spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

doi: 10.1242/10.1242/dev.00349


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, W.
Right arrow Articles by Li, Y.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, W.
Right arrow Articles by Li, Y.-P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 130, 1367-1379 (2003)
Copyright © 2003 The Company of Biologists Limited

The zinc-finger protein CNBP is required for forebrain formation in the mouse

Wei Chen1,2, Yuqiong Liang1, Wenjie Deng1, Ken Shimizu1, Amir M. Ashique1,2, En Li3 and Yi-Ping Li1,2,*

1 Department of Cytokine Biology, The Forsyth Institute, Boston, MA 02115, USA
2 Harvard-Forsyth Department of Oral Biology, Harvard School of Dental Medicine, Boston, MA 02115, USA
3 Cardiovascular Research Center, Massachusetts General Hospital, Department of Medicine, Harvard Medical School, Charlestown, MA 02129, USA

* Author for correspondence (e-mail: ypli{at}forsyth.org)

Accepted 19 December 2002


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mouse mutants have allowed us to gain significant insight into axis development. However, much remains to be learned about the cellular and molecular basis of early forebrain patterning. We describe a lethal mutation mouse strain generated using promoter-trap mutagenesis. The mutants exhibit severe forebrain truncation in homozygous mouse embryos and various craniofacial defects in heterozygotes. We show that the defects are caused by disruption of the gene encoding cellular nucleic acid binding protein (CNBP); Cnbp transgenic mice were able to rescue fully the mutant phenotype. Cnbp is first expressed in the anterior visceral endoderm (AVE) and, subsequently, in the anterior definitive endoderm (ADE), anterior neuroectoderm (ANE), anterior mesendoderm (AME), headfolds and forebrain. In Cnbp-/- embryos, the visceral endoderm remains in the distal tip of the conceptus and the ADE fails to form, whereas the node and notochord form normally. A substantial reduction in cell proliferation was observed in the anterior regions of Cnbp-/- embryos at gastrulation and neural-fold stages. In these regions, Myc expression was absent, indicating CNBP targets Myc in rostral head formation. Our findings demonstrate that Cnbp is essential for the forebrain induction and specification.

Key words: CNBP, Retroviral insertional mutagenesis, Forebrain patterning, AVE, ADE, ANE, Cell proliferation defects, Myc expression


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Craniofacial abnormalities affect hundreds of thousands of children each year and result in physical, emotional and economic hardships for affected individuals and their families (Cohen, 1993Go). The isolation of genes underlying mouse mutants that resemble the human syndromes promises to identify many important players in normal and abnormal craniofacial development (Jabs et al., 1993Go; Dattani et al., 1998Go). Similarly, gene knockout techniques have proved to be powerful tools for identifying the molecular regulation of many developmental processes. For example, genes such as Lim1 (Lhx1 — Mouse Genome Informatics) (Shawlot and Behringer, 1995Go), Otx2 (Matsuo et al., 1995Go; Acampora et al., 1995Go), Smad2 (Waldrip et al., 1998Go; Nomura and Li, 1998Go), Nodal (Brennan et al., 2001Go), Foxh1 (Hoodless et al., 2001Go; Yamamoto et al., 2001Go), Arkadia (Episkopou et al., 2001Go), Hex (Martinez Barbera et al., 2000Go), Oto (Zoltewicz et al., 1999Go), Hesx1 (Dattani et al., 1998Go) and Dkk1 (Mukhopadhyay et al., 2001Go; Shawlot et al., 1999Go; Yamamoto et al., 2001Go) have been demonstrated to be essential for normal head development by targeted gene disruption in mice. However, studies using such knockout techniques are limited to known genes. Through retroviral insertional mutagenesis and genetic screening approaches, we have identified a null-mutant mouse strain with complete forebrain truncation. Heterozygous mutants survive to birth with various craniofacial abnormalities, including the absence of the lower jaw and eyes. The mutated gene has been determined to be that encoding the cellular nucleic acid binding protein (CNBP); this was confirmed by transgenic rescue.

The Cnbp gene encodes a 19 kDa protein containing seven tandem zinc-finger repeats of 14 amino acids (Covey, 1986Go). The amino acid sequence of CNBP is highly conserved; the sequence of human CNBP is 94.1% identical to that of Xenopus laevis (Flink et al., 1998Go), 99% identical to that of the chick (van Heumen et al., 1997Go) and 100% identical to the mouse protein. Despite its discovery over a decade ago, little is known about CNBP function. CNBP was initially postulated to function as a negative-transcription regulator in the coordinate control of cholesterol metabolism (Rajavashisth et al., 1989Go) but this has not been confirmed (Ayala-Torres et al., 1994Go; Warden et al., 1994Go). CNBP was subsequently shown to be a single strand-specific DNA-binding protein that interacts with the sequence CCCTCCCCA (termed the CT element), a segment of DNA that enhances Myc promoter activity (Michelotti et al., 1995Go). Recently, Konicek et al. reported that CNBP upregulates CSF1 promoter activity in a tissue-specific manner through specific DNA-binding protein interactions (Konicek et al., 1998Go). Expression studies during embryogenesis, determined that Xenopus CNBP (XCNBP) was located in the ectoderm, endoderm and mesoderm during early development, and in a wide variety of cell types during late Xenopus embryogenesis (Flink et al., 1998Go). De Dominicis et al. further reported that, in Xenopus embryos, CNBP mRNA accumulation during development decreases before the mid-blastula stage and increases again thereafter (De Dominicis et al., 2000Go). Although the in vivo role and expression pattern of CNBP in mammalian development remains unclear, the extraordinary level of conservation and the expression pattern in Xenopus embryos suggest a potentially important role for CNBP during early embryonic development across different species.

The biological events that control anterior and posterior patterning in vertebrate embryos is one of the most intriguing questions to challenge biologists. Recent evidence from studies in the mouse suggests that anterior patterning precedes gastrulation (Beddington and Robertson, 1999Go). In mouse embryos, an increasing number of genes have been identified that are expressed in the anterior visceral endoderm (AVE) before, or coincident with, the start of gastrulation (Lu et al., 2001Go). Mutations in a number of transcription factor genes, such as Otx2, Lim1, Hex and Hesx1, that are first expressed in the AVE and, subsequently, in the node and node derivatives, affect anterior development and exhibit anterior truncation. The AVE region is located at the distal tip of the conceptus prior to primitive streak formation, and, subsequently, undergoes a morphogenetic movement toward the proximal/anterior region. These movements have been proposed to be extremely important for the anteroposterior patterning of the embryo (Beddington and Robertson, 1999Go). For example, in Otx2-/- embryos at egg cylinder stages, the posterior rotation of epiblast seems to occur normally but the AVE remains distal (Acampora et al., 1998Go), and the resulting embryos lack midbrain and forebrain. The AVE cells have been suggested to detach from the epithelial sheet and move toward the anterior region (Kimura et al., 2000Go). It is currently not understood what mechanisms drive either of these processes.

The mouse node structure is homologous to the Spemann's organizer in Xenopus. It gives rise to a similar repertoire of embryonic tissues: prechordal mesoderm, notochord and gut endoderm (Beddington, 1981Go; Beddington, 1994Go; Lawson et al., 1991Go). However, it is unable to induce secondary anterior structures even when node precursor cells are transplanted from an early gastrula stage (Tam and Steiner, 1999Go). AVE appears to repress posterior signals in the epiblast. However, it is unable to pattern the neuroectoderm or cause formation of anterior embryonic structures (Lu et al., 2001Go; Moon and Kimelman, 1998Go; Piotrowska and Zernicka-Goetz, 2001Go). The anterior definitive endoderm (ADE) arises from the anterior streak region before node formation and notochord extension, and moves anteriorly to displace the AVE and underlie the prospective neuroectoderm during gastrulation (Lawson and Pedersen, 1987Go; Tam and Beddington, 1992Go; Lu et al., 2001Go). The ADE expresses many of the same genes as the AVE, such as Hex and Cer1, making it an attractive candidate tissue from the anterior streak for patterning the anterior epiblast (Martinez Barbera et al., 2000Go; Lu et al., 2001Go). Although, the AVE, ADE and node tissues are essential for head development, the precise function and interaction of these three tissues remain unresolved. We report a new mouse mutant, generated by retroviral insertion into the locus of the Cnbp gene, that displays impaired anterior movement of AVE, lack of both ADE and anterior neuroectoderm (ANE) tissues, and forebrain truncation.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Generation of the Cnbp mutant mouse strain
The Cnbp mutant mouse strain, also termed A8, was generated as described (Harbers et al., 1996Go). Briefly, J1 embryonic stem (ES) cells (Li et al., 1992Go) were grown on a monolayer of mytomycin C-treated Psi-2 cells producing mp 10 virus (Barklis et al., 1986Go) in ES cell culture medium containing 8 ug/ml polybrene. ES cell lines with a single-copy proviral genome were injected into BALB/c or C57BL/6J blastocysts, and injected embryos were then transferred into the uteri of pseudopregnant F1 (C57BL/6JxCBA) foster mothers as described (Li et al., 1992Go) to obtain transgenic lines. The Cnbp transgenic line was obtained by breeding a male chimera with a female C57BL/6J mouse. The Cnbp mutation was repeatedly backcrossed (>12 generations) onto the C57BL/6J inbred genetic background to improve phenotypic consistency. Cnbp+/- inbred mice were intercrossed to produce Cnbp-/- mice.

