|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00351

1 Department of Cell Biology Faculty of Biology, and Barcelona Science Park,
University of Barcelona, Barcelona 08028, Spain
2 Department of Cell Biology, Faculty of Biological Sciences, University of
Valencia, 46100 Burjassot, Spain
3 Department of Biological Sciences, Columbia University, New York, New York
10027, USA
4 Department of Neurosciences, Karolinska Institute, Stockholm 17177,
Sweden
Author for correspondence (e-mail:
soriano{at}porthos.bio.ub.es)
Accepted 18 December 2002
| SUMMARY |
|---|
|
|
|---|
We also show that BDNF overexpression increases the number of synapses at much earlier stages (E18) than those reported previously. Most of these synapses were GABAergic, and GABAergic interneurons showed hypertrophy and a 3-fold increase in GAD expression. Interestingly, whereas BDNF does not alter the expression of GABA and glutamate ionotropic receptors, it does raise the expression of the recently cloned K+/Cl- KCC2 co-transporter, which is responsible for the conversion of GABA responses from depolarizing to inhibitory, through the control of the Cl- potential. Together, results indicate that both the presynaptic and postsynaptic machineries of GABAergic circuits may be essential targets of BDNF actions to control spontaneous activity. The data indicate that BDNF is a potent regulator of spontaneous activity and co-active networks, which is a new level of regulation of neurotrophins. Given that BDNF itself is regulated by neuronal activity, we suggest that BDNF acts as a homeostatic factor controlling the emergence, complexity and networking properties of spontaneous networks.
Key words: Synaptogenesis, KCC2, Spontaneous activity, CNS, BDNF, Mouse, GABA, Ca2+ oscillations
| INTRODUCTION |
|---|
|
|
|---|
Although certain signaling mechanisms, particularly neurotransmitters and
gap junctions, are thought to sustain spontaneous activity, the signals
regulating the formation and complexity of spontaneous co-active networks have
not been identified (Yuste et al.,
1995
; Ben-Ari et al.,
1997
; Garaschuk et al.,
1998
; Feller,
1999
; O'Donovan,
1999
; Ben-Ari,
2001
). The neurotrophin family exerts potent trophic actions in
the peripheral and central nervous systems (PNS and CNS) through the tyrosine
kinase receptors TrkA, TrkB and TrkC, and the death domain-containing p75
receptor (Huang and Reichardt,
2001
). Neurotrophins are also associated with the structural and
functional regulation of axonal and dendritic growth, synapse formation and
synaptic transmission (Huang et al.,
1999
; McAllister et al.,
1999
; Schuman,
1999
; Schinder and Poo,
2000
; Alsina et al.,
2001
; Huang and Reichardt,
2001
). In contrast, whether neurotrophins regulate the emergence
and patterns of spontaneous neuronal activity at early developmental stages is
currently unknown. We now show that, in vivo, overexpression of BDNF regulates
the onset and complexity of spontaneous correlated network activity from very
early stages of development. We also show that higher rates of synaptogenesis
and GABA production, and the expression of the KCC2 co-transporter, which
controls intracellular [Cl-] level, underlie the effects of BDNF on
coordinated network activity.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Histological techniques
Dil tracing
Small crystals of the lipophilic tracer DiI (Molecular Probes) were placed
in the entorhinal cortex of paraformaldehyde-fixed wild-type (n=4)
and transgenic (n=3) brains and horizontal sections were
counterstained with bisbenzimide (Sigma)
(Barallobre et al., 2000
).
Immunocytochemistry
Free-floating sections (Barallobre et
al., 2000
) from four wild-type and four transgenic brains were
incubated with the following primary antibodies: GluR1, GluR2/3 and synapsin I
(Chemicon), synaptophysin and syntaxin 1 (Sigma), NMDAR1 and NMDAR2A
(Watanabe et al., 1998
),
GABAA
1 and GABAA
2
(Fritschy et al., 1994
),
calbindin and calretinin (Swant, Bellizona, Switzerland). Sections were
processed using the Vectastain ABC kit (Vector Laboratories, UK).
In situ hybridization
Non-radioactive hybridizations were performed on three transgenic and four
control brains according to the method of Barallobre et al.
(Barallobre et al., 2000
). RNA
probes against the two rat glutamic decarboxylase isoforms (GAD65
and GAD67) have been described previously
(Erlander et al., 1991
). To
obtain the KCC2 riboprobe, RNA from mouse brain was reverse-transcribed with
M-MuLV (Biolabs), and a 474 pb fragment of mouse KCC2 (AF332064 GenBank
database) was amplified by PCR (forward primer:
5'-CTCAACAACCTGACGGACTG-3'; reverse primer:
5'-GCACAACACCATTGGTT GCG-3').
Electron microscopy
Four wild-type and five transgenic brains were prepared for EM analysis
(Crespo et al., 2000
) and
electron micrographs were randomly taken from the stratum radiatum of the CA1
region at a final magnification of x26,000. Vesicles were considered
docked when their membrane was less than 50 nm from the presynaptic active
zone (Rosahl et al., 1995
).
Post-embedding GABA immunostaining followed the method described by Crespo et
al. (Crespo et al., 2000
),
using a rabbit anti-GABA antiserum and 10 nm colloidal gold-coated secondary
antibodies (Sigma). Electron micrographs at final magnifications of
x52,000 were taken at random from the stratum radiatum.
Biochemical and molecular techniques
Western blotting
The proteins of total membrane fractions from the forebrains of 3
transgenic BDNF-overexpressing mice and 3 control littermates were separated
by 8% and 10% SDS-PAGE and electrotransferred to a nitrocellulose membrane.
The membranes were incubated with the same primary antibodies used for
immunocytochemical assays, and with an anti-ATPase ß1 (Upstate
Biotechnology) and bound Igs were viewed using the ECL chemiluminescent system
(Amersham). Densitometric analysis, standardized to ATPase ß1, was
performed using Imat software.
Northern blotting
Twenty µg of total RNA from two BDNF transgenic and two control
forebrains per sample were hybridized with BDNF (484-825 bp in the coding
sequence of mouse BDNF) and GAD67
(Erlander et al., 1991
) cDNA
probes labeled with 32P. The same filters were rehybridized with a
mouse cyclophilin cDNA probe to standardize RNA. Autoradiograms were
quantified as above.
Reverse transcription-PCR and southern hybridization
One µg of total RNA from each forebrain was retrotranscribed and
amplified using the Reverse Transcription System (Promega). Amplification was
run up to 25 cycles with taq polymerase. For the KCC2 assays the
forward and reverse primers described above were utilized. For glyceraldehyde
phosphate dehydrogenase (GAPDH) assays the forward primer was
GGCCCCTCTGGAAAGCTGTGG, and the reverse primer was CCTTGGAGGCCATGTAGGCCAT (608
to 1043 nucleotides of mouse GADPH). Autoradiograms of Southern blots of PCR
products were quantified as above.
