|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00349
1 Department of Cytokine Biology, The Forsyth Institute, Boston, MA 02115,
USA
2 Harvard-Forsyth Department of Oral Biology, Harvard School of Dental Medicine,
Boston, MA 02115, USA
3 Cardiovascular Research Center, Massachusetts General Hospital, Department of
Medicine, Harvard Medical School, Charlestown, MA 02129, USA
* Author for correspondence (e-mail: ypli{at}forsyth.org)
Accepted 19 December 2002
| SUMMARY |
|---|
|
|
|---|
Key words: CNBP, Retroviral insertional mutagenesis, Forebrain patterning, AVE, ADE, ANE, Cell proliferation defects, Myc expression
| INTRODUCTION |
|---|
|
|
|---|
The Cnbp gene encodes a 19 kDa protein containing seven tandem
zinc-finger repeats of 14 amino acids
(Covey, 1986
). The amino acid
sequence of CNBP is highly conserved; the sequence of human CNBP is 94.1%
identical to that of Xenopus laevis
(Flink et al., 1998
), 99%
identical to that of the chick (van Heumen
et al., 1997
) and 100% identical to the mouse protein. Despite its
discovery over a decade ago, little is known about CNBP function. CNBP was
initially postulated to function as a negative-transcription regulator in the
coordinate control of cholesterol metabolism
(Rajavashisth et al., 1989
)
but this has not been confirmed
(Ayala-Torres et al., 1994
;
Warden et al., 1994
). CNBP was
subsequently shown to be a single strand-specific DNA-binding protein that
interacts with the sequence CCCTCCCCA (termed the CT element), a segment of
DNA that enhances Myc promoter activity
(Michelotti et al., 1995
).
Recently, Konicek et al. reported that CNBP upregulates CSF1 promoter activity
in a tissue-specific manner through specific DNA-binding protein interactions
(Konicek et al., 1998
).
Expression studies during embryogenesis, determined that Xenopus CNBP
(XCNBP) was located in the ectoderm, endoderm and mesoderm during
early development, and in a wide variety of cell types during late
Xenopus embryogenesis (Flink et
al., 1998
). De Dominicis et al. further reported that, in
Xenopus embryos, CNBP mRNA accumulation during development
decreases before the mid-blastula stage and increases again thereafter
(De Dominicis et al., 2000
).
Although the in vivo role and expression pattern of CNBP in mammalian
development remains unclear, the extraordinary level of conservation and the
expression pattern in Xenopus embryos suggest a potentially important
role for CNBP during early embryonic development across different species.
The biological events that control anterior and posterior patterning in
vertebrate embryos is one of the most intriguing questions to challenge
biologists. Recent evidence from studies in the mouse suggests that anterior
patterning precedes gastrulation
(Beddington and Robertson,
1999
). In mouse embryos, an increasing number of genes have been
identified that are expressed in the anterior visceral endoderm (AVE) before,
or coincident with, the start of gastrulation
(Lu et al., 2001
). Mutations
in a number of transcription factor genes, such as Otx2, Lim1, Hex
and Hesx1, that are first expressed in the AVE and, subsequently, in
the node and node derivatives, affect anterior development and exhibit
anterior truncation. The AVE region is located at the distal tip of the
conceptus prior to primitive streak formation, and, subsequently, undergoes a
morphogenetic movement toward the proximal/anterior region. These movements
have been proposed to be extremely important for the anteroposterior
patterning of the embryo (Beddington and
Robertson, 1999
). For example, in Otx2-/-
embryos at egg cylinder stages, the posterior rotation of epiblast seems to
occur normally but the AVE remains distal
(Acampora et al., 1998
), and
the resulting embryos lack midbrain and forebrain. The AVE cells have been
suggested to detach from the epithelial sheet and move toward the anterior
region (Kimura et al., 2000
).
It is currently not understood what mechanisms drive either of these
processes.
The mouse node structure is homologous to the Spemann's organizer in
Xenopus. It gives rise to a similar repertoire of embryonic tissues:
prechordal mesoderm, notochord and gut endoderm
(Beddington, 1981
;
Beddington, 1994
;
Lawson et al., 1991
). However,
it is unable to induce secondary anterior structures even when node precursor
cells are transplanted from an early gastrula stage
(Tam and Steiner, 1999
). AVE
appears to repress posterior signals in the epiblast. However, it is unable to
pattern the neuroectoderm or cause formation of anterior embryonic structures
(Lu et al., 2001
;
Moon and Kimelman, 1998
;
Piotrowska and Zernicka-Goetz,
2001
). The anterior definitive endoderm (ADE) arises from the
anterior streak region before node formation and notochord extension, and
moves anteriorly to displace the AVE and underlie the prospective
neuroectoderm during gastrulation (Lawson
and Pedersen, 1987
; Tam and
Beddington, 1992
; Lu et al.,
2001
). The ADE expresses many of the same genes as the AVE, such
as Hex and Cer1, making it an attractive candidate tissue
from the anterior streak for patterning the anterior epiblast
(Martinez Barbera et al.,
2000
; Lu et al.,
2001
). Although, the AVE, ADE and node tissues are essential for
head development, the precise function and interaction of these three tissues
remain unresolved. We report a new mouse mutant, generated by retroviral
insertion into the locus of the Cnbp gene, that displays impaired
anterior movement of AVE, lack of both ADE and anterior neuroectoderm (ANE)
tissues, and forebrain truncation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Molecular cloning
Initially, a genomic DNA fragment flanking the 5' end of the mp 10
provirus was cloned by inverse PCR. This fragment, designated 5' fA8
(see Fig. 1), was subcloned
into the Bluescript vector (Stratagene). To obtain
-phage clones
representing the A8 locus from wild-type mice, a 129/Sv mouse genomic library
in lambda FIXII (Stratagene) was screened with a radiolabeled probe derived
from 5' fA8. Positive plaques were purified by three rounds of screening
and sub-fragments from the
clones were subcloned according to
standard procedures. The physical map of the A8 locus shown in
Fig. 1 was obtained by both
sequence analyses of the plasmid clones and Southern blot analyses of
restriction enzyme digested wild-type and mutant genomic DNA.
|
Genotype analysis
For genotyping, DNA was isolated from the yolk sac of dissected embryos or
from the terminal tail region of adult animals and analyzed by PCR or by
Southern blot using 5' fA8 as a probe
(Fig. 1). Embryos were obtained
from timed matings; the day of plug detection was counted as day 0.5 of
gestation. The presence of a single 8 kb fragment indicates a homozygote
genotype (Fig. 1). Oligonucleotide primers P1 (ATAGGACCCGTAGGTTGTCA), P2 (CTCTGAGTGATT-GACTACCC)
and P3 (AGTCTCTCCAGAATTGGGTC) were used to give diagnostic amplification
products of 500 bp for the wild-type Cnbp allele and 300 bp for the
disrupted Cnbp allele (Fig.