Molecular cloning
Initially, a genomic DNA fragment flanking the 5' end of the mp 10 provirus was cloned by inverse PCR. This fragment, designated 5' fA8 (see Fig. 1), was subcloned into the Bluescript vector (Stratagene). To obtain {lambda}-phage clones representing the A8 locus from wild-type mice, a 129/Sv mouse genomic library in lambda FIXII (Stratagene) was screened with a radiolabeled probe derived from 5' fA8. Positive plaques were purified by three rounds of screening and sub-fragments from the {lambda} clones were subcloned according to standard procedures. The physical map of the A8 locus shown in Fig. 1 was obtained by both sequence analyses of the plasmid clones and Southern blot analyses of restriction enzyme digested wild-type and mutant genomic DNA.



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 1. Retroviral insertional mutation of CNBP resulted in anterior patterning and craniofacial defects. (A) Morphology of newborn wild-type mouse. (B) A heterozygote newborn mouse with a short snout and lacking eyes. (C,D) Heterozygotes with a smaller lower jaw (C) and missing eyes (D). (E) A homozygote lacking rostral head structures, including the entire forebrain. (F,G) As early as E7.5, a homozygous mutant embryo is smaller than its wild-type littermate. A constriction is observed between embryonic and extra-embryonic regions in Cnbp-/- mutants (arrow in G). (H,I) By E8.5, forebrain truncation is evident in mutant embryo (arrow in I). (J,K) At E9.5, Cnbp-/- embryos were smaller with forebrain truncations. (L) The integration site of the provirus in the Cnbp gene locus. The flanking sequence, 5' fA8, was cloned by inverse PCR. The Cnbp gene was cloned and characterized by using 5' fA8 as probe. The positions of the 5' fA8 probe and primers 1, 2 and 3 (P1, P2, and P3) for genotyping are shown. (M) Genotype analysis of Cnbp mutant mice by Southern blot. The presence of a single 4 kb fragment represents wild-type allele, while a larger 8 kb fragment, a result of the proviral insertion, represents a mutant allele. (N) Genotype analysis of E6.5 embryos by PCR demonstrates the recovery of wild-type (lanes 1, 5), heterozygous (lanes 3, 4, 6, 8) and homozygous embryos (lanes 2, 7). Primers P1 and P3 amplify a 500 bp wild-type fragment, whereas primers P2 (a Neo insertion-specific primer) and P3 together amplify a 300 bp mutant fragment. (O) Northern blot analysis of total RNA isolated from E9.5 whole embryos derived from Cnbp-heterozygous mutant parents. A 1.65 kb mRNA was detected in the wild-type and heterozygous embryos but was undetectable in the homozygous embryos using Cnbp cDNA as a probe. (P,Q) Immunostaining in tissue sections was performed, using an anti-CNBP polyclonal antibody, to examine CNBP protein levels in E7.25 wild-type and mutant embryos. CNBP protein was localized to the ANE and ADE of a wild-type embryo (brown staining in P) but was absent in the Cnbp-/--mutant embryo (Q).

 

Genotype analysis
For genotyping, DNA was isolated from the yolk sac of dissected embryos or from the terminal tail region of adult animals and analyzed by PCR or by Southern blot using 5' fA8 as a probe (Fig. 1). Embryos were obtained from timed matings; the day of plug detection was counted as day 0.5 of gestation. The presence of a single 8 kb fragment indicates a homozygote genotype (Fig. 1). Oligonucleotide primers P1 (ATAGGACCCGTAGGTTGTCA), P2 (CTCTGAGTGATT-GACTACCC) and P3 (AGTCTCTCCAGAATTGGGTC) were used to give diagnostic amplification products of 500 bp for the wild-type Cnbp allele and 300 bp for the disrupted Cnbp allele (Fig. 1). Data from this study were from C57/B6J inbred mice.

RNA preparation and analysis
Total cellular RNA was isolated from adult tissues and mouse embryos by the guanidinium isothiocyanate procedure. Extracted RNA was fractionated (15 µg per lane) by electrophoresis in 1% agarose gels containing formaldehyde and then transferred onto nylon membranes (Li et al., 1999Go). Blots were hybridized for 18-20 hours at 65°C in a standard hybridization solution without formamide (Li et al., 1999Go).

Histology
Embryos and tissues were fixed in 4% paraformaldehyde. Tissues were embedded in paraffin wax and sectioned at 7 µm. Sections were stained with Hematoxylin and Eosin according to standard procedures.

Immunostaining
Tissue section immunostaining was performed as described (Li et al., 1999Go) using anti-CNBP polyclonal anti-peptide antibodies raised against a 20 amino acid peptide from the C terminus of mouse CNBP (CYRCGESGHLARECTIEATA).

In situ hybridization
Whole-mount in situ hybridization was performed as described (Deng et al., 2001Go). The full-length mouse Cnbp cDNA was subcloned and linearized with NotI and transcribed with T3-RNA polymerase. The Krox20 cDNA was linearized with BamHI and transcribed with T3-RNA polymerase. En1 and Hnf3b cDNA were linearized and transcribed with T7-RNA polymerase. Other antisense probes used were for: Myc, Mox1 (Meox1 — Mouse Genome Informatics), Otx2, Brachyury (T), Hex, Lim1, Six3, Dkk1, Gsc, Hesx1 and Cer1. At least five embryos with the same genetic background were analyzed for each probe.

Transgenic rescue of forebrain defect in Cnbp mutants
Cnbp transgenic mice were used to rescue the forebrain truncation in Cnbp mutants. The transgenic vector construct that was used contained 10 kb of the CNBP promoter and 11 kb of the entire Cnbp gene. The vector DNA was linearized and used for pronuclear microinjection to obtain Cnbp transgenic mice. Transgenic (TG) mice were crossed to Cnbp+/- mutants and the resultant progeny (TG/Cnbp+/-) were backcrossed to Cnbp+/- mice. Litters were examined at E9.5.

BrdU and TUNEL assays
BrdU incorporation and TUNEL assays were performed as described (Shen-Li et al., 2000Go). At least five embryos with the same genetic background were analyzed for each stage.

Transfection study
Transfection study was performed as described previously (He et al., 1998Go). Wild-type and Cnbp-/- mutant embryonic fibroblasts (MEF) were isolated from E13.5 embryos in C57B1/6J and 129Sv hybrid background using 0.05% trypsin/EDTA digestion and then maintained in MEM/10% FBS. Wild-type and Cnbp-/- mutant embryonic fibroblasts (MEF) were transfected with a Myc promoter-luciferase reporter plasmid or co-transfected with the luciferase reporter DNA and a mouse Cnbp expression plasmid (pCMV-CNBP) as described (He et al., 1998Go). The pCMV-CNBP was constructed by inserting the Cnbp cDNA under the transcriptional control of a CMV promoter in the pCDNA3.1 vector (Invitrogen). Cnbp cDNA was obtained by screening a day 17.5 mouse embryo cDNA library (Clontech). DNA co-transfections were performed in duplicate and repeated at least four times.