Imaging
Neuronal activity was recorded on hippocampal acute slices (E16-P5 stages)
(Schwartz et al., 1998
;
Aguiló et al., 1999
).
The brains were removed into ice-cold artificial cerebrospinal fluid (ACSF)
solution composed of (in mM): NaCl 120, KCl 3, D-glucose 10, NaHCO3
26, NaH2PO4 2.25, CaCl2 2, MgSO4
1, pH 7.4, bubbled with 95% O2 and 5% CO2. Transverse
hippocampal slices (300 µm) were incubated with the Ca2+
indicator fura-2-AM (Molecular Probes, Eugene, OR). Images were captured in an
upright fluorescence microscope (BX50WI; Olympus, Tokyo, Japan) at room
temperature (22-25°C) with a silicon-intensifier tube (SIT) camera
(Hamamatsu C2400-08). Fura-2 fluorescence images were collected at 4 second
intervals (15 frames average for each time point) using a 380 nm bandpass
filter controlled by the NIH Image program.
(±)-2-amino-5-phosphonopentanoic acid (APV),
6-cyano-7-nitroquinoxaline-2, 3-dione (CNQX) and ()-bicuculline
methiodide (BMI) were obtained from Sigma.
Network analysis
Changes in fluorescence,
F/F=(F0-F1)/(F0),
were analyzed with a program written in Interactive Data Language (IDL;
Research Systems Inc., Boulder, CO)
(Schwartz et al., 1998
;
Aguiló et al., 1999
).
The time of initiation of each Ca2+ transient for each cell was
marked in a raster plot. These raster plots were used to calculate the matrix
of asymmetric correlation coefficients between all cell pairs. Contingency
tables and
2 tests were then used to detect which of the
correlation coefficients was significantly greater than expected. Significant
correlation coefficients were used to generate a correlation map in which
lines link neurons whose asymmetric correlation coefficient is significant
(P<0.01) and in which the thickness of a line connecting any two
cells represents the magnitude of the greatest asymmetric correlation
coefficient between the cells (Schwartz et
al., 1998
; Aguiló et
al., 1999
).
To test whether the [Ca2+]i transients showed
associations between the neurons within a network, the number of simultaneous
activations in a recording was measured and used as a statistical test
(Schwartz et al., 1998
;
Aguiló et al., 1999
). To
determine its P value, the distribution of the statistics under the
null hypothesis of independent transients was computed by Monte Carlo
simulation. The P value was then estimated as the proportion of the
1,000 replications in which the statistical test exceeded the statistical test
computed from the real data. To simulate independent realizations of the
transients, the number of cells, activations and time intervals were
preserved, but the initiations of the transients were taken at random.
Statistics
The Student's t, Mann-Whitney U and Bernouilli tests were used.
Data are expressed as mean ± s.e.m.
| RESULTS |
|---|
|
|
|---|
|
|
We focused on the CA1 region and measured both the number of active cells and the frequency of Ca2+ oscillations. Few active cells were recorded at E16-E17 (Fig. 1D), but the number increased at E18 and around birth (postnatal days 0-1, P0-P1). There was a 2- to 3-fold increase in the number of active neurons at P2-P5 over P0. Similarly, the rate of activation per neuron increased from prenatal to postnatal stages, with a maximum between P2 and P5 (Fig. 1E). We conclude that spontaneous neuronal activity in the hippocampus emerges at E16 and reaches highest levels during postnatal development.
We represented the profile of activation of every active cells in each
movie in raster plots (Fig.
2A-C,F,G). By comparing the raster plots of embryonic and
postnatal stages, we observed that the number of apparent synchronous firing
events increased with age (Fig.
2C,G). We next used a statistical analysis based on contingency
tables and
2 tests to identify pairs of cells with significant
synchronous activity (Schwartz et al.,
1998
; Aguiló et al.,
1999
). This analysis results in correlation maps illustrating
networks of co-active cells, in which each pair of synchronous cells is
connected by lines whose thickness is proportional to the degree of
correlation (see Materials and Methods)
(Fig. 2D,H). Very simple
correlation maps were observed at E16-E17
(Fig. 2D), whereas the
complexity of the networks increased at E18-P1
(Fig. 2H). From P2 onwards,
virtually every active neuron displayed synchronous firing, resulting in
complex correlation maps in which all active neurons were recruited into
synchronous Ca2+ waves (not shown, see raster plot in
Fig. 2G). The percentage of
active cells with correlated activity increased progressively from 33% at E16
to 78-94% at P3-P5 (Fig. 2J),
demonstrating that most active cells formed part of a coordinated network at
early postnatal stages.
We also measured the overall degree of synchronous correlation in each
network sample, by comparing the number of times any two cells showed
simultaneous onset of activation in the actual experiment (number of
co-activations) with the number of co-activation events present in a
theoretical distribution of 1,000 data sets created by random Monte Carlo
simulation (Schwartz et al.,
1998
). This comparison gives a P value for the
experimental data set that describes the probability that the entire number of
co-activations present in each sample was random
(Fig. 2E,I). Because the
simulations are performed with the same number of neurons as in the actual
experiment, the statistical significance of the correlation is independent of
the number of neurons forming part of a given network
(Schwartz et al., 1998
;
Aguiló et al., 1999
).
The first significant overall correlated networks (P<0.05) were
found at E18 (2 out of 7), and more were found at P0-P1 (9 out of 17). In
contrast, all 22 samples recorded at P2-P5 showed significant correlations,
indicating the generation of highly synchronous networks
(Fig. 2K). The developmental
rise of synchronous networks (statistically significant P values)
parallels a non-linear increase in the number of active cells
(Fig. 2L), suggesting that a
threshold of active neurons is required to generate complex patterns of
synchronous activity.
These results show that spontaneous activity in the hippocampus increases progressively from embryonic to postnatal stages, with significant synchronized network activity emerging only after E18. However, not until P2 does spontaneous neuronal activity became organized into highly complex patterns of synchronous activity.
BDNF overexpression enhances spontaneous correlated network activity
at embryonic stages
We examined the role of BDNF in the regulation of spontaneous correlated
networks at early stages in vivo, in transgenic mice overexpressing BDNF under
the control of the nestin promoter, which drives transgene expression
to CNS progenitors from E10, a few days before the onset of endogenous BDNF
production (Ringstedt et al.,
1998
). Expression of the specific BDNF receptor TrkB in the
forebrain begins at E13 (Knüsel et
al., 1994
). As these transgenic mice die of cardiac malfunction
soon after birth (Ringstedt et al.,
1998
), embryos were analyzed at E18. Littermate embryos, with no
integration of the transgene, were used as controls.