1). Data from this study were from C57/B6J inbred mice.
RNA preparation and analysis
Total cellular RNA was isolated from adult tissues and mouse embryos by the
guanidinium isothiocyanate procedure. Extracted RNA was fractionated (15 µg
per lane) by electrophoresis in 1% agarose gels containing formaldehyde and
then transferred onto nylon membranes (Li
et al., 1999
). Blots were hybridized for 18-20 hours at 65°C
in a standard hybridization solution without formamide
(Li et al., 1999
).
Histology
Embryos and tissues were fixed in 4% paraformaldehyde. Tissues were
embedded in paraffin wax and sectioned at 7 µm. Sections were stained with
Hematoxylin and Eosin according to standard procedures.
Immunostaining
Tissue section immunostaining was performed as described
(Li et al., 1999
) using
anti-CNBP polyclonal anti-peptide antibodies raised against a 20 amino acid
peptide from the C terminus of mouse CNBP (CYRCGESGHLARECTIEATA).
In situ hybridization
Whole-mount in situ hybridization was performed as described
(Deng et al., 2001
). The
full-length mouse Cnbp cDNA was subcloned and linearized with
NotI and transcribed with T3-RNA polymerase. The Krox20 cDNA was
linearized with BamHI and transcribed with T3-RNA polymerase.
En1 and Hnf3b cDNA were linearized and transcribed with
T7-RNA polymerase. Other antisense probes used were for: Myc, Mox1
(Meox1 Mouse Genome Informatics), Otx2, Brachyury (T),
Hex, Lim1, Six3, Dkk1, Gsc, Hesx1 and Cer1. At least five
embryos with the same genetic background were analyzed for each probe.
Transgenic rescue of forebrain defect in Cnbp mutants
Cnbp transgenic mice were used to rescue the forebrain truncation
in Cnbp mutants. The transgenic vector construct that was used
contained 10 kb of the CNBP promoter and 11 kb of the entire Cnbp
gene. The vector DNA was linearized and used for pronuclear microinjection to
obtain Cnbp transgenic mice. Transgenic (TG) mice were crossed to
Cnbp+/- mutants and the resultant progeny
(TG/Cnbp+/-) were backcrossed to
Cnbp+/- mice. Litters were examined at E9.5.
BrdU and TUNEL assays
BrdU incorporation and TUNEL assays were performed as described
(Shen-Li et al., 2000
). At
least five embryos with the same genetic background were analyzed for each
stage.
Transfection study
Transfection study was performed as described previously
(He et al., 1998
). Wild-type
and Cnbp-/- mutant embryonic fibroblasts (MEF) were
isolated from E13.5 embryos in C57B1/6J and 129Sv hybrid background using
0.05% trypsin/EDTA digestion and then maintained in MEM/10% FBS. Wild-type and
Cnbp-/- mutant embryonic fibroblasts (MEF) were
transfected with a Myc promoter-luciferase reporter plasmid or
co-transfected with the luciferase reporter DNA and a mouse Cnbp
expression plasmid (pCMV-CNBP) as described
(He et al., 1998
). The
pCMV-CNBP was constructed by inserting the Cnbp cDNA under the
transcriptional control of a CMV promoter in the pCDNA3.1 vector (Invitrogen).
Cnbp cDNA was obtained by screening a day 17.5 mouse embryo cDNA
library (Clontech). DNA co-transfections were performed in duplicate and
repeated at least four times.
| RESULTS |
|---|
|
|
|---|
|
In order to identify the gene that is responsible for the mutation,
additional genomic sequences flanking 5' fA8 were isolated by screening
a
-phage library of mouse genomic DNA with the 5' fA8 probe. The
clones were dissected into subfragments and used as probes to
hybridize to northern blots containing poly(A)+ RNA that was
extracted from newborn mice. A 3.0 kb subfragment, designated PA832 (as shown
in Fig. 1), hybridized to a
1.65 kb RNA transcript. Sequencing the PA832 fragment indicated that the
proviral insertion created a mutation in the previously described
Cnbp gene (Rajavashisth et al.,
1989
). In order to map the proviral integration site relative to
the transcriptional unit of the Cnbp gene, the exon-intron junctions
of the gene were identified by comparing Cnbp gene sequences with
Cnbp cDNA sequences. The results summarized schematically in
Fig. 1 indicate that the
provirus was inserted into the first intron. To test whether the proviral
insertion affected levels of Cnbp transcription, total RNA was
isolated from E9.5 embryos (derived from Cnbp heterozygous mutant
parents) and analyzed on northern blots. Compared with their wild-type
littermates, the 1.65 kb Cnbp transcripts were significantly reduced
in heterozygous embryos and could not be detected in homozygous embryos
(Fig. 1O). In order to examine
CNBP protein levels, immunostaining of tissue sections was performed using an
anti-CNBP polyclonal anti-peptide. We found that, Cnbp was normally
expressed in the ANE and ADE of E7.25 embryos
(Fig. 1P) but was absent in
E7.25 Cnbp-/- mutant embryos
(Fig. 1Q). These results
indicate that the Cnbp mutation was a null mutation.
Morphological analysis showed that Cnbp-/- mutant
embryos were distinguishable from normal embryos. At E7.5, the
abnormal-looking embryos were smaller than their normal littermates
(Fig. 1F,G). A constriction was
seen between the embryonic and extra-embryonic regions
(Fig. 1G). A similar
extra-embryonic/embryonic constriction was also observed in Hnf3b
mutants (Ang and Rossant, 1994
)
and Otx2 mutants (Ang et al.,
1996
) and to a lesser extent in Lim1 mutants
(Shawlot and Behringer, 1995
).
Truncations were also seen in the anterior neural folds at early somite stages
(Fig. 1H,I) and in the anterior
regions of E9.5 Cnbp-/- embryos
(Fig. 1J,K). However, the trunk
and tail of the mutant embryos were relatively well formed.