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Retroviral insertional mutation of Cnbp is embryonically lethal and results in defects in anterior patterning
We have generated a mutant mouse strain (A8) that exhibits severe forebrain truncation and facial anomalies (Fig. 1A-E). The external morphological deficiencies were variable but limited to the forebrain, eyes and lower jaw. The A8 mutant mice were generated using retroviral insertional mutagenesis (Harbers et al., 1996Go). The 500 bp DNA fragment flanking the 5' LTR of the provirus was cloned by inverse PCR and designated 5' fA8 (Fig. 1L). When used as a probe on Southern blots, 5' fA8 hybridizes to a single 4 kb band in genomic DNA from wild-type mice (Fig. 1M), and an additional 8 kb band, resulting from the insertion of the provirus, in DNA from heterozygous animals, which was used for genotyping mice and embryos (Fig. 1M). Mutant embryos were also genotyped by PCR analysis (Fig. 1N). To ensure genetic uniformity for closely linked loci, heterozygous mice were backcrossed to C57BL/6J inbred strain 12 times. To define the role of Cnbp in mouse development, the offspring from intercrossed heterozygous (Cnbp+/-) C57BL/6J inbred mice (n=12) were examined at various developmental stages. We found that A8 homozygous embryos had a severe forebrain truncation and died around E10.5 (Table 1). No A8 homozygous newborns were ever found. About 40% of heterozygous newborn mutants exhibited multiple defects, including growth retardation and craniofacial defects (e.g. a smaller mandible and complete lack of eyes), and died shortly after birth. The haploinsufficiency suggests that the Cnbp gene must be expressed above a threshold level to ensure normal development. The remaining heterozygous mice either grew normally to adulthood or had mild eye and skeleton defects (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 1. Genotype of mice resulting from Cnbp heterozygous intercrosses in C57BL/6J inbred mice

 

In order to identify the gene that is responsible for the mutation, additional genomic sequences flanking 5' fA8 were isolated by screening a {lambda}-phage library of mouse genomic DNA with the 5' fA8 probe. The {lambda} clones were dissected into subfragments and used as probes to hybridize to northern blots containing poly(A)+ RNA that was extracted from newborn mice. A 3.0 kb subfragment, designated PA832 (as shown in Fig. 1), hybridized to a 1.65 kb RNA transcript. Sequencing the PA832 fragment indicated that the proviral insertion created a mutation in the previously described Cnbp gene (Rajavashisth et al., 1989Go). In order to map the proviral integration site relative to the transcriptional unit of the Cnbp gene, the exon-intron junctions of the gene were identified by comparing Cnbp gene sequences with Cnbp cDNA sequences. The results summarized schematically in Fig. 1 indicate that the provirus was inserted into the first intron. To test whether the proviral insertion affected levels of Cnbp transcription, total RNA was isolated from E9.5 embryos (derived from Cnbp heterozygous mutant parents) and analyzed on northern blots. Compared with their wild-type littermates, the 1.65 kb Cnbp transcripts were significantly reduced in heterozygous embryos and could not be detected in homozygous embryos (Fig. 1O). In order to examine CNBP protein levels, immunostaining of tissue sections was performed using an anti-CNBP polyclonal anti-peptide. We found that, Cnbp was normally expressed in the ANE and ADE of E7.25 embryos (Fig. 1P) but was absent in E7.25 Cnbp-/- mutant embryos (Fig. 1Q). These results indicate that the Cnbp mutation was a null mutation.

Morphological analysis showed that Cnbp-/- mutant embryos were distinguishable from normal embryos. At E7.5, the abnormal-looking embryos were smaller than their normal littermates (Fig. 1F,G). A constriction was seen between the embryonic and extra-embryonic regions (Fig. 1G). A similar extra-embryonic/embryonic constriction was also observed in Hnf3b mutants (Ang and Rossant, 1994Go) and Otx2 mutants (Ang et al., 1996Go) and to a lesser extent in Lim1 mutants (Shawlot and Behringer, 1995Go). Truncations were also seen in the anterior neural folds at early somite stages (Fig. 1H,I) and in the anterior regions of E9.5 Cnbp-/- embryos (Fig. 1J,K). However, the trunk and tail of the mutant embryos were relatively well formed.

Cnbp expression pattern in early embryonic development
To clarify the role of CNBP in mouse head development, we analyzed the expression of Cnbp at pre-gastrulation and gastrulation stages using whole-mount RNA in situ hybridization and tissue section immunostaining. We found that the expression of Cnbp during pregastrulation and gastrulation stages was very dynamic. Cnbp was expressed in visceral endoderm located at the distal tip of the E6.0 embryo in pre-primitive streak stage (Fig. 2A). At E7.0, the early-primitive streak stage, Cnbp was expressed in the AVE (Fig. 2B). At E7.25, the late-primitive streak stage, CNBP protein was localized to the ADE, underlying the future forebrain, and in the overlying ANE, where the forebrain will form (Fig. 1P). At early neural plate stages (E7.5), Cnbp was expressed in the anterior axial mesendoderm, ADE and ANE (Fig. 2C,D). At 8-10 somites (E8.25-8.5), Cnbp expression became progressively restricted to the headfold region (Fig. 2E-G). By E9.25, Cnbp was predominately expressed in the forebrain (Fig. 2H). The expression of Cnbp was also detected in midbrain by E9.5 (Fig. 2L). In addition to the head region, Cnbp expression was also detected in limb bud and tail at low level when organogenesis occurs (Fig. 2L). The expression pattern of Cnbp during early mouse development suggests that CNBP plays a role in patterning the anterior central nervous system (CNS), which is consistent with its role in forebrain formation.



View larger version (79K):
[in this window]
[in a new window]
 
Fig. 2. Identification of early Cnbp-expression pattern and Cnbp-transgene rescue of forebrain defects in Cnbp mutants. (A-D) Cnbp expression was analyzed at pre-gastrulation, gastrulation and post-gastrulation stages by whole-mount in situ hybridization. (A) Cnbp is expressed at the visceral endoderm, anterior to the distal tip of the early embryo at early gastrulation (E6.0; arrow). (B) During primitive streak formation, at E7.0, Cnbp expression localizes to the AVE in the anterior midline from the proximal to the distal region. (C) Cnbp is expressed in anterior axial mesendoderm, ADE and ANE at late-primitive streak stage (E7.5). (D) Sagittal section of an embryo at an approximately similar stage to that shown in C, showing Cnbp expression in the anterior axial mesendoderm, ADE and ANE. (E-G) Cnbp is expressed in the anterior neural folds at 8-10 somite stages. (F) Sagittal section of an embryo at an approximately a similar stage to that shown in E, showing Cnbp expression in the ANE (forebrain) and head mesenchyme. (G) Cnbp continues to be expressed in the headfolds. (H) Cnbp is expressed in the forebrain at E9.25. Transcripts were also detected in the early facial prominences, including the first branchial arch, primitive maxillary region and early frontonasal area. Regions of expression other than the head include the limb bud and tail. (I) The Cnbp transgene comprising the 10 kb mouse Cnbp promoter, the entire Cnbp gene (11 kb) and a 300 bp vector DNA fragment (shaded region on left side) as a tag for genotyping. (J) Transgenic genotyping by PCR analysis using primers P1 and P2, described in I. Lane 5 shows control DNA from wild-type mice. The 300 bp fragment in lanes 1-4 represents recovery of transgenic embryos. (K) Transgenic genotyping by Southern blot analysis using the 300 bp vector DNA as probe. Wild-type embryos are represented in lanes 1, 3 and 5. Genomic DNA from transgenic embryos hybridizes to probe (lanes 2, 4 and 6). (L-M) Transgenic rescue of forebrain defects in Cnbp mutants. Cnbp expression in Cnbp+/+ wild-type embryo (L), Cnbp-/- mutant (M) and TG/Cnbp-/- (n=7) (N) embryos at E9.5. Embryo in M shows forebrain truncation, whereas the transgenic rescued embryo has a normal phenotype and a nearly identical expression pattern as the wild-type embryo (L,N). Cnbp begins to also be expressed in the midbrain shortly before E9.5 (L).

 

Cnbp transgene rescue of forebrain defects in Cnbp mutants
To confirm that the forebrain truncation was indeed caused by a disruption of the Cnbp gene instead of by some unknown genetic or epigentic mutations, we generated Cnbp transgenic (TG) mice to test whether the Cnbp transgene could rescue the forebrain defect in Cnbp-/- mutants. The transgene contained a 10 kb Cnbp promoter and the entire 11 kb Cnbp gene (Fig. 2I). The TG mice were crossed with Cnbp+/- mutants and the resultant progeny (TG/Cnbp+/-) were then crossed with Cnbp+/- mice. Litters were examined at E9.5. As previously described, Cnbp-/- embryos showed forebrain truncations; however, transgene-positive Cnbp-/- (TG/Cnbp-/-) embryos were normal (Fig. 2M,N). In situ hybridization revealed an almost identical Cnbp-expression pattern between wild-type and TG/Cnbp-/- embryos (Fig. 2L,N). The forebrain truncation was rescued in TG/Cnbp-/- embryos, which confirms that knockout of the Cnbp gene was responsible for the forebrain truncation phenotype.