At E18, BDNF mRNA was barely detectable in control embryonic forebrains,
whereas nestin-BDNF transgenic forebrains showed conspicuous BDNF
mRNA expression, as determined by northern blot analysis
(Fig. 3A). In contrast to the
neocortex (Ringstedt et al.,
1998
), most nestin-BDNF transgenic mice displayed normal
hippocampal cytoarchitectonics, with the pyramidal and granule neurons
arranged in single layers. However, some of the embryos with the highest
number of integrated transgenes showed a double-pyramidal layer in the CA3-CA1
region (Fig. 3B,C). The
remaining neuronal populations of the embryonic hippocampus
(Supèr et al., 1998
),
including Cajal-Retzius cells and GABAergic interneurons, appeared
well-positioned, as shown by reelin (data not shown), calretinin, glutamic
acid decarboxylase (GAD) and calbindin labelling
(Fig. 3D,E,
Fig. 7A,B,D,E). Immunostaining
for the adhesion molecule L1 (Fig.
3F) and axonal tracing of the main hippocampal afferents by
injections of the tracer DiI (Fig.
3G), showed that axonal pathways were preserved in these
transgenic embryos (Barallobre et al.,
2000
).
|
|
We then investigated the effect of BDNF overexpression on the patterns of spontaneous activity. Recordings of changes of [Ca2+]i in the CA1 region showed very low levels of spontaneous neuronal activity in wild-type littermates (Fig. 4A-C), with few active neurons (18% of imaged cells) and low frequencies of activation (33 Ca2+ transients/cell/104 seconds) (Fig. 4I,J). Slices from BDNF-overexpressing mice showed a much greater spontaneous neuronal activity (Fig. 4E-G), with 2.3 times more active neurons (P=0.0001) and 36.3% greater rates of activation (P=0.003) (Fig. 4I,J). We conclude that BDNF overexpression markedly increases spontaneous neuronal activity at embryonic stages in vivo.
|
To investigate whether BDNF influences the pattern and complexity of
spontaneous correlated network activity, we applied the analyses based on
contingency tables,
2 test and Monte Carlo simulations.
Spatiotemporal analysis of wild-type hippocampi revealed a moderate number of
cases with significant overall co-activation (Monte Carlo: P<0.05;
55%, 16 out of 29) (Fig. 4L).
These correlated networks were simple, and composed of 18±4 neurons,
representing about half the active neurons present in the imaged fields
(Fig. 4D,K). Similar analyses
in BDNF transgenic slices revealed robust synchronous network activity using
raster plots (Fig. 4G).
Transgenic networks were composed of 38±4 co-activated neurons, 2.1
times more than in controls. Thus, about 83% of the active neurons in BDNF
transgenic slices were organized into complex synchronous networks
(Fig. 4G,H,K). The proportion
of slices showing significant overall network correlation was significantly
higher in BDNF transgenic slices (P<0.05; 69%, 29 out of 42
slices) than in control littermates (P<0.05, Bernouilli test).
Furthermore, the average P values, obtained by Monte Carlo
simulations, were dramatically lower (0.16±0.041 for wild-type versus
0.05±0.016 for transgenic) in nestin-BDNF mice
(Fig. 4L).
We conclude that prenatal overexpression of BDNF in vivo markedly enhances spontaneous neuronal activity by increasing the number of active neurons and their activation rate. Furthermore, BDNF also triggers the arrangement of such active neurons into highly synchronized correlated networks, which are reminiscent of those observed at P1-P2.
The expression of ionotropic neurotransmitter receptors and their
contribution to spontaneous neuronal activity are conserved in
BDNF-overexpressing embryos
We next determined whether the expression and distribution of GABA and
glutamate receptor subunits were altered in transgenic embryos overexpressing
BDNF. Immunoblot analysis of forebrain membranes showed no significant
alterations in the levels of the
1
(Fig. 5A) or
2 (data not
shown) subunits of the GABAA receptors. Similarly, no changes were
observed in the expression of the NR1, NR2A, GluR1 or GluR2/3 subunits
(Fig. 5A). To assess whether
the expression and distribution of these subunits might have been altered, we
performed immunocytochemical studies. The
2 GABAA, NR1,
GluR1 and GluR2/3 subunits were highly expressed in control hippocampi at E18
(Fig. 5B-D). Moderate
expression was found for the NR2A subunit and no signals were detected for the
1 GABAA subunit (see
Fritschy et al., 1994
).
Immunolabeling was mainly present in the plexiform layers, where the dendrites
of the principal neurons are located (Fig.
5B-D). No alterations were observed in either the expression
levels or the distribution of the
2 GABAA, NR1, GluR1 and
GluR2/3 subunits (Fig.
5E-G).
|
Next, we analyzed the effect of neurotransmitter receptor blockade on the
patterns of network activity (Fig.
5H-L). Administration of the GABAA receptor antagonist
BMI (30 µM) to wild-type E18 hippocampal slices dramatically reduced (55%)
the number of spontaneously active cells
(Fig. 5J). However, the neurons
that remained active showed only a slight reduction (less than 13%) in their
activation rates (Fig. 5K). The
effect of BMI on the complexity of co-active networks was also pronounced
(Fig. 5H,I), with a reduction
of 68% in the number of neurons belonging to correlated networks
(Fig. 5L). Similar, though less
marked, reductions in the percentages of active neurons and neurons present in
correlated networks were observed after NMDA blockade with APV (50 µM).
Only minor changes could be observed in slices treated with the non-NMDA
antagonist CNQX (20 µM) (Fig.
5J-L). We conclude that spontaneous network activity at embryonic
stages is controlled by GABAA ionotropic receptors and, to a lesser
extent, by NMDA glutamate receptors, which is consistent with analyses at
early postnatal stages (Ben-Ari et al.,
1997
; Garaschuk et al.,
1998
; Ben-Ari,
2001
). A similar analysis on nestin-BDNF transgenic
embryos showed comparable reductions in the percentages of both active neurons
and neurons in correlated networks, after treatment with BMI and APV, and no
major alterations after incubation with CNQX
(Fig. 5H-L). However, the
blockade of spontaneous activity by BMI in BDNF transgenic embryos was less
efficient than in control slices (Fig.
5J,L).
These results show that the major GABA and glutamate receptor subunits are present at E18 in the hippocampus, and that these receptors are required for the generation of networks of synchronous spontaneous activity. Our findings also indicate that BDNF overexpression at embryonic stages does not substantially alter either the expression of the receptor subunits or their physiological contribution to the generation of network activity.
Overexpression of BDNF at embryonic stages increases GABAergic and
non-GABAergic synaptogenesis and increases GAD65/67 expression
Since BDNF could be promoting synaptogenesis at early stages of
development, we analyzed the levels of expression of several presynaptic
markers (Fig. 6A-C).