Cnbp expression pattern in early embryonic development
To clarify the role of CNBP in mouse head development, we analyzed the
expression of Cnbp at pre-gastrulation and gastrulation stages using
whole-mount RNA in situ hybridization and tissue section immunostaining. We
found that the expression of Cnbp during pregastrulation and
gastrulation stages was very dynamic. Cnbp was expressed in visceral
endoderm located at the distal tip of the E6.0 embryo in pre-primitive streak
stage (Fig. 2A). At E7.0, the
early-primitive streak stage, Cnbp was expressed in the AVE
(Fig. 2B). At E7.25, the
late-primitive streak stage, CNBP protein was localized to the ADE, underlying
the future forebrain, and in the overlying ANE, where the forebrain will form
(Fig. 1P). At early neural
plate stages (E7.5), Cnbp was expressed in the anterior axial
mesendoderm, ADE and ANE (Fig.
2C,D). At 8-10 somites (E8.25-8.5), Cnbp expression
became progressively restricted to the headfold region
(Fig. 2E-G). By E9.25,
Cnbp was predominately expressed in the forebrain
(Fig. 2H). The expression of
Cnbp was also detected in midbrain by E9.5
(Fig. 2L). In addition to the
head region, Cnbp expression was also detected in limb bud and tail
at low level when organogenesis occurs
(Fig. 2L). The expression
pattern of Cnbp during early mouse development suggests that CNBP
plays a role in patterning the anterior central nervous system (CNS), which is
consistent with its role in forebrain formation.
|
Cnbp transgene rescue of forebrain defects in Cnbp mutants
To confirm that the forebrain truncation was indeed caused by a disruption
of the Cnbp gene instead of by some unknown genetic or epigentic
mutations, we generated Cnbp transgenic (TG) mice to test whether the
Cnbp transgene could rescue the forebrain defect in
Cnbp-/- mutants. The transgene contained a 10 kb
Cnbp promoter and the entire 11 kb Cnbp gene
(Fig. 2I). The TG mice were
crossed with Cnbp+/- mutants and the resultant progeny
(TG/Cnbp+/-) were then crossed with
Cnbp+/- mice. Litters were examined at E9.5. As previously
described, Cnbp-/- embryos showed forebrain truncations;
however, transgene-positive Cnbp-/-
(TG/Cnbp-/-) embryos were normal
(Fig. 2M,N). In situ
hybridization revealed an almost identical Cnbp-expression pattern
between wild-type and TG/Cnbp-/- embryos
(Fig. 2L,N). The forebrain
truncation was rescued in TG/Cnbp-/- embryos, which
confirms that knockout of the Cnbp gene was responsible for the
forebrain truncation phenotype.
Forebrain truncation in early Cnbp mutant embryos
We examined neuroectoderm formation and anteroposterior patterning in
Cnbp-/- embryos between 10-25 somite stages by the
expression analysis of a number of CNS and mesoderm marker genes. Bf1
mRNA, a marker for telencephalon forebrain, was entirely absent in E8.5 and
E9.5 Cnbp-/- embryos when compared with wild-type
littermates (Fig. 3A,B,K,L).
Loss of Bf1 expression in mutant embryos at E8.5 suggests loss of the
telencephalon. We examined the expression of other forebrain markers, such as
Hesx1 and Six3, which mark the diencephelon, to determine
whether this tissue is also missing in the mutants. Hesx1 and
Six3 were not detected in the mutants, indicating that diencephelon
is also missing in the mutant embryos (Fig.
3C-F). To determine the anterior truncation level, engrailed1
(En1), a marker for posterior midbrain and anterior hindbrain was
employed. En1 was expressed in the anterior region of both E9.0
normal and Cnbp mutant embryos
(Fig. 3G,H), indicating that
anterior hindbrain was not affected by the mutation. However, we could not
determine whether midbrain is affected in the mutants from the analysis of
En1 expression. Another hindbrain marker, Krox20
(Egr2 Mouse Genome Informatics), was detected in rhombomeres
3 and 5 of Cnbp-/- embryos at E9.0
(Fig. 3I,J). Thus, the anterior
hindbrain regions are present in homozygous mutants. We then used the mesoderm
specific markers, Mox1 and Brachyury (T) to
determine whether trunk and tail development was affected. Both genes were
expressed normally in homozygous mutants. Mox1 expression was
detected in paraxial mesoderm cells of E9.5 mutant embryos. Mox1
expression was similar in the trunk regions of homozygous mutants as in their
wild-type littermates (Fig.
3M,N). T expression was detected in the notochord and
posterior (tail) mesoderm cells of both mutant E9.5 embryos, and in their
wild-type littermates (Fig.
3O,P), indicating that notochord development is not affected in
Cnbp-/- homozygous embryos
(Fig. 3P). Collectively, our
expression analysis indicates that the Cnbp mutation results in
forebrain truncation but does not affect posterior patterning beyond the
midbrain, as development of hindbrain, trunk and tail of
Cnbp-/- embryos was essentially normal.
|
Defects of the AVE, ADE and ANE
In order to investigate the onset of the forebrain phenotypes, we analyzed
the expression of a number of markers at early developmental stages when
morphological abnormalities are not yet visible. We analyzed the expression of
AVE markers Hex and Lim1 at pre- and early-streak stages. At
E6.0, AVE formation was initiated normally at the distal end of
Cnbp-/- embryos (Fig.
4A,B). The defects were first detected at mid-primitive streak
stages (E6.5), when Hex expression did not complete a morphogenetic
movement toward the proximal anterior region in Cnbp-/-
mutants when compared with wild-type littermates
(Fig. 4C,D). The expression of
Lim1 in the anterior of mutants was also detected more distally when
compared with that in wild-type embryos
(Fig. 4E,F). Interestingly, the
posterior expression of Lim1 appeared to be more proximal, and closer
to the extra-embryonic/embryonic junction in the mutant embryo compared with
its expression pattern in wild-type embryos
(Fig. 4E,F). The ectopic
expression may be caused by the Cnbp mutation. In a similar case,
ectopic expression of Hesx1 was found throughout the ectodermal layer
of the distal region of the egg cylinder at E6.75 Cripto mutants
(Ding et al., 1998
). Others
have reported that Otx2-null mutant embryos also failed to execute
movement of the AVE from the distal end to proximal region of the embryo and
that they lack anterior structures
(Perea-Gomez et al., 2001
). We
conclude from these data, that CNBP is important for the correct localization
of the AVE.
|
To understand further the developmental origins of the
Cnbp-/- phenotype, we investigated ADE induction
(Lu et al., 2001
). The ADE
expresses many of the same genes as the AVE, such as Hex and
Cer1 (Martinez Barbera et al.,
2000
). The expression of Hex in
Cnbp-/- mutant embryos failed to occur at the late streak
stage E7.5 (n=6) (Fig.