Forebrain truncation in early Cnbp mutant embryos
We examined neuroectoderm formation and anteroposterior patterning in Cnbp-/- embryos between 10-25 somite stages by the expression analysis of a number of CNS and mesoderm marker genes. Bf1 mRNA, a marker for telencephalon forebrain, was entirely absent in E8.5 and E9.5 Cnbp-/- embryos when compared with wild-type littermates (Fig. 3A,B,K,L). Loss of Bf1 expression in mutant embryos at E8.5 suggests loss of the telencephalon. We examined the expression of other forebrain markers, such as Hesx1 and Six3, which mark the diencephelon, to determine whether this tissue is also missing in the mutants. Hesx1 and Six3 were not detected in the mutants, indicating that diencephelon is also missing in the mutant embryos (Fig. 3C-F). To determine the anterior truncation level, engrailed1 (En1), a marker for posterior midbrain and anterior hindbrain was employed. En1 was expressed in the anterior region of both E9.0 normal and Cnbp mutant embryos (Fig. 3G,H), indicating that anterior hindbrain was not affected by the mutation. However, we could not determine whether midbrain is affected in the mutants from the analysis of En1 expression. Another hindbrain marker, Krox20 (Egr2 — Mouse Genome Informatics), was detected in rhombomeres 3 and 5 of Cnbp-/- embryos at E9.0 (Fig. 3I,J). Thus, the anterior hindbrain regions are present in homozygous mutants. We then used the mesoderm specific markers, Mox1 and Brachyury (T) to determine whether trunk and tail development was affected. Both genes were expressed normally in homozygous mutants. Mox1 expression was detected in paraxial mesoderm cells of E9.5 mutant embryos. Mox1 expression was similar in the trunk regions of homozygous mutants as in their wild-type littermates (Fig. 3M,N). T expression was detected in the notochord and posterior (tail) mesoderm cells of both mutant E9.5 embryos, and in their wild-type littermates (Fig. 3O,P), indicating that notochord development is not affected in Cnbp-/- homozygous embryos (Fig. 3P). Collectively, our expression analysis indicates that the Cnbp mutation results in forebrain truncation but does not affect posterior patterning beyond the midbrain, as development of hindbrain, trunk and tail of Cnbp-/- embryos was essentially normal.



View larger version (102K):
[in this window]
[in a new window]
 
Fig. 3. Loss of forebrain in Cnbp mutants. (A,B,K,L) Bf1 mRNA, a marker for the telencephalon was entirely absent in E8.5 (B) and E9.5 (L) Cnbp-/- embryos (n=5). (C-F) Hesx1 and Six3 markers, used here to label the diencephalon, were entirely absent in E8.0 Cnbp-/- embryos (D,F) when compared with wild-type littermates (C,E). (G,H) En1, a marker for midbrain and anterior hindbrain, is normally expressed in E8.5 wild-type and Cnbp-/- mutant embryos. (I,J) Expression of Krox20, a marker for rhombomeres 3 and 5, is observed in E9.0 wild-type and Cnbp-/- mutant embryos. (M,N) Mox1 expression is normal in paraxial mesoderm cells in E9.5 Cnbp-/- mutant when compared with their wild-type littermates. (O,P) Brachyury (T) expression is detected in the notochord and posterior mesoderm cells of mutant embryos at E9.5. T expression in tail was similar in homozygous mutants and their wild-type littermates.

 

Defects of the AVE, ADE and ANE
In order to investigate the onset of the forebrain phenotypes, we analyzed the expression of a number of markers at early developmental stages when morphological abnormalities are not yet visible. We analyzed the expression of AVE markers Hex and Lim1 at pre- and early-streak stages. At E6.0, AVE formation was initiated normally at the distal end of Cnbp-/- embryos (Fig. 4A,B). The defects were first detected at mid-primitive streak stages (E6.5), when Hex expression did not complete a morphogenetic movement toward the proximal anterior region in Cnbp-/- mutants when compared with wild-type littermates (Fig. 4C,D). The expression of Lim1 in the anterior of mutants was also detected more distally when compared with that in wild-type embryos (Fig. 4E,F). Interestingly, the posterior expression of Lim1 appeared to be more proximal, and closer to the extra-embryonic/embryonic junction in the mutant embryo compared with its expression pattern in wild-type embryos (Fig. 4E,F). The ectopic expression may be caused by the Cnbp mutation. In a similar case, ectopic expression of Hesx1 was found throughout the ectodermal layer of the distal region of the egg cylinder at E6.75 Cripto mutants (Ding et al., 1998Go). Others have reported that Otx2-null mutant embryos also failed to execute movement of the AVE from the distal end to proximal region of the embryo and that they lack anterior structures (Perea-Gomez et al., 2001Go). We conclude from these data, that CNBP is important for the correct localization of the AVE.



View larger version (108K):
[in this window]
[in a new window]
 
Fig. 4. Molecular analyses of the origins of the developmental defects in Cnbp-/- mutants by whole-mount in situ hybridization analysis of marker genes. Lateral views of embryos are shown with anterior (A) to the left and posterior (P) to the right. (A,B) Whole-mount in situ hybridization with Hex probe at E6.0. Hex was expressed normally in the distal end of the epiblast of Cnbp-/- mutant when compared with wild-type littermates. (C,D) Hex was expressed in the displaced AVE of E6.5 wild-type embryos but was retained near the distal end of the epiblast in the mutants (arrow). (E,F) Lim1 is expressed in the AVE and the primitive streak of the E6.5 wild-type embryo; however, transcripts are more towards the distal end of the AVE in Cnbp-/-. (G,H) Hex is expressed in the anterior definitive endoderm (ADE) and AVE of E7.25 wild-type embryos but is not detectable in E7.25 mutant embryos. (I,J) Cer1 expression was undetectable in the ADE and AVE in E7.25 mutant embryos. (K,L) Hex is expressed in the ADE and ANE of E7.5 wild-type embryos but is not detectable in that of E7.5 mutant embryos. (M,N) Cer1 expression was undetectable in the ADE and ANE in E7.5 mutant embryos. (O,P) Expression of Otx2 in the ANE was not observed in mutant embryos.

 

To understand further the developmental origins of the Cnbp-/- phenotype, we investigated ADE induction (Lu et al., 2001Go). The ADE expresses many of the same genes as the AVE, such as Hex and Cer1 (Martinez Barbera et al., 2000Go). The expression of Hex in Cnbp-/- mutant embryos failed to occur at the late streak stage E7.5 (n=6) (Fig. 4K,L), indicating the ADE must be absent in Cnbp-/- mutant embryos. Cer1 is also normally expressed in the ADE at the late streak stage but was also absent in Cnbp-/- mutant embryos (n=5) (Fig. 4M,N), which further confirms the lack of the ADE in Cnbp-/- mutant embryos. Currently, we do not know why Hex and Cer1 were not expressed in the mutants. The difference in expression of Hex and Cer1 in mutants compared with wild-type embryos could be caused by a delay of development. In order to take into account the problem of developmental delay in the mutants, we then analyzed expression of these genes at E7.25 to determine whether the AVE is correctly positioned in the mutant embryos at this stage. Our results showed that at E7.25 stage, Hex and Cer1 were expressed in the AVE and ADE of E7.25 wild-type embryos (Fig. 4G,I). By contrast, Hex mRNA was expressed at the distal tip in the E7.25 mutant embryos and this leads, in Cnbp-/- E7.25 embryos, to the ectopic confinement of Hex-expressing cells to the region where the node is normally located (Fig. 4H). The expression of Cer1 was also detected more distally when compared with that in wild-type embryos (Fig. 4J). Interestingly, the expression of Hex and Cer1 in the ADE is not detected in the mutants at this stage (Fig. 4H,J). Mislocalization of the AVE and absence of the ADE indicate a defect in anterior displacement of the AVE instead of a developmental delay. The critical AVE movement could perhaps be a prerequisite for ADE formation. Its absence in Cnbp-/- embryos supports this hypothesis.

To determine whether the induction of the ANE was affected in Cnbp-/- embryos, we examined the expression of an ANE marker, Otx2, at E7.5. In all Cnbp-/- mutants examined Otx2 expression was undetectable (n=8) (Fig. 4O,P), which indicates that the cells destined for an anterior neural fate failed to form in the mutant embryos. Our data indicate that CNBP is required for ADE formation and anterior neural fate induction.

