Sim1 and generate V3
neurons throughout the Nkx6.1 domain, and each factor alone can suppress
somatic motoneuron fate by repressing Pax6 expression
(Briscoe et al., 2000
). This of
course raises the question of why loss of Nkx2.2 is apparently not rescued by
Nkx2.9, although the latter gene is expressed in the absence of
Nkx2.2 during early embryogenesis (Briscoe
et al., 1999
). The explanation for the distinct phenotypes of
Nkx2.2 and Nkx2.9 mutants may come from the different
temporal expression patterns of both genes. While Nkx2.9 in ventral
spinal cord at trunk level is rapidly downregulated after establishment of the
p3 domain, Nkx2.2 expression persists much longer until V3 neurons
are definitively determined. In fact, an early rescue function of Nkx2.9 can
be deduced from the observation that few Sim1-positive cells have been
observed occasionally in Nkx2.2-deficient mice early on, while these
cells were completely lost at later developmental stages
(Briscoe et al., 1999
).
Clarification of whether both Nkx transcription factors exert redundant
functions or even participate in the establishment of the p3-domain at early
stages awaits the generation of the double mutant mouse that lacks both
Nkx2.2 and Nkx2.9 gene products.
Expression of Nkx2.9 in brain parallels that of Nkx2.2
and continues until at least E11 of embryogenesis, in contrast to its early
repression in spinal cord. In line with the prolonged presence of Nkx2.9 in
brain domains and supporting the idea of redundant activities,
Nkx2.2-deficient mice exhibit no obvious phenotypic switch in
motoneuron identity within the hindbrain
(Briscoe et al., 1999
). In the
reverse situation presented here by the Nkx2.9 knockout mouse, e.g.
lack of Nkx2.9 but continuing presence of Nkx2.2, the phenotypic rescue is at
least incomplete. In hindbrain neuronal progenitors of the p3 domain that
co-express Nkx2.2 and Nkx2.9 give rise to branchiovisceral
motoneurons (Ericson et al.,
1997b
). These cells can be identified by the expression of the
transcription factor Phox2b (Dubreuil et
al., 2000
; Pattyn et al.,
2000
; Pattyn et al.,
1997
). In E10.5 mutant embryos, Phox2b expression appears
essentially normal in hindbrain at different axial levels, indicating that the
formation of branchiovisceral motoneurons is not generally dependent on Nkx2.9
function but rather affects a subset or only some of these cells.
Significantly, the population of presumptive branchial motoneurons of the
spinal accessory nucleus, which are characterized by expressing Isl1 alone and
their dorsolateral position in neural tube, is markedly reduced in the mutant
mouse. Moreover, the population of somatic motoneurons of the median motor
column, which co-express Isl1, Isl2 and Lim3, is increased. This result
somewhat resembles the cell fate switch observed in the spinal cord of
Nkx2.2 mutants with respect to the increase of somatic motoneurons at
the expense of another neuronal subpopulation originating in the
Nkx2.2/Nkx2.9 domain. Whether this reflects aberrant
specification of neuronal identity in response to graded Shh signaling, as it
is the case in Nkx2.2 mutants, cannot be decided easily here, because
the precise local relationship of the premigratory SAN progenitors and the
median motor column precursors is not clear. Consistent with the reduction of
branchial motoneurons in the dorsolateral position of the neural tube at the
level of C4-C3 we found a severely abnormal spinal accessory nerve in all
mutant mice. The partial phenotype of the glossopharyngeal and the vagal
nerves in
50% of mutant embryos may be related to the finding that, in
the absence of Nkx2.9, Phox2b expression in cells of the nucleus ambiguus is
drastically reduced, although the number of cells appears largely unaltered.