Immunoblotting of forebrain membranes and immunostaining of hippocampal
sections showed no changes in the expression levels or distribution of the
synaptic vesicle markers synaptophysin and synapsin I, or the t-SNARE syntaxin
1 (Fig. 6A-C). However, these
proteins may not be unequivocal presynaptic markers since they are also
distributed along axonal tracts at early developmental stages
(Soriano et al., 1994
). We
therefore used electron microscopy (EM) to count the synaptic contacts.
Developing synapses at E18 were immature in appearance, displaying few
synaptic vesicles and short synaptic specializations
(Fig. 6D,E) (see also
Blue and Parnavelas, 1983
;
Vaughn, 1989
;
Fiala et al., 1998
). Synaptic
contacts seemed to be more frequent in transgenic than in control hippocampi,
regardless of the plexiform layer analyzed. Thus, we counted the number of
synapses in 3 wild-type and 3 transgenic embryos. BDNF transgenic embryos had
63% more synapses (P=0.0017) than control littermates in the stratum
radiatum (Fig. 6F). We conclude
that BDNF overexpression produces a marked increase in the total number of
synaptic contacts in the embryonic hippocampus.
|
We also observed that transgenic axon terminals displayed 59.5% fewer synaptic vesicles than terminals from control mice (Fig. 6D,E,G). However, the number of synaptic vesicles clustered near the active zone (see Materials and Methods) was higher in BDNF-overexpressing embryos (P<0.0001) (Fig. 6H). These results suggest alterations in the exocytotic cycle of synaptic vesicles in BDNF-overexpressing embryos.
Postsynaptic elements were usually large in size and displayed microtubules, thus most likely corresponding to dendrites (Fig. 6D,E). Visual inspection of the electromicrographs suggested that postsynaptic dendrites were larger in transgenic hippocampi (Fig. 6D,E). We thus measured the surface area of postsynaptic elements in wild-type and BDNF-transgenic embryos. As shown in Fig. 6I the area of postsynaptic elements was 1.6 times greater in transgenic embryos (P=0.001). In contrast, there were no differences in the surface area of presynaptic boutons between wild-type and transgenic hippocampi (0.6±0.06 µm2 versus 0.57±0.05 µm2, P=0.86) (Fig. 6J).
Because GABA is the main excitatory neurotransmitter at early development
stages (Ben-Ari, 2001
), we
analyzed whether the GABAergic system was altered in BDNF-overexpressing
embryos. In wild-type hippocampi, GAD65/67 mRNA was expressed at
moderate levels in the interneurons in the strata oriens and radiatum
(Fig. 7A) (Soriano et al., 1994
;
Supèr et al., 1998
).
The hippocampus of BDNF transgenic embryos showed dramatically greater
GAD65/67 mRNA hybridization, with positive neurons showing very
high expression levels (Fig.
7B). Northern blot analysis supported these observations by
showing 3-fold greater GAD67 mRNA
(Fig. 7C). Immunostaining for
calbindin (Soriano et al.,
1994
; Supèr et al.,
1998
) showed that interneurons had hypertrophied perikarya and
dendrites in BDNF transgenic embryos (Fig.
7D,E).
We next examined whether the increase in synaptic contacts in BDNF-overexpressing embryos also applied to GABAergic synapses. In both control and transgenic hippocampi, GABA-positive synaptic contacts were recognized by the presence of gold particles (Fig. 7F-H). The stratum radiatum of BDNF transgenic embryos had 2.9 times more GABA-positive synapses than those of controls (P<0.001) (Fig. 7I). We conclude that BDNF at embryonic stages dramatically increases GABAergic synaptogenesis and GAD65/67 mRNA expression, and leads to hypertrophy of the GABAergic interneurons.
Finally, we also quantified the number of GABA-negative synapses. 1.54 times more non-GABAergic synapses (P<0.05) were found in BDNF-transgenic hippocampi (2.4±0.2) than in wild-type embryos (1.55±0.2) (Fig. 7J). We conclude that BDNF overexpression increases both GABAergic and non-GABAergic synaptogenesis.
BDNF overexpression increases expression of the
K+/Cl- co-transporter KCC2 and alters
GABAA-evoked responses
During early stages of development, activation of GABAA
receptors induces Cl- efflux, which results in high depolarization
and triggers a rise in [Ca2+]i
(Cherubini et al., 1991
;
Ben-Ari, 2001
). As development
progresses, [Cl-]i decreases and the response of
GABAA receptors switch from excitation to inhibition, in a process
which depends on the regulated expression of the KCC2
K+/Cl- co-transporter
(Rivera et al., 1999
). Given
that GABA triggers the expression of KCC2
(Ganguly et al., 2001
) and the
enhancement of the GABAergic system observed in BDNF-overexpressing embryos,
we examined whether BDNF had a function in the regulation of KCC2 expression.
RT-PCR analysis showed very low KCC2 mRNA expression in the forebrain of E18
control embryos. In contrast, high expression (4.3-fold greater) was detected
in the forebrains of BDNF-overexpressing embryos
(Fig. 8A). To determine whether
KCC2 mRNA was expressed in the hippocampus, we performed in situ
hybridization. Whereas control hippocampi were almost devoid of KCC2 mRNA,
strong hybridization signals were detected in BDNF transgenic hippocampi in
both the pyramidal and granule cell layers
(Fig. 8B,C). We conclude that
BDNF dramatically increases KCC2 expression.
|
We explored whether the precocious expression of KCC2 altered the response of GABAA receptor activation, by analysing by [Ca2+]i imaging the response of hippocampal neurons to the GABAA receptor agonist muscimol (Fig. 8D,E). No significant differences in the number of neurons responding to the agonist by [Ca2+]i increases were noted (Fig. 8F). However, the amplitude of muscimol-evoked responses was 43% lower in BDNF-overexpressing hippocampi than in wild-type littermates (P<0.0001) (Fig. 8D-F), indicating that the fast excitatory action of GABA through GABAA receptors is attenuated in these mutants. Taken together, these findings indicate that the expression of the KCC2 co-transporter in BDNF transgenic embryos reduces GABAA-evoked [Ca2+]i increases by decreasing [Cl-]i.
| DISCUSSION |
|---|
|
|
|---|
Here we used a gain-of-function mouse model to investigate possible
functions of BDNF at early stages. Whereas expression of BDNF at E18 in
wild-type forebrains is very low, nestin-BDNF transgenic embryos show
a marked increase in BDNF expression, reaching levels similar to those
detected at postnatal stages in control mice
(Ringstedt et al., 1998
).
Because endogenous TrkB receptors are expressed at normal levels in
nestin-BDNF transgenic embryos (C. F. Ibañez, personal
communication), we analyzed the effect of early physiological activation of
endogenous TrkB receptors on the patterns of neuronal activity. We show that
BDNF overexpression dramatically increases the number of neurons exhibiting
spontaneous [Ca2+]i transients in vivo, and that BDNF
may also increases correlated spontaneous network activity. Because most
hippocampal neurons are generated at E13-E16
(Soriano et al., 1989
), we
examined 2- to 5-day-old postmitotic neurons (E18) and show that they respond
to BDNF by acquiring activity profiles which are typical of P1-P2 postnatal
neurons. We conclude that BDNF may be a potent regulator of spontaneous
neuronal network activity at embryonic stages, and that young postmitotic
neurons are very sensitive to BDNF dosage.