Defects of anterior mesendoderm (AME)
Recent transplantation experiments have demonstrated that a mixed graft of cells from the AVE, the anterior epiblast and the anterior streak can induce anterior neural genes (Tam and Steiner, 1999Go). In addition, removal of the ADE, together with prechordal plate and axial node derivatives, at the late gastrula stage results in truncation of the anterior neuroectoderm (Camus et al., 2000Go), indicating that a reciprocal interaction between these tissues is required for anterior patterning. To examine whether the Cnbp mutation affects the formation of anterior mesendoderm (AME), prechordal mesoderm, node and axial node derivatives, we analyzed the expression of a number of anterior mesendoderm markers, including Lim1, T, Hnf3b, Gsc and Dkk1, at primitive streak and early somite stages. Lim1, T and Hnf3b were all expressed in the node of wild-type embryos at E7.5 (Fig. 5A,C,E) (Ang et al., 1993Go; Monaghan et al., 1993Go). Hnf3b and Lim1 were also expressed in midline cells anterior to the notochord, known as anterior mesendoderm or prechordal mesoderm cells (Fig. 5A,C). In homozygous mutants, all three genes were expressed in the node and in the anterior region, but only a short distance from the node (Fig. 5B,D,F). This is in sharp contrast to wild-type embryos in which labeled head-process cells had migrated much farther anteriorly (Fig. 5B,D,F). In particular, the anterior-most midline expression of Lim1 and Hnf3b in AME cells is missing in the mutants (Fig. 5B,D), indicating that the AME fails to develop. Later, during early somite stages, the absence of Hnf3b signal indicates defects in anterior axial mesoderm cells and the rostral portion of the neural tube (Fig. 5G,H). The rostral expression of Hnf3b in the mutant embryo appears to be limited to the prospective hindbrain (Fig. 5H). This suggests that the midbrain development may also be affected in the mutant embryos. However, the potential defect in midbrain should be only a partial truncation based on the above morphological analysis (Fig. 1). The reduced Lim1 and Hnf3b expression in the anterior embryo suggests a defect in the AME. To analyze this structure further, we used prechordal plate markers Gsc and Dkk1 to assess prechordal plate development. Gsc and Dkk1 were not expressed in E7.75 and E8.0 mutant embryos, indicating a defect in prechordal plate development (Fig. 5I-L). Although loss of Cnbp expression leads to defects in forebrain and midbrain development, the more posterior CNS is normal.



View larger version (122K):
[in this window]
[in a new window]
 
Fig. 5. Whole-mount RNA in situ hybridization staining of AME markers. (A,B) Lim1 is expressed in the ADE and primitive streak at E7.5, but is undetected in the AME of mutant embryos. (C,D) Hnf3b is expressed in the node and prechordal mesoderm in wild-type embryo at E7.5, but only extends a short distance anteriorly from the node in mutant embryos (arrow). (E,F) T is expressed in the primitive streak of the wild-type and mutant embryos. In the mutants, T is only expressed at a short distance from the node. (G,H). At E8.0, Hnf3b expression in mutants is normal in the node and most of the midline but is absent from the anterior head and foregut pocket region. (I-L) Analysis of the of prechordal plate markers Gsc and Dkk1 indicates that the E7.5 and E8.0 mutant embryos lack prechordal plate.

 

Reduced cell proliferation in anterior regions may account for defects in formation of the AVE, ADE, AME and ANE
We next investigated the cellular and molecular basis of the forebrain truncation defect in Cnbp-/- embryos. The forebrain truncation may potentially result from defects in anterior neural cell differentiation, excess cell death, decreased cell proliferation or a combination of these processes in the developing forebrain region. Morphological and histological analysis indicated that the AME and ANE tissues of E7.5 Cnbp-/- embryos were missing (Fig. 6A,B). Sagittal sections of E8.5 Cnbp-/- embryos revealed defects in headfold formation and prechordal mesoderm formation (Fig. 6C,D). The rest of the body axis appeared normal. To compare the proliferative and apoptotic profiles in Cnbp-/- and wild-type littermates, BrdU incorporation and TUNEL assays were performed on sections of E7.5 and E8.5 embryos. Wild-type E7.5 and E8.5 embryos exhibit many BrdU-positive nuclei throughout the embryonic structures (Fig. 6E,G). By contrast, the mutants have fewer BrdU-positive nuclei in the ANE region (Fig. 6F,H). However, there is no significant difference in the number of BrdU-positive nuclei between the trunk region of wild-type and mutant embryos. The ratio of proliferating cells (BrdU-positive nuclei) to total cell number in the anterior of E7.5 embryos was calculated to be 84% for three wild-type embryos compared with 28% for three Cnbp-/- mutant embryos (Fig. 6E,F,Q). As cells have been estimated to have a 10-12 hour division cycle during this period, a 10-20% decline in the proportion of S-phase cells during early post-implantation could result in a 25% decline in embryo size over a period of 1 day. The lack of cell proliferation may result in the observed reduction in size of the headfolds at E8.5 (Fig. 6H). TUNEL assays showed minimal apoptosis in normal and mutant E7.5 and 8.5 embryos (Fig. 6I-L), which suggests that programmed cell death does not contribute significantly, if at all, to the null phenotype. These findings indicated that the Cnbp mutation leads to a dramatic reduction in cell proliferation in the AME and ANE tissues, and headfold. To address further whether the impaired anterior movement of the AVE observed in Cnbp mutant embryos is related to defects in cell proliferation in AVE, we performed BrdU incorporation assays on E6.0 wild-type and mutant littermates. BrdU-positive nuclei were rarely seen in the prospective anterior region of the AVE in E6.0 mutant embryos (Fig. 6P). By contrast, the greatest density of BrdU-positive nuclei was observed in the anterior region of the AVE in normal E6.0 embryos (Fig. 6O). Our results suggest that reduced cell proliferation in anterior regions of Cnbp mutant embryos might account for defects in formation of the AVE, ADE, AME and ANE.



View larger version (115K):
[in this window]
[in a new window]
 
Fig. 6. Morphological and cellular basis of the forebrain defects in Cnbp-/-. (A,B) Disorganization of the axial mesendoderm and ANE region of cells (arrow) in E7.5 Cnbp-/- mutants (A) compared with that (arrow) of wild-type littermates (B). (C,D) Lack of ANE and characteristic headfold structure in E8.5 Cnbp-/- embryos compared with that of wild-type littermates. (E-H) Evidence for decreased proliferation rate in mutant head plate by BrdU incorporation analysis in adjacent sections of wild-type (E,G) and Cnbp-/- mutant embryos (F,H). Arrow in F indicates that BrdU-positive nuclei was rarely seen in the anterior region of the mutant compared with that in wild-type embryo (arrow in E). Note that the head regions of wild-type embryos exhibit a high density of BrdU-positive nuclei throughout the axial mesendoderm and ANE regions at E7.5, and in prechordal mesoderm and headfold regions at E8.5. The mutants showed much fewer BrdU-positive nuclei at the same regions. (I-L) TUNEL apoptosis assays in the histologically normal and mutant E7.5 and 8.5 embryos. TUNEL assays showed there was no significant difference of apoptosis in the anterior region of wild-type (I,K) and mutant (J,L) E7.5 and E8.5 embryos. (M-P) E6.0 Cnbp-/- mutant embryos and wild-type littermates were examined for general morphology (M,N) and cell division using a BrdU incorporation assay (O,P). BrdU-positive nuclei in mutant embryos were absent in the AVE of E6.0 mutant embryos (arrow in P). By contrast, the AVE region in normal E6.0 embryos showed the greatest density of BrdU-positive nuclei (arrow in O). (Q) Quantification of BrdU-positive nuclei in the anterior region of E7.5 embryos. The percent of BrdU-positive nuclei was 84% in wild-type embryos compared with 28% in null-mutant embryos. Error bars represent s.e., counts were made of three wild-type embryos (blue bar) and three null-mutant embryos (red bar). These values were determined to be statistically significant (P<0.001).

 

CNBP may control forebrain induction though Myc
CNBP was shown to regulate the CT element of the human MYC protooncogene through its binding to the element found in the MYC promoter (Michelotti et al., 1995Go). In addition to regulating cell proliferation and apoptosis, Myc can also promote differentiation of stem cells into transit-amplifying cells specific for the sebaceous and interfollicular epidermal lineages (Arnold and Watt, 2001Go; Gandarillas and Watt, 1997Go), and the Myc-/- mutant has defects in development of anterior structures (Davis et al., 1993Go; Gandarillas and Watt, 1997Go). These reports lead us to hypothesize that Myc is a downstream target gene of Cnbp during forebrain development, which may promote cell proliferation and differentiation in forebrain induction. We therefore examined the possible involvement of Myc in forebrain neuroectoderm induction and specification. We observed that Myc is expressed in anterior neuroectoderm at E7.25, and that the expression pattern of Myc in E8.5 and E9.5 mouse embryos was similar to that of Cnbp during forebrain development (Fig. 2C,E,H; Fig. 7A,C,E). Notably, expression of Myc in the anterior neuroectoderm and the headfold region of E7.25 and E8.5 Cnbp-/- mutant embryos was absent, whereas the expression of Myc in the allantois was normal (Fig. 7B,D). However, the loss of the anterior tissues by E8.5 and E9.5 could equally be the mechanism that results in reduced Myc expression. The regions where Myc expression was downregulated also showed reduced BrdU labeling, indicating that CNBP might regulate anterior cell proliferation through Myc.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 7. CNBP positively regulates the endogenous expression of Myc. (A-D) Myc is normally abundantly expressed in the ANE at E7.25 (A) and in the neural folds (arrow, C) at E8.5, but is nearly undetectable in the neural folds (arrow, D) of Cnbp mutants. Expression in the allantois (arrowhead) is not affected in E8.5 mutant embryos. (E,F) At E9.5, Myc is expressed in the forebrain, as well as in the primitive facial prominences of wild-type embryos, but it was undetected in the anterior region of E9.5 mutant embryos. (G) CNBP upregulates Myc promoter activity in embryonic cells. Cnbp+/+ and Cnbp-/- mouse embryonic fibroblast cells (MEFs) were transfected with Myc promoter-luciferase plasmid (columns 1 and 2) or co-transfected with a mouse Cnbp-expression plasmid into Cnbp-/- cells (column 3). A lower level of Myc expression was observed in Cnbp-/- embryonic fibroblasts compared with Cnbp+/+ cells. Transfection of Cnbp-/- embryonic fibroblasts with the Cnbp-expression plasmid resulted in a Myc expression level higher than that found in Cnbp+/+ cells. Results represent luciferase activity related to galactosidase activity. Values are the mean±s.d. of triplicate experiments.