4K,L), indicating the ADE must be absent in
Cnbp-/- mutant embryos. Cer1 is also normally
expressed in the ADE at the late streak stage but was also absent in
Cnbp-/- mutant embryos (n=5)
(Fig. 4M,N), which further
confirms the lack of the ADE in Cnbp-/- mutant embryos.
Currently, we do not know why Hex and Cer1 were not
expressed in the mutants. The difference in expression of Hex and
Cer1 in mutants compared with wild-type embryos could be caused by a
delay of development. In order to take into account the problem of
developmental delay in the mutants, we then analyzed expression of these genes
at E7.25 to determine whether the AVE is correctly positioned in the mutant
embryos at this stage. Our results showed that at E7.25 stage, Hex
and Cer1 were expressed in the AVE and ADE of E7.25 wild-type embryos
(Fig. 4G,I). By contrast,
Hex mRNA was expressed at the distal tip in the E7.25 mutant embryos
and this leads, in Cnbp-/- E7.25 embryos, to the ectopic
confinement of Hex-expressing cells to the region where the node is
normally located (Fig. 4H). The
expression of Cer1 was also detected more distally when compared with
that in wild-type embryos (Fig.
4J). Interestingly, the expression of Hex and
Cer1 in the ADE is not detected in the mutants at this stage
(Fig. 4H,J). Mislocalization of
the AVE and absence of the ADE indicate a defect in anterior displacement of
the AVE instead of a developmental delay. The critical AVE movement could
perhaps be a prerequisite for ADE formation. Its absence in
Cnbp-/- embryos supports this hypothesis.
To determine whether the induction of the ANE was affected in Cnbp-/- embryos, we examined the expression of an ANE marker, Otx2, at E7.5. In all Cnbp-/- mutants examined Otx2 expression was undetectable (n=8) (Fig. 4O,P), which indicates that the cells destined for an anterior neural fate failed to form in the mutant embryos. Our data indicate that CNBP is required for ADE formation and anterior neural fate induction.
Defects of anterior mesendoderm (AME)
Recent transplantation experiments have demonstrated that a mixed graft of
cells from the AVE, the anterior epiblast and the anterior streak can induce
anterior neural genes (Tam and Steiner,
1999
). In addition, removal of the ADE, together with prechordal
plate and axial node derivatives, at the late gastrula stage results in
truncation of the anterior neuroectoderm
(Camus et al., 2000
),
indicating that a reciprocal interaction between these tissues is required for
anterior patterning. To examine whether the Cnbp mutation affects the
formation of anterior mesendoderm (AME), prechordal mesoderm, node and axial
node derivatives, we analyzed the expression of a number of anterior
mesendoderm markers, including Lim1, T, Hnf3b, Gsc and Dkk1,
at primitive streak and early somite stages. Lim1, T and
Hnf3b were all expressed in the node of wild-type embryos at E7.5
(Fig. 5A,C,E)
(Ang et al., 1993
;
Monaghan et al., 1993
).
Hnf3b and Lim1 were also expressed in midline cells anterior
to the notochord, known as anterior mesendoderm or prechordal mesoderm cells
(Fig. 5A,C). In homozygous
mutants, all three genes were expressed in the node and in the anterior
region, but only a short distance from the node
(Fig. 5B,D,F). This is in sharp
contrast to wild-type embryos in which labeled head-process cells had migrated
much farther anteriorly (Fig.
5B,D,F). In particular, the anterior-most midline expression of
Lim1 and Hnf3b in AME cells is missing in the mutants
(Fig. 5B,D), indicating that
the AME fails to develop. Later, during early somite stages, the absence of
Hnf3b signal indicates defects in anterior axial mesoderm cells and
the rostral portion of the neural tube
(Fig. 5G,H). The rostral
expression of Hnf3b in the mutant embryo appears to be limited to the
prospective hindbrain (Fig.
5H). This suggests that the midbrain development may also be
affected in the mutant embryos. However, the potential defect in midbrain
should be only a partial truncation based on the above morphological analysis
(Fig. 1). The reduced
Lim1 and Hnf3b expression in the anterior embryo suggests a
defect in the AME. To analyze this structure further, we used prechordal plate
markers Gsc and Dkk1 to assess prechordal plate development.
Gsc and Dkk1 were not expressed in E7.75 and E8.0 mutant
embryos, indicating a defect in prechordal plate development
(Fig. 5I-L). Although loss of
Cnbp expression leads to defects in forebrain and midbrain
development, the more posterior CNS is normal.
|
Reduced cell proliferation in anterior regions may account for
defects in formation of the AVE, ADE, AME and ANE
We next investigated the cellular and molecular basis of the forebrain
truncation defect in Cnbp-/- embryos. The forebrain
truncation may potentially result from defects in anterior neural cell
differentiation, excess cell death, decreased cell proliferation or a
combination of these processes in the developing forebrain region.
Morphological and histological analysis indicated that the AME and ANE tissues
of E7.5 Cnbp-/- embryos were missing
(Fig. 6A,B). Sagittal sections
of E8.5 Cnbp-/- embryos revealed defects in headfold
formation and prechordal mesoderm formation
(Fig. 6C,D). The rest of the
body axis appeared normal. To compare the proliferative and apoptotic profiles
in Cnbp-/- and wild-type littermates, BrdU incorporation
and TUNEL assays were performed on sections of E7.5 and E8.5 embryos.
Wild-type E7.5 and E8.5 embryos exhibit many BrdU-positive nuclei throughout
the embryonic structures (Fig.
6E,G). By contrast, the mutants have fewer BrdU-positive nuclei in
the ANE region (Fig. 6F,H).
However, there is no significant difference in the number of BrdU-positive
nuclei between the trunk region of wild-type and mutant embryos. The ratio of
proliferating cells (BrdU-positive nuclei) to total cell number in the
anterior of E7.5 embryos was calculated to be 84% for three wild-type embryos
compared with 28% for three Cnbp-/- mutant embryos
(Fig. 6E,F,Q). As cells have
been estimated to have a 10-12 hour division cycle during this period, a
10-20% decline in the proportion of S-phase cells during early
post-implantation could result in a 25% decline in embryo size over a period
of 1 day. The lack of cell proliferation may result in the observed reduction
in size of the headfolds at E8.5 (Fig.
6H). TUNEL assays showed minimal apoptosis in normal and mutant
E7.5 and 8.5 embryos (Fig.