Both the developmental profile and the plasticity of early spontaneous
network activity in the CNS suggest that homeostatic factors modulate the
properties of this activity (Feller,
1999
; O'Donovan,
1999
). However, the identity of such factors remains unknown. The
present results, indicating that neuronal network activity is controlled by
BDNF, along with the findings that BDNF and TrkB are themselves regulated by
neural activity and neurotransmitter-dependent [Ca2+]i
changes (Ernfors et al., 1991
;
Berninger et al., 1995
;
Kohara et al., 2001
), support
a homeostatic role for BDNF in the regulation of early spontaneous activity
and in their organization into correlated functional networks.
Axon terminals in BDNF transgenic embryos have higher numbers of synaptic
vesicles docked at the active zones, and a lower density of synaptic vesicles,
in agreement with reports proposing a role for BDNF in the modulation of the
docking vesicle step (Pozo-Miller et al., 1999). This suggests that
neurotransmitter release may be enhanced in BDNF transgenic embryos
(Südhof, 2000
). The role
of BDNF in CNS synaptogenesis has previously been investigated at postnatal
ages or at the equivalent stages in vitro
(Martinez et al., 1998
;
Vicario-Abejón et al.,
1998
; Pozo-Miller et al., 1999), which raises the possibility that
the effects observed may be a consequence of either altered formation or
rearrangement of synaptic contacts. Our data showing increased numbers of
synaptic contacts at the onset of hippocampal synaptogenesis strongly suggest
that early synapse formation in vivo is indeed regulated by BDNF.
We show that overexpression of BDNF regulates the development of the
GABAergic system, as evidenced by somata hypertrophy, enhanced
GAD65/67 expression and increased synaptogenesis, suggesting that
BDNF may act on cortical GABAergic synaptogenesis in vivo at earlier stages
than previously reported (Marty et al.,
1997
; Vicario-Abejón et
al., 1998
; Huang et al.,
1999
). Because GABA is the principal excitatory transmitter in the
neonatal brain (Ben-Ari, 2001
),
the increased maturation of the GABAergic system is likely to underlie the
increased levels of synchronous network activity in BDNF-overexpressing
hippocampi. Since GABAergic neurons develop before pyramidal neurons and play
a role in the maturation of glutamatergic transmission
(Soriano et al., 1989
;
Ben-Ari et al., 1997
;
Ben-Ari, 2001
), GABAergic
neurons may be the earliest target of BDNF, controlling the development of the
entire hippocampal network.
Conversion of GABAergic transmission from depolarizing to hyperpolarizing
depends on the expression of KCC2 and the Cl- electrochemical
potential (Ben-Ari et al.,
1997
; Rivera et al.,
1999
; Hüber et al.,
2001
). We found that BDNF overexpression increases the expression
of KCC2 and reduces the amplitude of Ca2+ transients evoked by
activation of GABAA receptors. A steady increase in KCC2
expression, concomitant with decreased amplitude of GABAA-evoked
Ca2+ responses, occurs from embryonic to postnatal stages
(Garaschuck et al., 1998; Rivera et al.,
1999
; Ganguly et al.,
2001
; Hüber et al.,
2001
; Gulyás et al.,
2001
; Owens et al.,
1996
). As the KCC2 expression levels and GABAA
responses in E18 BDNF transgenic neurons are similar to those found in early
postnatal hippocampi (Garaschuk et al.,
1998
; Rivera et al.,
1999
; Gulyas et al.,
2001
), we suggest that BDNF controls the developmental switch of
GABAergic transmission.
KCC2 expression is associated with reduced GABAA-evoked
[Ca2+]i responses (Garaschuck et al., 1998;
Rivera et al., 1999
;
Ganguly et al., 2001
;
Hüber et al., 2001
;
Gulyás et al., 2001
;
Owens et al., 1996
). However,
both the GABAA blockade by BMI in transgenic slices and the
muscimol-induced [Ca2+]i increases in virtually all
transgenic hippocampal neurons indicate that GABA is still excitatory, despite
the expression of KCC2. The situation is similar to that at early postnatal
stages in the hippocampus (P1-P4), when KCC2 expression levels are not high
enough to convert GABAA responses into inhibitory actions
(Rivera et al., 1999
), and
robust spontaneous activity is still essentially driven by GABAA
depolarizing responses (Ben-Ari,
2001
; Garaschuk et al.,
1998
). Consistent with this, the present physiological and
pharmacological analyses show that the contribution of GABAA-evoked
excitation in acute slices (Fig.
5H-L) and of muscimol-induced Ca2+ responses
(Fig. 8D-F) are decreased in
BDNF-transgenic embryos.
In summary, the present study indicates that BDNF regulates the emergence
and complexity of spontaneous co-active networks in vivo, which demonstrates a
new level of regulation of neuronal circuits by neurotrophins. We also show
that the mechanisms controlling spontaneous activity include the convergent
actions of increased synaptogenesis and GABAergic development, as well as the
accelerated conversion of GABAergic responses through the regulation of KCC2
expression. Because [Ca2+]i oscillations regulate
numerous developmental processes, which are in turn amplified among vast
numbers of neurons by synchronous patterns of activity
(Komuro and Rakic, 1998
;
Spitzer et al., 2000
;
Feller, 1999
;
Buonanno and Fields, 1999
), the
control of network activity by BDNF is likely to regulate patterned gene
expression and synaptic circuits. Since spontaneous network activity reflects
the pattern of intrinsic circuits (Yuste
et al., 1995
; Feller,
1999
; Ben-Ari,
2001
; Mao et al.,
2001
), BDNF may control the properties and complexity of the basic
circuits operating in neuronal processing. The data also suggest that the
effects of BDNF on activity-dependent plasticity
(Bonhoeffer, 1996
;
McAllister et al., 1999
;
Schuman, 1999
;
Schinder and Poo, 2000
) could
be mediated in part by the regulation of the complexity of intrinsic circuits
and networking properties.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Aguiló, A., Schwartz, T. H., Kumar, V. S., Peterlin, Z.
A., Tsiola, A., Soriano, E. and Yuste, R. (1999). Involvement
of Cajal-Retzius neurons in spontaneous correlated activity of embryonic and
postnatal layer 1 from wild-type and reeler mice. J.
Neurosci. 19,10856
-10868.