 

To test whether CNBP regulates Myc expression at the transcription level, we transfected wild-type and Cnbp-/- mutant embryonic fibroblasts (MEF) with a Myc promoter-luciferase reporter plasmid (He et al., 1998Go). A lower level of luciferase activity was observed in Cnbp-/- MEF than in wild-type cells (Fig. 7G). Co-transfection of Cnbp-/- MEF with the luciferase reporter DNA and a mouse Cnbp-expression plasmid (CMV-CNBP) elevated Myc expression to a level higher than that seen in Cnbp+/+ cells (Fig. 7G). Therefore, we conclude that Cnbp expression enhances Myc-promoter activity. Although the mechanism by which Cnbp expression enhances Myc promoter activity during anterior patterning remains to be elucidated, it is plausible that CNBP is one of the necessary transcription factors that bind to the Myc promoter to regulate its transcription.


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Our work is the first to demonstrate the role of CNBP in rostral head formation during mouse embryonic development by generating Cnbp mutant mice, performing in vivo functional studies and transgenic mouse rescue, and characterizing the potential mechanism by which CNBP induces and specifies the forebrain through Myc expression and regulation of cell proliferation. Our results demonstrate that the Cnbp mutant mouse provides a valuable model for insight into anterior patterning related to AVE localization, ADE formation, neuralization of anterior ectoderm and forebrain induction.

A role for CNBP in head development
Our study has shown that ablation of Cnbp function in the mouse results in severe truncation of the forebrain. This finding provides direct genetic evidence that Cnbp, a zinc-finger protein, plays an essential and novel role in mouse forebrain development. De Robertis and colleagues have recently shown that mouse embryos carrying null mutations in the genes encoding BMP antagonists Noggin and Chordin fail to maintain a functional AVE and display forebrain defects (Bachiller et al., 2000Go). In addition, Mukhopadhyay and colleagues have recently shown that mouse embryos carrying null mutations in the genes encoding Dkk1 display forebrain defects (Mukhopadhyay et al., 2001Go). Molecular marker analysis showed that expression of Bf1, Hesx1 and Six3 is completely absent; however, expression of En1 is detected in Dkk1-mutant embryos. The identical expression pattern of the marker genes in both Dkk1- and Cnbp-mutant embryos indicates that both Dkk1- and Cnbp-mutant embryos show a similar forebrain phenotype. Although Cnbp is predominately expressed in the forebrain, Cnbp expression is also detected in midbrain region of E9.5 embryos. Moreover, E7.5 Cnbp-mutant embryos show a complete lack of Otx2 expression, and the rostral level of Hnf3b expression in the mutant embryos appears to be limited to the hindbrain region, indicating a defect in midbrain tissues in the Cnbp mutants.

Cnbp expression in the early embryo is first noted in cells corresponding to a region of the early gastrulating embryo (at E6.0) where the AVE abuts the epiblast. However, no morphological defect can be detected in the Cnbp-/- embryos prior to the early-streak stages. The defects were first detected at mid-primitive-streak stages (E6.5), when Hex expression did not complete a morphogenetic movement toward the proximal anterior region in Cnbp-/- mutants when compared with wild-type littermates. The more distal Hex expression could be caused by a delay in development of the mutants. However, our results could not rule out the possibility of a delay in the development of mutants, based on the fact that: (1) Hex expression in E6.0 mutants is normal, which indicates the delay did not happen at this stage of development; (2) at E7.25, expression of Hex and Cer1 was incorrectly positioned at the distal end in mutant embryos, which indicates defects in corresponding tissues, whereas we would expect that the AVE would persist and fully elongate, and that the ADE would be induced if there was a delay in development; and (3) forebrain truncation in the E9.5 and newborn mutants is consistent with defects in the anterior tissue, whereas the trunk develops normally.

It is notable that Otx2 expression is absent in Cnbp mutants at E7.5. As Otx2-null mutant embryos both failed to execute the movement of the AVE from the distal end to proximal region of the embryo (Perea-Gomez et al., 2001Go) and lack anterior structures (Ang et al., 1996Go), we suspect Otx2 may act downstream of CNBP. However, in Otx2 mutants the brain truncation was extended to anterior hindbrain as the expression of En1 marker gene was not detected in Otx2-mutant embryos (Ang et al., 1996Go). Thus, the head defect phenotype in Otx2-mutant embryos is more severe than that in Cnbp-mutant embryos. The difference between the two mutations might be explained by residual Otx2 protein or reduced Otx2 expression in Cnbp mutants that was not detected by our in situ methods. An alternative possibility is that CNBP might only regulate Otx2 expression in certain tissues and at specific stages. To address this question, mutant embryos at early stages will be analyzed in further studies. Nevertheless, the absence of Otx2 expression in the prospective ANE cells of late-streak mutant embryos at E7.5 suggests that CNBP function is required for specification of the ANE during forebrain development. Forebrain patterning in the mouse is initiated by the inductive activity of the AVE and, subsequently, requires the function of the node-derived ADE (Ang et al., 1994Go; Shawlot et al., 1999Go; Tam and Steiner, 1999Go; Thomas and Beddington, 1996Go). The severe anterior phenotype of Cnbp-/- embryos suggests that CNBP is a key factor in the head developmental process. However, it is not clear from this analysis whether CNBP is required in the AVE and/or the ADE for forebrain development. The generation of chimeric embryos composed of extra-embryonic and embryonic tissues of different genotypes would resolve this issue in future studies.

CNBP appears to regulate cell proliferation and tissue specification through Myc during forebrain induction
An abnormal constriction at the extra-embryonic/embryonic boundary is observed in Cnbp-/- mutants. The constriction was also reported in Otx2, Hnf3b and Lim1 mutants. However, the cause of the constriction remains unknown. Our cell proliferation data identify a substantial reduction in the cell proliferation of the AME and ANE, which is also associated with the loss of Myc expression in a tissue-specific manner where the constriction is observed. As no difference in apoptosis was evident between Cnbp-/- and wild-type embryos, we conclude that the constriction arises as a result of reduced proliferation of the AVE and ANE during expansion of the ANE. The fact that CNBP upregulates CT elements in the Myc promoter and regulates cell proliferation highlights potential links between CNBP and Myc. In Cnbp-/- embryos, CNBP appears to regulate proliferation through Myc. Myc is an important regulator of cell proliferation; however, others have recently shown that Myc is also involved in differentiation (Arnold and Watt, 2001Go; Gandarillas and Watt, 1997Go). Myc may be involved in ANE tissue specification. In homozygous Cnbp mutants, the lack of Myc may hinder neuralization in the anterior epiblast and, thus, further exacerbate the forebrain defect. Our data suggest a forebrain induction mechanism by which CNBP induces the expression of Myc, which in turn stimulates cell proliferation and differentiation of the anterior epiblast and neuroectoderm cells during forebrain induction and specification. Although we propose that CNBP regulates forebrain formation through the Myc pathway, we could not rule out involvement of other CNBP target genes that have not yet been characterized. Interestingly, some Myc-null mutant embryos die at E10.5 with anterior neural fold truncation (Davis et al., 1993Go) whereas other Myc mutant embryos do not show obvious forebrain defects. One possible explanation is that CNBP targets a group of genes, including Myc, to regulate forebrain development. Another explanation is that an unknown factor may compensate for Myc loss in C57B1/6J and 129Sv hybrid or inbred 129Sv background (Davis et al., 1993Go). The role of Myc in forebrain formation remains to be investigated further.