6I-L), which suggests that programmed cell death does not
contribute significantly, if at all, to the null phenotype. These findings
indicated that the Cnbp mutation leads to a dramatic reduction in
cell proliferation in the AME and ANE tissues, and headfold. To address
further whether the impaired anterior movement of the AVE observed in
Cnbp mutant embryos is related to defects in cell proliferation in
AVE, we performed BrdU incorporation assays on E6.0 wild-type and mutant
littermates. BrdU-positive nuclei were rarely seen in the prospective anterior
region of the AVE in E6.0 mutant embryos
(Fig. 6P). By contrast, the
greatest density of BrdU-positive nuclei was observed in the anterior region
of the AVE in normal E6.0 embryos (Fig.
6O). Our results suggest that reduced cell proliferation in
anterior regions of Cnbp mutant embryos might account for defects in
formation of the AVE, ADE, AME and ANE.
|
CNBP may control forebrain induction though Myc
CNBP was shown to regulate the CT element of the human MYC
protooncogene through its binding to the element found in the MYC
promoter (Michelotti et al.,
1995
). In addition to regulating cell proliferation and apoptosis,
Myc can also promote differentiation of stem cells into transit-amplifying
cells specific for the sebaceous and interfollicular epidermal lineages
(Arnold and Watt, 2001
;
Gandarillas and Watt, 1997
),
and the Myc-/- mutant has defects in development of
anterior structures (Davis et al.,
1993
; Gandarillas and Watt,
1997
). These reports lead us to hypothesize that Myc is a
downstream target gene of Cnbp during forebrain development, which
may promote cell proliferation and differentiation in forebrain induction. We
therefore examined the possible involvement of Myc in forebrain
neuroectoderm induction and specification. We observed that Myc is
expressed in anterior neuroectoderm at E7.25, and that the expression pattern
of Myc in E8.5 and E9.5 mouse embryos was similar to that of
Cnbp during forebrain development
(Fig. 2C,E,H;
Fig. 7A,C,E). Notably,
expression of Myc in the anterior neuroectoderm and the headfold
region of E7.25 and E8.5 Cnbp-/- mutant embryos was
absent, whereas the expression of Myc in the allantois was normal
(Fig. 7B,D). However, the loss
of the anterior tissues by E8.5 and E9.5 could equally be the mechanism that
results in reduced Myc expression. The regions where Myc
expression was downregulated also showed reduced BrdU labeling, indicating
that CNBP might regulate anterior cell proliferation through Myc.
|
To test whether CNBP regulates Myc expression at the transcription
level, we transfected wild-type and Cnbp-/- mutant
embryonic fibroblasts (MEF) with a Myc promoter-luciferase reporter
plasmid (He et al., 1998
). A
lower level of luciferase activity was observed in Cnbp-/-
MEF than in wild-type cells (Fig.
7G). Co-transfection of Cnbp-/- MEF with the
luciferase reporter DNA and a mouse Cnbp-expression plasmid
(CMV-CNBP) elevated Myc expression to a level higher than that seen
in Cnbp+/+ cells (Fig.
7G). Therefore, we conclude that Cnbp expression enhances
Myc-promoter activity. Although the mechanism by which Cnbp
expression enhances Myc promoter activity during anterior patterning
remains to be elucidated, it is plausible that CNBP is one of the necessary
transcription factors that bind to the Myc promoter to regulate its
transcription.
| DISCUSSION |
|---|
|
|
|---|
A role for CNBP in head development
Our study has shown that ablation of Cnbp function in the mouse
results in severe truncation of the forebrain. This finding provides direct
genetic evidence that Cnbp, a zinc-finger protein, plays an essential
and novel role in mouse forebrain development. De Robertis and colleagues have
recently shown that mouse embryos carrying null mutations in the genes
encoding BMP antagonists Noggin and Chordin fail to maintain a functional AVE
and display forebrain defects (Bachiller et
al., 2000
). In addition, Mukhopadhyay and colleagues have recently
shown that mouse embryos carrying null mutations in the genes encoding Dkk1
display forebrain defects (Mukhopadhyay et
al., 2001
). Molecular marker analysis showed that expression of
Bf1, Hesx1 and Six3 is completely absent; however,
expression of En1 is detected in Dkk1-mutant embryos. The
identical expression pattern of the marker genes in both Dkk1- and
Cnbp-mutant embryos indicates that both Dkk1- and
Cnbp-mutant embryos show a similar forebrain phenotype. Although
Cnbp is predominately expressed in the forebrain, Cnbp
expression is also detected in midbrain region of E9.5 embryos. Moreover, E7.5
Cnbp-mutant embryos show a complete lack of Otx2 expression,
and the rostral level of Hnf3b expression in the mutant embryos
appears to be limited to the hindbrain region, indicating a defect in midbrain
tissues in the Cnbp mutants.
Cnbp expression in the early embryo is first noted in cells corresponding to a region of the early gastrulating embryo (at E6.0) where the AVE abuts the epiblast. However, no morphological defect can be detected in the Cnbp-/- embryos prior to the early-streak stages. The defects were first detected at mid-primitive-streak stages (E6.5), when Hex expression did not complete a morphogenetic movement toward the proximal anterior region in Cnbp-/- mutants when compared with wild-type littermates. The more distal Hex expression could be caused by a delay in development of the mutants. However, our results could not rule out the possibility of a delay in the development of mutants, based on the fact that: (1) Hex expression in E6.0 mutants is normal, which indicates the delay did not happen at this stage of development; (2) at E7.25, expression of Hex and Cer1 was incorrectly positioned at the distal end in mutant embryos, which indicates defects in corresponding tissues, whereas we would expect that the AVE would persist and fully elongate, and that the ADE would be induced if there was a delay in development; and (3) forebrain truncation in the E9.5 and newborn mutants is consistent with defects in the anterior tissue, whereas the trunk develops normally.
It is notable that Otx2 expression is absent in Cnbp
mutants at E7.5. As Otx2-null mutant embryos both failed to execute
the movement of the AVE from the distal end to proximal region of the embryo
(Perea-Gomez et al., 2001
) and
lack anterior structures (Ang et al.,
1996
), we suspect Otx2 may act downstream of CNBP. However, in
Otx2 mutants the brain truncation was extended to anterior hindbrain
as the expression of En1 marker gene was not detected in
Otx2-mutant embryos (Ang et al.,
1996
). Thus, the head defect phenotype in Otx2-mutant
embryos is more severe than that in Cnbp-mutant embryos. The
difference between the two mutations might be explained by residual Otx2
protein or reduced Otx2 expression in Cnbp mutants that was
not detected by our in situ methods. An alternative possibility is that CNBP
might only regulate Otx2 expression in certain tissues and at
specific stages. To address this question, mutant embryos at early stages will
be analyzed in further studies. Nevertheless, the absence of Otx2
expression in the prospective ANE cells of late-streak mutant embryos at E7.5
suggests that CNBP function is required for specification of the ANE during
forebrain development. Forebrain patterning in the mouse is initiated by the
inductive activity of the AVE and, subsequently, requires the function of the
node-derived ADE (Ang et al.,
1994
; Shawlot et al.,
1999
; Tam and Steiner,
1999
; Thomas and Beddington,
1996
). The severe anterior phenotype of
Cnbp-/- embryos suggests that CNBP is a key factor in the
head developmental process. However, it is not clear from this analysis
whether CNBP is required in the AVE and/or the ADE for forebrain development.