Alsina, B., Vu, T. and Cohen-Cory, S. (2001). Visualizing synapse formation in arborizing optic axons in vivo: dynamics and modulation by BDNF. Nat. Neurosci. 4,1093 -1101.[CrossRef][Medline]
Barallobre, M. J., del Rio, J. A., Alcántara, S., Borrell, V., Aguado, F., Ruiz, M., Carmona, M. A., Martin, M., Fabre, M. Yuste, R. et al. (2000). Aberrant development of hippocampal circuits and altered neuronal activity in netrin 1-deficient mice. Development 127,4797 -4810.[Abstract]
Ben-Ari, Y., Cherubini, E., Corradetti, B. and Gaiarsa, J. L. (1997). GABAA, NMDA and AMPA receptors: a developmentally regulated `ménage à trois'. Trends Neurosci. 20,523 -529.[CrossRef][Medline]
Ben-Ari, Y. (2001). Developing networks play a similar melody. Trends Neurosci. 24,353 -360.[CrossRef][Medline]
Berninger, B., Marty, S., Zafra, F., Berzaghi, M. P., Thoenen, H. and Lindholm, D. (1995). GABAergic stimulation switches from enhancing to repressing BDNF expression in rat hippocampal neurons during maturation in vitro. Development 121,2327 -2335.[Abstract]
Blue, M. E. and Parnavelas, J. G. (1983). The formation and maturation of synapses in the visual cortex of the rat. I. Qualitative analysis. J. Neurocytol. 12,599 -616.[CrossRef][Medline]
Bonhoeffer, T. (1996). Neurotrophins and activity-dependent development of the neocortex. Curr. Opin. Neurobiol. 6,119 -126.[CrossRef][Medline]
Buonanno, A. and Fields, R. D. (1999). Gene regulation by patterned electrical activity during neural and skeletal muscle development. Curr. Opin. Neurobiol. 9, 110-120.[CrossRef][Medline]
Cherubini, E., Gaiarsa, J. L. and Ben-Ari, Y. (1991). GABA: an excitatory transmitter in early postnatal life. Trends Neurosci. 14,515 -519.[CrossRef][Medline]
Crespo, C., Blasco-Ibáñez, J. M., Briñón, J. G., Alonso, J. R., Domínguez, M. I. and Martínez-Guijarro, F. J. (2000). Subcellular localization of m2 muscarinic receptors in GABAergic interneurons of the olfactory bulb. Eur. J. Neurosci. 12,3963 -3974.[CrossRef][Medline]
Diabira, D., Hennou, S., Chevassus-au-Louis, N., Ben-Ari, Y. and Gozlan, H. (1999). Late embryonic expression of AMPA receptor function in the CA1 region of the intact hippocampus in vitro. Eur. J. Neurosci. 11,4015 -4023.[CrossRef][Medline]
Erlander, M. G., Tillakaratne, N. J., Feldblum, S., Patel, N. and Tobin, A. J. (1991). Two genes encode distinct glutamate decarboxylases. Neuron 7, 91-100.[CrossRef][Medline]
Ernfors, P., Begzon, J., Kokaia, Z., Persson, H. and Lindvall, O. (1991). Increased levels of messenger RNAs for neurotrophic factors in the brain during kindling epileptogenesis. Neuron 7,165 -176.[CrossRef][Medline]
Feller, M. B. (1999). Spontaneous correlated activity in developing neural circuits. Neuron 22,653 -656.[CrossRef][Medline]
Fiala, J. C., Feinberg, M., Popov, V. and Harris, M.
(1998). Synaptogenesis via dendritic filopodia in developing
hippocampal area CA1. J. Neurosci.
18,8900
-8911.
Fritschy, J. M., Paysan, J., Enna, A. and Mohler, H. (1994). Switch in the expression of rat GABAA-receptor subtypes during postnatal development: an immunohistochemical study. J. Neurosci. 14,5302 -5324.[Abstract]
Ganguly, K., Schinder, A. F., Wong, S. T. and Poo, M. M. (2001). GABA itself promotes the developmental switch of neuronal GABAergic responses from excitation to inhibition. Cell 105,521 -532.[CrossRef][Medline]
Garaschuk, O., Hanse, E. and Konnerth, A.
(1998). Developmental profile and synaptic origin of early
network oscillations in the CA1 region of rat neonatal hippocampus.
J. Physiol. 507,219
-236.
Gulyás, A. I., Sík, A., Payne, J. A., Kaila, K. and Freund, T. F. (2001). The KCl cotransporter, KCC2, is highly expressed in the vicinity of excitatory synapses in rat hippocampus. Eur. J. Neurosci. 13,2205 -2217.[CrossRef][Medline]
Huang, Z. J., Kirkwood, A., Pizzorusso, T., Porciatti, V., Morales, B., Bear, M. F., Maffei, L. and Tonegawa, S. (1999). BDNF regulates the maturation of inhibition and the critical period of plasticity in mouse visual cortex. Cell 98,739 -755.[CrossRef][Medline]
Huang, E. L. and Reichardt, L. F. (2001). Neurotrophins: roles in neuronal development and function. Annu. Rev. Neurosci. 24,677 -736.[CrossRef][Medline]
Hüber, C. A., Stein, V., Hermans-Borgmeyer, I., Meyer, T., Ballanyi, K. and Jentsch, T. (2001). Disruption of KCC2 reveals an essential role of KCl cotransport already in early synaptic inhibition. Neuron 30,515 -524.[CrossRef][Medline]
Katz, L. C. and Shatz, C. J. (1996). Synaptic
activity and the construction of cortical circuits.
Science 274,1133
-1138.
Knüsel, B., Rabin, S. J., Hefti, F. and Kaplan, D. R. (1994). Regulated neurotrophin receptor responsiveness during neuronal migration and early differentiation. J. Neurosci. 14,1542 -1554.[Abstract]
Kohara, K., Kitamura, A., Morishima, M. and Tsumoto, T.
(2001). Activity-dependent transfer of brain-derived neurotrophic
factor to postsynaptic neurons. Science
291,2419
-2423.
Komuro, H. and Rakic, O. (1998). Orchestration of neuronal migration by activity of ion channels, neurotransmitter receptors, and intracellular Ca2+ fluctuations. J. Neurobiol. 37,110 -130.[CrossRef][Medline]
Mao, B.-Q., Hamzei-Sichani, F., Aronov, D., Froemke, R. C. and Yuste, R. (2001). Dynamics of spontaneous activity in neocortical slices. Neuron 32,883 -898.[CrossRef][Medline]
Martínez, A., Alcántara, S., Borrell, V., del
Río, J. A., Blasi, J., Otal, R., Campos, N., Boronat, A., Barbacid, M.,
Silos-Santiago, I. et al. (1998). TrkB and TrkC signaling are
required for maturation and synaptogenesis of hippocampal connections.
J. Neurosci. 18,7336
-7350.