The origins of forebrain phenotype of CNBP mutants are defects in the AVE and ADE tissues but not in the node and notochord
We find that AVE, ADE and ANE defects in Cnbp-/- mice result in forebrain truncation initiated from early gastrulation stages. Other genes, such as Lim1, Otx2, Nodal, Smad2, Foxh1, Arkadia, Hex, Oto, Dkk1, Hesx1, Nog and Chrd, are also essential for murine head development (Episkopou et al., 2001Go; Hoodless et al., 2001Go; Shawlot et al., 1999Go; Yamamoto et al., 2001Go). However, the brain defects are considerably different among these mutants. Embryos homozygous for mutations in Lim1, Otx2, Foxh1 or Arkadia exhibit truncations of the forebrain, midbrain and rostral hindbrain. By comparison, forebrain truncation in Hex-/-, Oto-/- and Hesx1-/- embryos is relatively mild (Zoltewicz et al., 1999Go; Martinez Barbera et al., 2000Go). The defects observed in Cnbp-/- embryos are clearly different from other mutants as Cnbp-/- mutants showed complete forebrain truncation. The developmental origins of the defects are also considerably different among these mutants. The developmental defects in Otx2 mutants originate from an inability of the AVE to complete its anteriorward movement and a failure to form the node, prechordal mesoderm, notochord and ADE. Foxh1 and Arkadia mutants have normal AVE but impaired ADE, node and notochord. Hex-/-, Oto-/- and Hesx1-/- mutants display absence or early regression of the ADE and normal AVE, node and notochord. Compared with other mutants that have brain defects, the developmental origin of the forebrain defects in Cnbp-/- embryos is clearly unique. Cnbp mutants exhibit impaired AVE and ADE, with normal development of the node and notochord. The unique forebrain phenotype and developmental origin of the defects in Cnbp mutants indicate that the Cnbp mutation may affect a different genetic pathway when compared with any known mutation resulting in forebrain defects. Therefore, Cnbp-/- embryos provide a unique and valuable mouse model for studying forebrain formation.


    ACKNOWLEDGMENTS
 
We are grateful to Ms Justine Dobeck for her excellent histology assistance and Dr S. P. Oh for his assistance with genomic gene cloning. We thank Dr Margaret A. Thompson for her assistance with transgenic mouse rescue work. We thank Dr Ryoji Moroi for his assistance with the manuscript. We thank Dr Kenneth W. Kinzler for the Myc promoter-luciferase plasmid, Dr Sarah Millar for the Dkk1 probe and Dr Guillermo Oliver for the Six3 probe. This work was supported by NIH grant AR44741 (Y.-P. L.) and AR-48133-01 (Y.-P. L.).