The generation of chimeric embryos composed of extra-embryonic and embryonic
tissues of different genotypes would resolve this issue in future studies.
CNBP appears to regulate cell proliferation and tissue specification
through Myc during forebrain induction
An abnormal constriction at the extra-embryonic/embryonic boundary is
observed in Cnbp-/- mutants. The constriction was also
reported in Otx2, Hnf3b and Lim1 mutants. However, the cause
of the constriction remains unknown. Our cell proliferation data identify a
substantial reduction in the cell proliferation of the AME and ANE, which is
also associated with the loss of Myc expression in a tissue-specific
manner where the constriction is observed. As no difference in apoptosis was
evident between Cnbp-/- and wild-type embryos, we conclude
that the constriction arises as a result of reduced proliferation of the AVE
and ANE during expansion of the ANE. The fact that CNBP upregulates CT
elements in the Myc promoter and regulates cell proliferation
highlights potential links between CNBP and Myc. In
Cnbp-/- embryos, CNBP appears to regulate proliferation
through Myc. Myc is an important regulator of cell proliferation; however,
others have recently shown that Myc is also involved in differentiation
(Arnold and Watt, 2001
;
Gandarillas and Watt, 1997
).
Myc may be involved in ANE tissue specification. In homozygous Cnbp
mutants, the lack of Myc may hinder neuralization in the anterior epiblast
and, thus, further exacerbate the forebrain defect. Our data suggest a
forebrain induction mechanism by which CNBP induces the expression of
Myc, which in turn stimulates cell proliferation and differentiation
of the anterior epiblast and neuroectoderm cells during forebrain induction
and specification. Although we propose that CNBP regulates forebrain formation
through the Myc pathway, we could not rule out involvement of other CNBP
target genes that have not yet been characterized. Interestingly, some
Myc-null mutant embryos die at E10.5 with anterior neural fold
truncation (Davis et al.,
1993
) whereas other Myc mutant embryos do not show
obvious forebrain defects. One possible explanation is that CNBP targets a
group of genes, including Myc, to regulate forebrain development.
Another explanation is that an unknown factor may compensate for Myc
loss in C57B1/6J and 129Sv hybrid or inbred 129Sv background
(Davis et al., 1993
). The role
of Myc in forebrain formation remains to be investigated further.
The origins of forebrain phenotype of CNBP mutants are defects in the
AVE and ADE tissues but not in the node and notochord
We find that AVE, ADE and ANE defects in Cnbp-/- mice
result in forebrain truncation initiated from early gastrulation stages. Other
genes, such as Lim1, Otx2, Nodal, Smad2, Foxh1, Arkadia, Hex, Oto, Dkk1,
Hesx1, Nog and Chrd, are also essential for murine head
development (Episkopou et al.,
2001
; Hoodless et al.,
2001
; Shawlot et al.,
1999
; Yamamoto et al.,
2001
). However, the brain defects are considerably different among
these mutants. Embryos homozygous for mutations in Lim1, Otx2, Foxh1
or Arkadia exhibit truncations of the forebrain, midbrain and rostral
hindbrain. By comparison, forebrain truncation in Hex-/-,
Oto-/- and Hesx1-/- embryos is
relatively mild (Zoltewicz et al.,
1999
; Martinez Barbera et al.,
2000
). The defects observed in Cnbp-/- embryos
are clearly different from other mutants as Cnbp-/-
mutants showed complete forebrain truncation. The developmental origins of the
defects are also considerably different among these mutants. The developmental
defects in Otx2 mutants originate from an inability of the AVE to
complete its anteriorward movement and a failure to form the node, prechordal
mesoderm, notochord and ADE. Foxh1 and Arkadia mutants have
normal AVE but impaired ADE, node and notochord. Hex-/-,
Oto-/- and Hesx1-/- mutants display
absence or early regression of the ADE and normal AVE, node and notochord.
Compared with other mutants that have brain defects, the developmental origin
of the forebrain defects in Cnbp-/- embryos is clearly
unique. Cnbp mutants exhibit impaired AVE and ADE, with normal
development of the node and notochord. The unique forebrain phenotype and
developmental origin of the defects in Cnbp mutants indicate that the
Cnbp mutation may affect a different genetic pathway when compared
with any known mutation resulting in forebrain defects. Therefore,
Cnbp-/- embryos provide a unique and valuable mouse model
for studying forebrain formation.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Acampora, D., Mazan, S., Lallemand, Y., Avantaggiato, V., Maury, M., Simeone, A. and Brulet, P. (1995). Forebrain and midbrain regions are deleted in Otx2-/- mutants due to a defective anterior neuroectoderm specification during gastrulation. Development 121,3279 -3290.[Abstract]
Acampora, D., Avantaggiato, V., Tuorto, F., Briata, P., Corte, G. and Simeone, A. (1998). Visceral endoderm-restricted translation of Otx1 mediates recovery of Otx2 requirements for specification of anterior neural plate and normal gastrulation. Development 125,5091 -5104.[Abstract]
Ang, S. L. and Rossant, J. (1994). HNF-3 beta is essential for node and notochord formation in mouse development. Cell 78,561 -574.[CrossRef][Medline]