Marty, S., Berzaghi, M. P. and Berninger, B. (1997). Neurotrophins and activity-dependent plasticity of cortical interneurons. Trends Neurosci. 20,198 -202.[CrossRef][Medline]
McAllister, A. K., Katz, L. C. and Lo, D. C. (1999). Neurotrophins and synaptic plasticity. Annu. Rev. Neurosci. 22,295 -318.[CrossRef][Medline]
O'Donovan, M. J. (1999). The origin of spontaneous activity in developing networks of the vertebrate nervous system. Curr. Opin. Neurobiol. 9, 94-104.[CrossRef][Medline]
Owens, D. F., Boyce, L. H., Davis, M. B. E. and Kriegstein, A.
R. (1996). Excitatory GABA responses in embryonic and
neonatal cortical slices demonstrated by gramicidin perforated-patch
recordings and calcium imaging. J. Neurosci.
16,6414
-6423.
Penn, A. A., Riquelme, P. A., Feller, M. B. and Shatz, C. J.
(1998). Competition in retinogeniculate pattering driven by
spontaneous activity. Science
279,2108
-2112.
Pozzo-Miller, L. D., Gottschalk, W., Zhang, L., McDermott, K.,
Du, J., Gopalakrishnan, R., Oho, C., Sheng, Z. H., Lu, B.
(1999). Impairments in high-frequency transmission, synaptic
vesicle docking, and synaptic protein distribution in the hippocampus of BDNF
knockout mice. J. Neurosci.
19,4972
-4983.
Ringstedt, T., Linnarsson, S., Wagner, J., Lendahl, U., Kokaia, Z., Arenas, E., Ernfors, P. and Ibañez, C. F. (1998). BDNF regulates reelin expression and Cajal-Retzius cell development in the cerebral cortex. Neuron 21,305 -315.[CrossRef][Medline]
Rivera, C., Voipio, J., Payne, J. A., Ruusuvuori, E., Lahtinen, H., Lamsa, K., Pirvola, U., Saarma, M. and Kaila, K. (1999). The K+/Cl- cotransporter KCC2 renders GABA hyperpolarizing during neuronal maturation. Nature 397,251 -255.[CrossRef][Medline]
Rosahl, T. W., Spillane, D., Missler, M., Herz, J., Selig, D. K., Wolff, J. R., Hammer, R. E., Malenka, R. C. and Südhof, T. C. (1995). Essential function of synapsins I and II in synaptic vesicle regulation. Nature 375,488 -493.[CrossRef][Medline]
Schinder, A. F. and Poo, M. M. (2000). The neurotrophin hypothesis for synaptic plasticity. Trends Neurosci. 23,639 -645.[CrossRef][Medline]
Schuman, E. M. (1999). Neurotrophin regulation of synaptic transmission. Curr. Opin. Neurobiol. 9, 105-109.[CrossRef][Medline]
Schwartz, T., Rabinowtz, D., Unni, V., Kumar, V. S., Smetters, D. K., Tsiola, A. and Yuste, R. (1998). Networks of coactive neurons in developing layer 1. Neuron 20,541 -552.[CrossRef][Medline]
Soriano, E., Cobas, A. and Fairen, A. (1989). Neurogenesis of glutamic acid decarboxylase immunoreactive cells in the hippocampus of the mouse. I: Regio superior and regio inferior. J. Comp. Neurol. 281,586 -602.[CrossRef][Medline]
Soriano, E., del Río, J. A., Martínez, A. and Super, H. (1994). Organization of the embryonic and early postnatal murine hippocampus. I. Immunocytochemical characterization of neuronal populations in the subplate and marginal zone. J. Comp. Neurol. 342,571 -595.[CrossRef][Medline]
Spitzer, N. C., Lautermilch, N. J., Smith, R. D. and Gomez, T. M. (2000). Coding of neuronal differentiation by calcium transients. BioEssays 22,811 -817.[CrossRef][Medline]
Stellwagen, D. and Shatz, C. J. (2002). An instructive role for retinal waves in the development of retinogeniculate connectivity. Neuron 33,357 -367.[CrossRef][Medline]
Südhof, T. C. (2000). The synaptic vesicle cycle revisited. Neuron 28,317 -320.[CrossRef][Medline]
Supèr, H. and Soriano, E. (1994). The organization of the embryonic and early postnatal murine hippocampus. II. Development of entorhinal, commissural, and septal connections studied with the lipophilic tracer DiI. J. Comp. Neurol. 344,101 -120.[CrossRef][Medline]
Supèr, H., Martinez, A., del Rio, J. A. and Soriano, E. (1998). Involvement of distinct pioneer neurons in the formation of layer-specific connections in the hippocampus. J. Neurosci. 15,4616 -4626.
Vaughn, J. E. (1989). Review: Fine structure of synaptogenesis in the vertebrate central nervous system. Synapse 3,255 -285.[CrossRef][Medline]
Vicario-Abejón, C., Collin, C., McKay, R. D. and Segal,
M. (1998). Neurotrophins induce formation of functional
excitatory and inhibitory synapses between cultured hippocampal neurons.
J. Neurosci. 18,7256
-7271.
Watanabe, M., Fukaya, M., Sakimura, K., Manabe, T., Mishina, M. and Inoue, Y. (1998). Selective scarcity of NMDA receptor channel subunits in the stratum lucidum (mossy fibre-recipient layer) of the mouse hippocampal CA3 subfield. Eur. J. Neurosci. 10,478 -487.[CrossRef][Medline]
Yuste, R., Peinado, A. and Katz, L. C. (1992).
Neuronal domains in developing neocortex. Science
257,665
-669.