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Acampora, D., Mazan, S., Lallemand, Y., Avantaggiato, V., Maury, M., Simeone, A. and Brulet, P. (1995). Forebrain and midbrain regions are deleted in Otx2-/- mutants due to a defective anterior neuroectoderm specification during gastrulation. Development 121,3279 -3290.[Abstract]
Acampora, D., Avantaggiato, V., Tuorto, F., Briata, P., Corte, G. and Simeone, A. (1998). Visceral endoderm-restricted translation of Otx1 mediates recovery of Otx2 requirements for specification of anterior neural plate and normal gastrulation. Development 125,5091 -5104.[Abstract]
Ang, S. L. and Rossant, J. (1994). HNF-3 beta is essential for node and notochord formation in mouse development. Cell 78,561 -574.[CrossRef][Medline]
Ang, S. L., Wierda, A., Wong, D., Stevens, K. A., Cascio, S., Rossant, J. and Zaret, K. S. (1993). The formation and maintenance of the definitive endoderm lineage in the mouse: involvement of HNF3/forkhead proteins. Development 119,1301 -1315.[Abstract]
Ang, S. L., Conlon, R. A., Jin, O. and Rossant, J. (1994). Positive and negative signals from mesoderm regulate the expression of mouse Otx2 in ectoderm explants. Development 120,2979 -2989.[Abstract]
Ang, S. L., Jin, O., Rhinn, M., Daigle, N., Stevenson, L. and Rossant, J. (1996). A targeted mouse Otx2 mutation leads to severe defects in gastrulation and formation of axial mesoderm and to deletion of rostral brain. Development 122,243 -252.[Abstract]
Arnold, I. and Watt, F. M. (2001). c-Myc activation in transgenic mouse epidermis results in mobilization of stem cells and differentiation of their progeny. Curr. Biol. 11,558 -568.[CrossRef][Medline]
Ayala-Torres, S., Johnson, B. H. and Thompson, E. B. (1994). Oxysterol sensitive and resistant lymphoid cells: correlation with regulation of cellular nucleic acid binding protein mRNA. J. Steroid Biochem. Mol. Biol. 48,307 -315.[CrossRef][Medline]
Bachiller, D., Klingensmith, J., Kemp, C., Belo, J. A., Anderson, R. M., May, S. R., McMahon, J. A., McMahon, A. P., Harland, R. M., Rossant, J. et al. (2000). The organizer factors chordin and noggin are required for mouse forebrain development. Nature 403,658 -661.[CrossRef][Medline]
Barklis, E., Mulligan, R. C. and Jaenisch, R. (1986). Chromosomal position or virus mutation permits retrovirus expression in embryonal carcinoma cells. Cell 47,391 -399.[CrossRef][Medline]
Beddington, R. S. (1994). Induction of a second neural axis by the mouse node. Development 120,613 -620.[Abstract]
Beddington, R. S. and Robertson, E. J. (1999). Axis development and early asymmetry in mammals. Cell 96,195 -209.[CrossRef][Medline]
Beddington, S. P. (1981). An autoradiographic analysis of the potency of embryonic ectoderm in the 8th day postimplantation mouse embryo. J Embryol. Exp Morphol. 64, 87-104.[Medline]
Brennan, J., Lu, C. C., Norris, D. P., Rodriguez, T. A., Beddington, R. S. and Robertson, E. J. (2001). Nodal signalling in the epiblast patterns the early mouse embryo. Nature 411,965 -969.[CrossRef][Medline]
Camus, A., Davidson, B. P., Billiards, S., Khoo, P., Rivera-Perez, J. A., Wakamiya, M., Behringer, R. R. and Tam, P. P. (2000). The morphogenetic role of midline mesendoderm and ectoderm in the development of the forebrain and the midbrain of the mouse embryo. Development 127,1799 -1813.[Abstract]
Cohen, M. M., Jr (1993). Sutural biology and the correlates of craniosynostosis. Am. J. of Med. Genet. 47,581 -616.[CrossRef][Medline]
Covey, S. N. (1986). Amino acid sequence homology in gag region of reverse transcribing elements and the coat protein gene of cauliflower mosaic virus. Nucl. Acids Res. 14,623 -633.[Abstract/Free Full Text]
Dattani, M. T., Martinez-Barbera, J. P., Thomas, P. Q., Brickman, J. M., Gupta, R., Martensson, I. L., Toresson, H., Fox, M., Wales, J. K., Hindmarsh, P. C. et al. (1998). Mutations in the homeobox gene HESX1/Hesx1 associated with septo-optic dysplasia in human and mouse. Nat. Genet. 19,125 -133.[CrossRef][Medline]
Davis, A. C., Wims, M., Spotts, G. D., Hann, S. R. and Bradley, A. (1993). A null c-myc mutation causes lethality before 10.5 days of gestation in homozygotes and reduced fertility in heterozygous female mice. Genes Dev. 7,671 -682.[Abstract/Free Full Text]
De Dominicis, A., Lotti, F., Pierandrei-Amaldi, P. and Cardinali, B. (2000). cDNA cloning and developmental expression of cellular nucleic acid-binding protein (CNBP) gene in xenopus laevis. Gene 241,35 -43.[CrossRef][Medline]
Deng, W., Stashenko, P., Chen, W., Liang, Y., Shimizu, K. and Li, Y. P. (2001). Characterization of mouse Atp6i gene, the gene promoter, and the gene expression. J. Bone Miner. Res. 16,1136 -1146.[CrossRef][Medline]
Ding, J., Yang, L., Yan, Y. T., Chen, A., Desai, N., Wynshaw-Boris, A. and Shen, M. M. (1998). Cripto is required for correct orientation of the anterior-posterior axis in the mouse embryo. Nature 395,702 -707.[CrossRef][Medline]
Episkopou, V., Arkell, R., Timmons, P. M., Walsh, J. J., Andrew, R. L. and Swan, D. (2001). Induction of the mammalian node requires Arkadia function in the extraembryonic lineages. Nature 410,825 -830.[CrossRef][Medline]
Flink, I. L., Blitz, I. and Morkin, E. (1998). Characterization of cellular nucleic acid binding protein from Xenopus laevis: expression in all three germ layers during early development. Dev. Dyn. 211,123 -130.[CrossRef][Medline]
Gandarillas, A. and Watt, F. M. (1997). c-Myc promotes differentiation of human epidermal stem cells. Genes Dev. 11,2869 -2882.[Abstract/Free Full Text]
Harbers, K., Muller, U., Grams, A., Li, E., Jaenisch, R. and Franz, T. (1996). Provirus integration into a gene encoding a ubiquitin- conjugating enzyme results in a placental defect and embryonic lethality. Proc. Natl. Acad. Sci. USA 93,12412 -12417.[Abstract/Free Full Text]
He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da Costa, L. T., Morin, P. J., Vogelstein, B. and Kinzler, K. W. (1998). Identification of c-MYC as a target of the APC pathway. Science 281,1509 -1512.[Abstract/Free Full Text]
Hoodless, P. A., Pye, M., Chazaud, C., Labbe, E., Attisano, L., Rossant, J. and Wrana, J. L. (2001). FoxH1 (Fast) functions to specify the anterior primitive streak in the mouse. Genes Dev. 15,1257 -1271.[Abstract/Free Full Text]
Jabs, E. W., Muller, U., Li, X., Ma, L., Luo, W., Haworth, I. S., Klisak, I., Sparkes, R., Warman, M. L., Mulliken, J. B. et al. (1993). A mutation in the homeodomain of the human MSX2 gene in a family affected with autosomal dominant craniosynostosis. Cell 75,443 -450.[CrossRef][Medline]
Kimura, C., Yoshinaga, K., Tian, E., Suzuki, M., Aizawa, S. and Matsuo, I. (2000). Visceral endoderm mediates forebrain development by suppressing posteriorizing signals. Dev. Biol. 225,304 -321.[CrossRef][Medline]
Konicek, B. W., Xia, X., Rajavashisth, T. and Harrington, M. A. (1998). Regulation of mouse colony-stimulating factor-1 gene promoter activity by AP1 and cellular nucleic acid-binding protein. DNA Cell Biol. 17,799 -809.[Medline]
Lawson, K. A. and Pedersen, R. A. (1987). Cell fate, morphogenetic movement and population kinetics of embryonic endoderm at the time of germ layer formation in the mouse. Development 101,627 -652.[Abstract]
Lawson, K. A., Meneses, J. J. and Pedersen, R. A. (1991). Clonal analysis of epiblast fate during germ layer formation in the mouse embryo. Development 113,891 -911.[Abstract]
Li, E., Bestor, T. H. and Jaenisch, R. (1992). Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69,915 -926.[CrossRef][Medline]
Li, Y. P., Chen, W., Liang, Y., Li, E. and Stashenko, P. (1999). Atp6i-deficient mice exhibit severe osteopetrosis due to loss of osteoclast-mediated extracellular acidification. Nat. Genet. 23,447 -451.[CrossRef][Medline]
Lu, C. C., Brennan, J. and Robertson, E. J. (2001). From fertilization to gastrulation: axis formation in the mouse embryo. Curr. Opin. Genet. Dev. 11,384 -392.[CrossRef][Medline]
Martinez Barbera, J. P., Clements, M., Thomas, P., Rodriguez, T., Meloy, D., Kioussis, D. and Beddington, R. S. (2000). The homeobox gene Hex is required in definitive endodermal tissues for normal forebrain, liver and thyroid formation. Development 127,2433 -2445.[Abstract]
Matsuo, I., Kuratani, S., Kimura, C., Takeda, N. and Aizawa, S. (1995). Mouse Otx2 functions in the formation and patterning of rostral head. Genes Dev. 9,2646 -2658.[Abstract/Free Full Text]
Michelotti, E. F., Tomonaga, T., Krutzsch, H. and Levens, D. (1995). Cellular nucleic acid binding protein regulates the CT element of the human c-myc protooncogene. J. Biol. Chem. 270,9494 -9499.[Abstract/Free Full Text]
Monaghan, A. P., Kaestner, K. H., Grau, E. and Schutz, G. (1993). Postimplantation expression patterns indicate a role for the mouse forkhead/HNF-3 alpha, beta and gamma genes in determination of the definitive endoderm, chordamesoderm and neuroectoderm. Development 119,567 -578.[Abstract/Free Full Text]
Moon, R. T. and Kimelman, D. (1998). From cortical rotation to organizer gene expression: toward a molecular explanation of axis specification in Xenopus. BioEssays 20,536 -545.[CrossRef][Medline]
Mukhopadhyay, M., Shtrom, S., Rodriguez-Esteban, C., Chen, L., Tsukui, T., Gomer, L., Dorward, D. W., Glinka, A., Grinberg, A., Huang, S. P. et al. (2001). Dickkopf1 is required for embryonic head induction and limb morphogenesis in the mouse. Dev. Cell 1,423 -434.[CrossRef][Medline]
Nomura, M. and Li, E. (1998). Smad2 role in mesoderm formation, left-right patterning and craniofacial development. Nature 393,786 -790.[CrossRef][Medline]
Perea-Gomez, A., Lawson, K. A., Rhinn, M., Zakin, L., Brulet, P., Mazan, S. and Ang, S. L. (2001). Otx2 is required for visceral endoderm movement and for the restriction of posterior signals in the epiblast of the mouse embryo. Development 128,753 -765.[Abstract]
Piotrowska, K. and Zernicka-Goetz, M. (2001). Role for sperm in spatial patterning of the early mouse embryo. Nature 409,517 -521.[CrossRef][Medline]
Rajavashisth, T. B., Taylor, A. K., Andalibi, A., Svenson, K. L. and Lusis, A. J. (1989). Identification of a zinc finger protein that binds to the sterol regulatory element. Science 245,640 -643.[Abstract/Free Full Text]
Shawlot, W. and Behringer, R. R. (1995). Requirement for Lim1 in head-organizer function. Nature 374,425 -430.[CrossRef][Medline]
Shawlot, W., Wakamiya, M., Kwan, K. M., Kania, A., Jessell, T. M. and Behringer, R. R. (1999). Lim1 is required in both primitive streak-derived tissues and visceral endoderm for head formation in the mouse. Development 126,4925 -4932.[Abstract]
Shen-Li, H., O'Hagan, R. C., Hou, H., Jr, Horner, J. W., Lee, H. W. and DePinho, R. A. (2000). Essential role for Max in early embryonic growth and development. Genes Dev. 14, 17-22.[Abstract/Free Full Text]
Tam, P. P. and Beddington, R. S. (1992). Establishment and organization of germ layers in the gastrulating mouse embryo. Ciba Found. Symp. 165, 27-41.[Medline]
Tam, P. P. and Steiner, K. A. (1999). Anterior patterning by synergistic activity of the early gastrula organizer and the anterior germ layer tissues of the mouse embryo. Development 126,5171 -5179.[Abstract]
Thomas, P. and Beddington, R. (1996). Anterior primitive endoderm may be responsible for patterning the anterior neural plate in the mouse embryo. Curr. Biol. 6,1487 -1496.[CrossRef][Medline]
van Heumen, W. R., Claxton, C. and Pickles, J. O. (1997). Sequence and tissue distribution of chicken cellular nucleic acid binding protein cDNA. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 118,659 -665.[CrossRef][Medline]
Waldrip, W. R., Bikoff, E. K., Hoodless, P. A., Wrana, J. L. and Robertson, E. J. (1998). Smad2 signaling in extraembryonic tissues determines anterior-posterior polarity of the early mouse embryo. Cell 92,797 -808.[CrossRef][Medline]
Warden, C. H., Krisans, S. K., Purcell-Huynh, D., Leete, L. M., Daluiski, A., Diep, A., Taylor, B. A. and Lusis, A. J. (1994). Mouse cellular nucleic acid binding proteins: a highly conserved family identified by genetic mapping and sequencing. Genomics 24,14 -19.[CrossRef][Medline]
Yamamoto, M., Meno, C., Sakai, Y., Shiratori, H., Mochida, K., Ikawa, Y., Saijoh, Y. and Hamada, H. (2001). The transcription factor FoxH1 (FAST) mediates Nodal signaling during anterior-posterior patterning and node formation in the mouse. Genes Dev. 15,1242 -1256.[Abstract/Free Full Text]
Zoltewicz, J. S., Plummer, N. W., Lin, M. I. and Peterson, A. S. (1999). Oto is a homeotic locus with a role in anteroposterior development that is partially redundant with Lim1. Development 126,5085 -5095.[Abstract]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Raabe, S. Clemens-Richter, T. Twardzik, A. Ebert, G. Gramlich, and M. Heisenberg
Identification of Mushroom body miniature, a zinc-finger protein implicated in brain development of Drosophila
PNAS, September 28, 2004; 101(39): 14276 - 14281.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, W.
Right arrow Articles by Li, Y.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, W.
Right arrow Articles by Li, Y.-P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?