Ang, S. L., Wierda, A., Wong, D., Stevens, K. A., Cascio, S., Rossant, J. and Zaret, K. S. (1993). The formation and maintenance of the definitive endoderm lineage in the mouse: involvement of HNF3/forkhead proteins. Development 119,1301 -1315.[Abstract]
Ang, S. L., Conlon, R. A., Jin, O. and Rossant, J. (1994). Positive and negative signals from mesoderm regulate the expression of mouse Otx2 in ectoderm explants. Development 120,2979 -2989.[Abstract]
Ang, S. L., Jin, O., Rhinn, M., Daigle, N., Stevenson, L. and Rossant, J. (1996). A targeted mouse Otx2 mutation leads to severe defects in gastrulation and formation of axial mesoderm and to deletion of rostral brain. Development 122,243 -252.[Abstract]
Arnold, I. and Watt, F. M. (2001). c-Myc activation in transgenic mouse epidermis results in mobilization of stem cells and differentiation of their progeny. Curr. Biol. 11,558 -568.[CrossRef][Medline]
Ayala-Torres, S., Johnson, B. H. and Thompson, E. B. (1994). Oxysterol sensitive and resistant lymphoid cells: correlation with regulation of cellular nucleic acid binding protein mRNA. J. Steroid Biochem. Mol. Biol. 48,307 -315.[CrossRef][Medline]
Bachiller, D., Klingensmith, J., Kemp, C., Belo, J. A., Anderson, R. M., May, S. R., McMahon, J. A., McMahon, A. P., Harland, R. M., Rossant, J. et al. (2000). The organizer factors chordin and noggin are required for mouse forebrain development. Nature 403,658 -661.[CrossRef][Medline]
Barklis, E., Mulligan, R. C. and Jaenisch, R. (1986). Chromosomal position or virus mutation permits retrovirus expression in embryonal carcinoma cells. Cell 47,391 -399.[CrossRef][Medline]
Beddington, R. S. (1994). Induction of a second neural axis by the mouse node. Development 120,613 -620.[Abstract]
Beddington, R. S. and Robertson, E. J. (1999). Axis development and early asymmetry in mammals. Cell 96,195 -209.[CrossRef][Medline]
Beddington, S. P. (1981). An autoradiographic analysis of the potency of embryonic ectoderm in the 8th day postimplantation mouse embryo. J Embryol. Exp Morphol. 64, 87-104.[Medline]
Brennan, J., Lu, C. C., Norris, D. P., Rodriguez, T. A., Beddington, R. S. and Robertson, E. J. (2001). Nodal signalling in the epiblast patterns the early mouse embryo. Nature 411,965 -969.[CrossRef][Medline]
Camus, A., Davidson, B. P., Billiards, S., Khoo, P., Rivera-Perez, J. A., Wakamiya, M., Behringer, R. R. and Tam, P. P. (2000). The morphogenetic role of midline mesendoderm and ectoderm in the development of the forebrain and the midbrain of the mouse embryo. Development 127,1799 -1813.[Abstract]
Cohen, M. M., Jr (1993). Sutural biology and the correlates of craniosynostosis. Am. J. of Med. Genet. 47,581 -616.[CrossRef][Medline]
Covey, S. N. (1986). Amino acid sequence
homology in gag region of reverse transcribing elements and the coat protein
gene of cauliflower mosaic virus. Nucl. Acids Res.
14,623
-633.
Dattani, M. T., Martinez-Barbera, J. P., Thomas, P. Q., Brickman, J. M., Gupta, R., Martensson, I. L., Toresson, H., Fox, M., Wales, J. K., Hindmarsh, P. C. et al. (1998). Mutations in the homeobox gene HESX1/Hesx1 associated with septo-optic dysplasia in human and mouse. Nat. Genet. 19,125 -133.[CrossRef][Medline]
Davis, A. C., Wims, M., Spotts, G. D., Hann, S. R. and Bradley,
A. (1993). A null c-myc mutation causes lethality before 10.5
days of gestation in homozygotes and reduced fertility in heterozygous female
mice. Genes Dev. 7,671
-682.
De Dominicis, A., Lotti, F., Pierandrei-Amaldi, P. and Cardinali, B. (2000). cDNA cloning and developmental expression of cellular nucleic acid-binding protein (CNBP) gene in xenopus laevis. Gene 241,35 -43.[CrossRef][Medline]
Deng, W., Stashenko, P., Chen, W., Liang, Y., Shimizu, K. and Li, Y. P. (2001). Characterization of mouse Atp6i gene, the gene promoter, and the gene expression. J. Bone Miner. Res. 16,1136 -1146.[CrossRef][Medline]
Ding, J., Yang, L., Yan, Y. T., Chen, A., Desai, N., Wynshaw-Boris, A. and Shen, M. M. (1998). Cripto is required for correct orientation of the anterior-posterior axis in the mouse embryo. Nature 395,702 -707.[CrossRef][Medline]
Episkopou, V., Arkell, R., Timmons, P. M., Walsh, J. J., Andrew, R. L. and Swan, D. (2001). Induction of the mammalian node requires Arkadia function in the extraembryonic lineages. Nature 410,825 -830.[CrossRef][Medline]
Flink, I. L., Blitz, I. and Morkin, E. (1998). Characterization of cellular nucleic acid binding protein from Xenopus laevis: expression in all three germ layers during early development. Dev. Dyn. 211,123 -130.[CrossRef][Medline]
Gandarillas, A. and Watt, F. M. (1997). c-Myc
promotes differentiation of human epidermal stem cells. Genes
Dev. 11,2869
-2882.
Harbers, K., Muller, U., Grams, A., Li, E., Jaenisch, R. and
Franz, T. (1996). Provirus integration into a gene encoding a
ubiquitin- conjugating enzyme results in a placental defect and embryonic
lethality. Proc. Natl. Acad. Sci. USA
93,12412
-12417.
He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da
Costa, L. T., Morin, P. J., Vogelstein, B. and Kinzler, K. W.
(1998). Identification of c-MYC as a target of the APC pathway.
Science 281,1509
-1512.
Hoodless, P. A., Pye, M., Chazaud, C., Labbe, E., Attisano, L.,
Rossant, J. and Wrana, J. L. (2001). FoxH1 (Fast) functions
to specify the anterior primitive streak in the mouse. Genes
Dev. 15,1257
-1271.