Yuste, R., Nelson, D. A., Rubin, W. W. and Katz, L. C. (1995). Neuronal domains in developing neocortex: mechanisms of coactivation. Neuron 14,7 -17.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
K. Sakata, N. H. Woo, K. Martinowich, J. S. Greene, R. J. Schloesser, L. Shen, and B. Lu Critical role of promoter IV-driven BDNF transcription in GABAergic transmission and synaptic plasticity in the prefrontal cortex PNAS, April 7, 2009; 106(14): 5942 - 5947. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sivakumaran, M. H. Mohajerani, and E. Cherubini At Immature Mossy-Fiber-CA3 Synapses, Correlated Presynaptic and Postsynaptic Activity Persistently Enhances GABA Release and Network Excitability via BDNF and cAMP-Dependent PKA J. Neurosci., February 25, 2009; 29(8): 2637 - 2647. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Xu, D. A. Hennessy, T. K. M. Lee, and N. I. Syed Trophic Factor-Induced Intracellular Calcium Oscillations Are Required for the Expression of Postsynaptic Acetylcholine Receptors during Synapse Formation between Lymnaea Neurons J. Neurosci., February 18, 2009; 29(7): 2167 - 2176. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Aguado, C. Diaz-Ruiz, R. Parlato, A. Martinez, M. A. Carmona, S. Bleckmann, J. M. Urena, F. Burgaya, J. A. del Rio, G. Schutz, et al. The CREB/CREM Transcription Factors Negatively Regulate Early Synaptogenesis and Spontaneous Network Activity J. Neurosci., January 14, 2009; 29(2): 328 - 333. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shulga, J. Thomas-Crusells, T. Sigl, A. Blaesse, P. Mestres, M. Meyer, Q. Yan, K. Kaila, M. Saarma, C. Rivera, et al. Posttraumatic GABAA-Mediated [Ca2+]i Increase Is Essential for the Induction of Brain-Derived Neurotrophic Factor-Dependent Survival of Mature Central Neurons J. Neurosci., July 2, 2008; 28(27): 6996 - 7005. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bayatti, J. A. Moss, L. Sun, P. Ambrose, J. F. H. Ward, S. Lindsay, and G. J. Clowry A Molecular Neuroanatomical Study of the Developing Human Neocortex from 8 to 17 Postconceptional Weeks Revealing the Early Differentiation of the Subplate and Subventricular Zone Cereb Cortex, July 1, 2008; 18(7): 1536 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Meitzen, I. T. Moore, K. Lent, E. A. Brenowitz, and D. J. Perkel Steroid Hormones Act Transsynaptically within the Forebrain to Regulate Neuronal Phenotype and Song Stereotypy J. Neurosci., October 31, 2007; 27(44): 12045 - 12057. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Hu, Y. Chen, and S. Schacher Multifunctional Role of Protein Kinase C in Regulating the Formation and Maturation of Specific Synapses J. Neurosci., October 24, 2007; 27(43): 11712 - 11724. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Uvarov, A. Ludwig, M. Markkanen, C. Rivera, and M. S. Airaksinen Upregulation of the Neuron-Specific K+/Cl- Cotransporter Expression by Transcription Factor Early Growth Response 4 J. Neurosci., December 27, 2006; 26(52): 13463 - 13473. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Gomes, C. Hampton, F. El-Sabeawy, S. L. Sabo, and A. K. McAllister The Dynamic Distribution of TrkB Receptors before, during, and after Synapse Formation between Cortical Neurons. J. Neurosci., November 1, 2006; 26(44): 11487 - 11500. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Singh, C. Henneberger, D. Betances, M. A. Arevalo, A. Rodriguez-Tebar, J. C. Meier, and R. Grantyn Altered balance of glutamatergic/GABAergic synaptic input and associated changes in dendrite morphology after BDNF expression in BDNF-deficient hippocampal neurons. J. Neurosci., July 5, 2006; 26(27): 7189 - 7200. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Alcantara, E. Pozas, C. F. Ibanez, and E. Soriano BDNF-modulated Spatial Organization of Cajal-Retzius and GABAergic Neurons in the Marginal Zone Plays a Role in the Development of Cortical Organization Cereb Cortex, April 1, 2006; 16(4): 487 - 499. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. H. Woo and B. Lu Regulation of Cortical Interneurons by Neurotrophins: From Development to Cognitive Disorders Neuroscientist, February 1, 2006; 12(1): 43 - 56. [Abstract] [PDF] |
||||
![]() |
M. A. Carmona, E. Pozas, A. Martinez, J. F. Espinosa-Parrilla, E. Soriano, and F. Aguado Age-dependent Spontaneous Hyperexcitability and Impairment of GABAergic Function in the Hippocampus of Mice Lacking trkB Cereb Cortex, January 1, 2006; 16(1): 47 - 63. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Hu, A. M. Nikolakopoulou, and S. Cohen-Cory BDNF stabilizes synapses and maintains the structural complexity of optic axons in vivo Development, October 1, 2005; 132(19): 4285 - 4298. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wise-Faberowski, H. Zhang, R. Ing, R. D. Pearlstein, and D. S. Warner Isoflurane-Induced Neuronal Degeneration: An Evaluation in Organotypic Hippocampal Slice Cultures Anesth. Analg., September 1, 2005; 101(3): 651 - 657. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Moody and M. M. Bosma Ion Channel Development, Spontaneous Activity, and Activity-Dependent Development in Nerve and Muscle Cells Physiol Rev, July 1, 2005; 85(3): 883 - 941. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Gubellini, Y. Ben-Ari, and J.-L. Gaiarsa Endogenous Neurotrophins Are Required for the Induction of GABAergic Long-Term Potentiation in the Neonatal Rat Hippocampus J. Neurosci., June 15, 2005; 25(24): 5796 - 5802. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Luikart, S. Nef, T. Virmani, M. E. Lush, Y. Liu, E. T. Kavalali, and L. F. Parada TrkB Has a Cell-Autonomous Role in the Establishment of Hippocampal Schaffer Collateral Synapses J. Neurosci., April 13, 2005; 25(15): 3774 - 3786. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Gonzalez-Forero, A. M. Pastor, E. J. Geiman, B. Benitez-Temino, and F. J. Alvarez Regulation of Gephyrin Cluster Size and Inhibitory Synaptic Currents on Renshaw Cells by Motor Axon Excitatory Inputs J. Neurosci., January 12, 2005; 25(2): 417 - 429. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rivera, J. Voipio, and K. Kaila Two developmental switches in GABAergic signalling: the K+-Cl- cotransporter KCC2 and carbonic anhydrase CAVII J. Physiol., January 1, 2005; 562(1): 27 - 36. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-R. Shen, A.-C. Lin, Y.-M. Hsu, T.-J. Chang, M.-J. Tang, S. L. Alper, J. C. Ellory, and C.-Y. Chou Insulin-like Growth Factor 1 Stimulates KCl Cotransport, Which Is Necessary for Invasion and Proliferation of Cervical Cancer and Ovarian Cancer Cells J. Biol. Chem., September 17, 2004; 279(38): 40017 - 40025. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rivera, J. Voipio, J. Thomas-Crusells, H. Li, Z. Emri, S. Sipila, J. A. Payne, L. Minichiello, M. Saarma, and K. Kaila Mechanism of Activity-Dependent Downregulation of the Neuron-Specific K-Cl Cotransporter KCC2 J. Neurosci., May 12, 2004; 24(19): 4683 - 4691. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Elmariah, M. A. Crumling, T. D. Parsons, and R. J. Balice-Gordon Postsynaptic TrkB-Mediated Signaling Modulates Excitatory and Inhibitory Neurotransmitter Receptor Clustering at Hippocampal Synapses J. Neurosci., March 10, 2004; 24(10): 2380 - 2393. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Vale, J. Schoorlemmer, and D. H. Sanes Deafness Disrupts Chloride Transporter Function and Inhibitory Synaptic Transmission J. Neurosci., August 20, 2003; 23(20): 7516 - 7524. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Jin, H. Hu, P. H. Mathers, and A. Agmon Brain-Derived Neurotrophic Factor Mediates Activity-Dependent Dendritic Growth in Nonpyramidal Neocortical Interneurons in Developing Organotypic Cultures J. Neurosci., July 2, 2003; 23(13): 5662 - 5673. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||