As Nkx2.9 is only expressed in the progenitor domain and Phox2b-positive
progenitors are present in normal numbers in the neuroepithelium of mutant
embryos (E10.5), but not in the mature nucleus ambiguus, it seems to have a
function in maintaining the phenotypic trait of branchial motoneurons rather
than specifying them. Another unknown transcription factor is possible
involved acting downstream of Nkx2.9. Whether the alterations in the nucleus
ambiguus also contribute to the mutant phenotype of the spinal accessory nerve
appears disputable, as the existence of projections from the nucleus ambiguus
has been recently questioned, at least in humans
(Lachman et al., 2002
). The
three nerves affected in the mutant belong to the branchial motor column,
suggesting that Nkx2.9 in the hindbrain has a unique role in formation of
branchial motoneurons, a function that can not be fully substituted for by
Nkx2.2. Clearly, visceral motoneurons are not affected by the Nkx2.9
mutation, as demonstrated here for the dmnX. It is also interesting to note
that the more rostrally located branchial motor nerves, such as the facialis
and the trigeminus nerve, appear quite normal in mutants, suggesting a
differential requirement for Nkx2.9 along the rostrocaudal axis. Whether the
fractional loss of branchial motoneurons in hindbrain of Nkx2.9
mutants is due to partial rescue by redundant Nkx2.2 function or,
alternatively, reflects the total loss of a neuronal subpopulation whose fate
is entirely dependent on Nkx2.9, cannot be decided unequivocally by the
available data. The latter possibility, however, seems less likely given the
reduced size but not the complete absence of the affected nerves. Taken
together, our data provide evidence that Nkx2.9 is a crucial transcription
factor for the determination and/or differentiation of at least a subset of
branchial motoneurons during hindbrain development. Its early role in
establishing the p3-domain in spinal cord remains to be determined in
Nkx2.2/Nkx2.9 double mutants.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Barth, K. A. and Wilson, S. W. (1995). Expression of zebrafish nk2.2 is influenced by sonic hedgehog/vertebrate hedgehog-1 and demarcates a zone of neuronal differentiation in the embryonic forebrain. Development 121,1755 -1768.[Abstract]
Bober, E., Franz, T., Arnold, H. H., Gruss, P. and Tremblay, P. (1994). Pax3 is required for the development of limb muscles: a possible role for the migration of dermomyotomal muscle progenitor cells. Development 120,603 -612.[Abstract]
Briscoe, J., Sussel, L., Serup, P., Hartigan-O'Connor, D., Jessell, T. M., Rubenstein, J. L. and Ericson, J. (1999). Homeobox gene Nkx2.2 and specification of neuronal identity by graded Sonic hedgehog signalling. Nature 398,622 -627.[CrossRef][Medline]
Briscoe, J., Pierani, A., Jessell, T. M. and Ericson, J. (2000). A homeodomain protein code specifies progenitor cell identity and neuronal fate in the ventral neural tube. Cell 101,435 -445.[CrossRef][Medline]
Callister, R. J., Brichta, A. M. and Peterson, E. H. (1987). Quantitative analysis of cervical musculature in rats: histochemical composition and motor pool organization. II. Deep dorsal muscles. J. Comp. Neurol. 255,369 -385.[CrossRef][Medline]
Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J. L., Westphal, H. and Beachy, P. A. (1996). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383,407 -413.[CrossRef][Medline]
Dubreuil, V., Hirsch, M. R., Pattyn, A., Brunet, J. F. and Goridis, C. (2000). The Phox2b transcription factor coordinately regulates neuronal cell cycle exit and identity. Development 127,5191 -5201.[Abstract]
Ericson, J., Briscoe, J., Rashbass, P., van Heyningen, V. and
Jessell, T. M. (1997a). Graded sonic hedgehog signaling and
the specification of cell fate in the ventral neural tube. Cold
Spring Harb. Symp. Quant. Biol. 62,451
-466.