Jabs, E. W., Muller, U., Li, X., Ma, L., Luo, W., Haworth, I. S., Klisak, I., Sparkes, R., Warman, M. L., Mulliken, J. B. et al. (1993). A mutation in the homeodomain of the human MSX2 gene in a family affected with autosomal dominant craniosynostosis. Cell 75,443 -450.[CrossRef][Medline]
Kimura, C., Yoshinaga, K., Tian, E., Suzuki, M., Aizawa, S. and Matsuo, I. (2000). Visceral endoderm mediates forebrain development by suppressing posteriorizing signals. Dev. Biol. 225,304 -321.[CrossRef][Medline]
Konicek, B. W., Xia, X., Rajavashisth, T. and Harrington, M. A. (1998). Regulation of mouse colony-stimulating factor-1 gene promoter activity by AP1 and cellular nucleic acid-binding protein. DNA Cell Biol. 17,799 -809.[Medline]
Lawson, K. A. and Pedersen, R. A. (1987). Cell fate, morphogenetic movement and population kinetics of embryonic endoderm at the time of germ layer formation in the mouse. Development 101,627 -652.[Abstract]
Lawson, K. A., Meneses, J. J. and Pedersen, R. A. (1991). Clonal analysis of epiblast fate during germ layer formation in the mouse embryo. Development 113,891 -911.[Abstract]
Li, E., Bestor, T. H. and Jaenisch, R. (1992). Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69,915 -926.[CrossRef][Medline]
Li, Y. P., Chen, W., Liang, Y., Li, E. and Stashenko, P. (1999). Atp6i-deficient mice exhibit severe osteopetrosis due to loss of osteoclast-mediated extracellular acidification. Nat. Genet. 23,447 -451.[CrossRef][Medline]
Lu, C. C., Brennan, J. and Robertson, E. J. (2001). From fertilization to gastrulation: axis formation in the mouse embryo. Curr. Opin. Genet. Dev. 11,384 -392.[CrossRef][Medline]
Martinez Barbera, J. P., Clements, M., Thomas, P., Rodriguez, T., Meloy, D., Kioussis, D. and Beddington, R. S. (2000). The homeobox gene Hex is required in definitive endodermal tissues for normal forebrain, liver and thyroid formation. Development 127,2433 -2445.[Abstract]
Matsuo, I., Kuratani, S., Kimura, C., Takeda, N. and Aizawa,
S. (1995). Mouse Otx2 functions in the formation and
patterning of rostral head. Genes Dev.
9,2646
-2658.
Michelotti, E. F., Tomonaga, T., Krutzsch, H. and Levens, D.
(1995). Cellular nucleic acid binding protein regulates the CT
element of the human c-myc protooncogene. J. Biol.
Chem. 270,9494
-9499.
Monaghan, A. P., Kaestner, K. H., Grau, E. and Schutz, G. (1993). Postimplantation expression patterns indicate a role for the mouse forkhead/HNF-3 alpha, beta and gamma genes in determination of the definitive endoderm, chordamesoderm and neuroectoderm. Development 119,567 -578.[Abstract]
Moon, R. T. and Kimelman, D. (1998). From cortical rotation to organizer gene expression: toward a molecular explanation of axis specification in Xenopus. BioEssays 20,536 -545.[CrossRef][Medline]
Mukhopadhyay, M., Shtrom, S., Rodriguez-Esteban, C., Chen, L., Tsukui, T., Gomer, L., Dorward, D. W., Glinka, A., Grinberg, A., Huang, S. P. et al. (2001). Dickkopf1 is required for embryonic head induction and limb morphogenesis in the mouse. Dev. Cell 1,423 -434.[CrossRef][Medline]
Nomura, M. and Li, E. (1998). Smad2 role in mesoderm formation, left-right patterning and craniofacial development. Nature 393,786 -790.[CrossRef][Medline]
Perea-Gomez, A., Lawson, K. A., Rhinn, M., Zakin, L., Brulet, P., Mazan, S. and Ang, S. L. (2001). Otx2 is required for visceral endoderm movement and for the restriction of posterior signals in the epiblast of the mouse embryo. Development 128,753 -765.[Abstract]
Piotrowska, K. and Zernicka-Goetz, M. (2001). Role for sperm in spatial patterning of the early mouse embryo. Nature 409,517 -521.[CrossRef][Medline]
Rajavashisth, T. B., Taylor, A. K., Andalibi, A., Svenson, K. L.
and Lusis, A. J. (1989). Identification of a zinc finger
protein that binds to the sterol regulatory element.
Science 245,640
-643.
Shawlot, W. and Behringer, R. R. (1995). Requirement for Lim1 in head-organizer function. Nature 374,425 -430.[CrossRef][Medline]
Shawlot, W., Wakamiya, M., Kwan, K. M., Kania, A., Jessell, T. M. and Behringer, R. R. (1999). Lim1 is required in both primitive streak-derived tissues and visceral endoderm for head formation in the mouse. Development 126,4925 -4932.[Abstract]
Shen-Li, H., O'Hagan, R. C., Hou, H., Jr, Horner, J. W., Lee, H.
W. and DePinho, R. A. (2000). Essential role for Max in early
embryonic growth and development. Genes Dev.
14, 17-22.
Tam, P. P. and Beddington, R. S. (1992). Establishment and organization of germ layers in the gastrulating mouse embryo. Ciba Found. Symp. 165, 27-41.[Medline]
Tam, P. P. and Steiner, K. A. (1999). Anterior patterning by synergistic activity of the early gastrula organizer and the anterior germ layer tissues of the mouse embryo. Development 126,5171 -5179.[Abstract]
Thomas, P. and Beddington, R. (1996). Anterior primitive endoderm may be responsible for patterning the anterior neural plate in the mouse embryo. Curr. Biol. 6,1487 -1496.[CrossRef][Medline]
van Heumen, W. R., Claxton, C. and Pickles, J. O. (1997). Sequence and tissue distribution of chicken cellular nucleic acid binding protein cDNA. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 118,659 -665.[CrossRef][Medline]
Waldrip, W. R., Bikoff, E. K., Hoodless, P. A., Wrana, J. L. and Robertson, E. J. (1998). Smad2 signaling in extraembryonic tissues determines anterior-posterior polarity of the early mouse embryo. Cell 92,797 -808.[CrossRef][Medline]
Warden, C. H., Krisans, S. K., Purcell-Huynh, D., Leete, L. M., Daluiski, A., Diep, A., Taylor, B. A. and Lusis, A. J. (1994). Mouse cellular nucleic acid binding proteins: a highly conserved family identified by genetic mapping and sequencing. Genomics 24,14 -19.[CrossRef][Medline]
Yamamoto, M., Meno, C., Sakai, Y., Shiratori, H., Mochida, K.,
Ikawa, Y., Saijoh, Y. and Hamada, H. (2001). The
transcription factor FoxH1 (FAST) mediates Nodal signaling during
anterior-posterior patterning and node formation in the mouse.
Genes Dev. 15,1242
-1256.
Zoltewicz, J. S., Plummer, N. W., Lin, M. I. and Peterson, A. S. (1999). Oto is a homeotic locus with a role in anteroposterior development that is partially redundant with Lim1. Development 126,5085 -5095.[Abstract]
This article has been cited by other articles:
![]() |
T. Raabe, S. Clemens-Richter, T. Twardzik, A. Ebert, G. Gramlich, and M. Heisenberg Identification of Mushroom body miniature, a zinc-finger protein implicated in brain development of Drosophila PNAS, September 28, 2004; 101(39): 14276 - 14281. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||