Ericson, J., Rashbass, P., Schedl, A., Brenner-Morton, S., Kawakami, A., van Heyningen, V., Jessell, T. M. and Briscoe, J. (1997b). Pax6 controls progenitor cell identity and neuronal fate in response to graded Shh signaling. Cell 90,169 -180.[CrossRef][Medline]
Fan, C. M., Kuwana, E., Bulfone, A., Fletcher, C. F., Copeland, N. G., Jenkins, N. A., Crews, S., Martinez, S., Puelles, L., Rubenstein, J. L. et al. (1996). Expression patterns of two murine homologs of Drosophila single-minded suggest possible roles in embryonic patterning and in the pathogenesis of Down syndrome. Mol. Cell. Neurosci. 7,1 -16.[CrossRef][Medline]
Goshgarian, H. G. and Rafols, J. A. (1981). The phrenic nucleus of th albino rat: a correlative HRP and Golgi study. J. Comp. Neurol. 201,441 -456.[CrossRef][Medline]
Hartigan, D. J. and Rubenstein, J. L. (1996). The cDNA sequence of murine Nkx-2.2. Gene 168,271 -272.[CrossRef][Medline]
Kim, Y. and Nirenberg, M. (1989). Drosophila
NK-homeobox genes. Proc. Natl. Acad. Sci. USA
86,7716
-7720.
Krammer, E. B., Lischka, M. F., Egger, T. P., Riedl, M. and Gruber, H. (1987). The motoneuronal organization of the spinal accessory nuclear complex. Adv. Anat. Embryol. Cell Biol. 103,1 -62.[Medline]
Lachman, N., Acland, R. D. and Rosse, C. (2002). Anatomical evidence for the absence of a morphologically distinct cranial root of the accessory nerve in man. Clin. Anat. 15,4 -10.[CrossRef][Medline]
Liinamaa, T. L., Keane, J. and Richmond, F. J. (1997). Distribution of motoneurons supplying feline neck muscles taking origin from the shoulder girdle. J. Comp. Neurol. 377,298 -312.[CrossRef][Medline]
Marin, O., Baker, J., Puelles, L. and Rubenstein, J. L.
(2002). Patterning of the basal telencephalon and hypothalamus is
essential for guidance of cortical projections.
Development 129,761
-773.
Marti, E., Bumcrot, D. A., Takada, R. and McMahon, A. P. (1995). Requirement of 19K form of Sonic hedgehog for induction of distinct ventral cell types in CNS explants. Nature 375,322 -325.[CrossRef][Medline]
McDonald, J. A., Holbrook, S., Isshiki, T., Weiss, J., Doe, C.
Q. and Mellerick, D. M. (1998). Dorsoventral patterning in
the Drosophila central nervous system: the vnd homeobox gene specifies ventral
column identity. Genes Dev.
12,3603
-3612.
Osumi, N., Hirota, A., Ohuchi, H., Nakafuku, M., Iimura, T., Kuratani, S., Fujiwara, M., Noji, S. and Eto, K. (1997). Pax-6 is involved in the specification of hindbrain motor neuron subtype. Development 124,2961 -2972.[Abstract]
Pabst, O., Herbrand, H. and Arnold, H. H. (1998). Nkx2-9 is a novel homeobox transcription factor which demarcates ventral domains in the developing mouse CNS. Mech. Dev. 73,85 -93.[CrossRef][Medline]
Pabst, O., Herbrand, H., Takuma, N. and Arnold, H. H. (2000). NKX2 gene expression in neuroectoderm but not in mesendodermally derived structures depends on sonic hedgehog in mouse embryos. Dev. Genes Evol. 210,47 -50.[CrossRef][Medline]
Pattyn, A., Hirsch, M., Goridis, C. and Brunet, J. F. (2000). Control of hindbrain motor neuron differentiation by the homeobox gene Phox2b. Development 127,1349 -1358.[Abstract]
Pattyn, A., Morin, X., Cremer, H., Goridis, C. and Brunet, J. F. (1997). Expression and interactions of the two closely related homeobox genes Phox2a and Phox2b during neurogenesis. Development 124,4065 -4075.[Abstract]
Qi, Y., Cai, J., Wu, Y., Wu, R., Lee, J., Fu, H., Rao, M.,
Sussel, L., Rubenstein, J. and Qiu, M. (2001). Control of
oligodendrocyte differentiation by the Nkx2.2 homeodomain transcription
factor. Development 128,2723
-2733.
Qiu, M., Shimamura, K., Sussel, L., Chen, S. and Rubenstein, J. L. (1998). Control of anteroposterior and dorsoventral domains of Nkx-6.1 gene expression relative to other Nkx genes during vertebrate CNS development. Mech. Dev. 72, 77-88.[CrossRef][Medline]
Sander, M., Paydar, S., Ericson, J., Briscoe, J., Berber, E.,
German, M., Jessell, T. M. and Rubenstein, J. L. (2000).
Ventral neural patterning by Nkx homeobox genes: Nkx6.1 controls somatic motor
neuron and ventral interneuron fates. Genes Dev.
14,2134
-2139.
Shimamura, K., Hartigan, D. J., Martinez, S., Puelles, L. and Rubenstein, J. L. (1995). Longitudinal organization of the anterior neural plate and neural tube. Development 121,3923 -3933.[Abstract]
Sommer, L., Ma, Q. and Anderson, D. J. (1996). neurogenins, a novel family of atonal-related bHLH transcription factors, are putative mammalian neuronal determination genes that reveal progenitor cell heterogeneity in the developing CNS and PNS. Mol. Cell. Neurosci. 8,221 -241.[CrossRef][Medline]
Sussel, L., Marin, O., Kimura, S. and Rubenstein, J. L. (1999). Loss of Nkx2.1 homeobox gene function results in a ventral to dorsal molecular respecification within the basal telencephalon: evidence for a transformation of the pallidum into the striatum. Development 126,3359 -3370.[Abstract]
Tanabe, Y., William, C. and Jessell, T. M. (1998). Specification of motor neuron identity by the MNR2 homeodomain protein. Cell 95, 67-80.[CrossRef][Medline]
Wang, C. C., Brodnicki, T., Copeland, N. G., Jenkins, N. A. and Harvey, R. P. (2000). Conserved linkage of NK-2 homeobox gene pairs Nkx2-2/2-4 and Nkx2-1/2-9 in mammals. Mamm. Genome 11,466 -468.[CrossRef][Medline]
Yamada, T., Placzek, M., Tanaka, H., Dodd, J. and Jessell, T. M. (1991). Control of cell pattern in the developing nervous system: polarizing activity of the floor plate and notochord. Cell 64,635 -647.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. Tian, R. Mahmood, R. Hnasko, and J. Locker Loss of Nkx2.8 Deregulates Progenitor Cells in the Large Airways and Leads to Dysplasia Cancer Res., November 1, 2006; 66(21): 10399 - 10407. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Dillon, S. C. Fujita, M. P. Matise, A. A. Jarjour, T. E. Kennedy, H. Kollmus, H.-H. Arnold, J. A. Weiner, J. R. Sanes, and Z. Kaprielian Molecular Control of Spinal Accessory Motor Neuron/Axon Development in the Mouse Spinal Cord J. Neurosci., November 2, 2005; 25(44): 10119 - 10130. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hester, J. C. Thompson, J. Mills, Y. Liu, H. M. El-Hodiri, and M. Weinstein Smad1 and Smad8 Function Similarly in Mammalian Central Nervous System Development Mol. Cell. Biol., June 1, 2005; 25(11): 4683 - 4692. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Muller, N. Jabs, D. E. Lork, B. Fritzsch, and M. Sander Nkx6.1 controls migration and axon pathfinding of cranial branchio-motoneurons Development, December 1, 2003; 130(23): 5815 - 5826. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pattyn, A. Vallstedt, J. M. Dias, M. Sander, and J. Ericson Complementary roles for Nkx6 and Nkx2 class proteins in the establishment of motoneuron identity in the hindbrain Development, September 1, 2003; 130(17): 4149 - 4159. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||