|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00375


1 Zebrafish Neurogenetics Junior Research Group, Institute of Virology,
Technical University-Munich, Trogerstrasse 4b, D-81675 Munich, Germany and
GSF-National Research Center for Environment and Health, Institute of
Developmental Genetics, Ingolstaedter Landstrasse 1, D-85764 Neuherberg,
Germany
2 Laboratory of Molecular Genetics, NICHD, NIH, Bethesda, MD 20892, USA
3 Department of Molecular, Cellular and Developmental Biology, University of
Michigan, Ann Arbor, MI 48109-1048, USA
Authors for correspondence (e-mail:
ebally{at}gsf.de
and
chitnisa{at}mail.nih.gov)
Accepted 8 January 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Zebrafish, Midbrain-hindbrain boundary, MHB, Neurogenesis, Her5, bHLH, E(spl), Hairy, Proliferation, Cyclin-dependent kinase inhibitor, p27
| INTRODUCTION |
|---|
|
|
|---|
A crucial and extensively studied domain of the anterior neural plate is
the midbrain-hindbrain (MH), which contains at the MH boundary (MHB) the
isthmic organizer, a critical regulator of MH growth and patterning
(Martinez, 2001
;
Rhinn and Brand, 2001
;
Wurst and Bally-Cuif, 2001
).
Strikingly, the MH is also characterized by a distinct pattern of neurogenesis
at early stages: mesencephalic and anterior rhombencephalic neurons are
separated by a neuron-free, transverse stripe of delayed differentiation
(hereafter referred to as `intervening zone', IZ), precisely located at the
level of the MHB. In the zebrafish, the IZ is identifiable from the onset of
neurogenesis, when it separates two of the earliest neuronal clusters, the vcc
and the presumptive motorneurons of rhombomere 2 (r2MN). The IZ is conspicuous
during neurogenesis of all vertebrates examined (see
Palmgren, 1921
;
Bally-Cuif et al., 1993
).
According to classical neuroanatomical studies
(Vaage, 1969
;
Vaage, 1973
), it corresponds
in the chick to a caudal `mesomere' which initially encompasses half the
midbrain but upon regression during development forms a narrow, neuron-free
stripe at the junction with the first rhombomere. Lineage analysis in the
zebrafish (A.T. and L.B.-C., unpublished) demonstrate that this is a dynamic
process where the IZ progressively contributes cells to adjacent territories
upon cell divisions. The zebrafish IZ also maintains a large population of
proliferating cells at larval stages, long past the time when proliferation
has ceased in adjacent neural domains
(Wullimann and Knipp, 2000
).
As such, the IZ has been proposed to play a crucial role in permitting the
growth and regionalization of MH structures over a long period
(Tallafuß and Bally-Cuif,
2002
). Understanding its formation is thus an important issue.
Several factors have been identified that positively define early
neurogenesis competence domains and proneural clusters within the embryonic
neural plate. Neuronal differentiation-promoting factors include members of
the Achate-Scute, Atonal, Gli and Iroquois families
(Allende and Weinberg, 1994
;
Fisher and Caudy, 1998
;
Cavodeassi et al., 2001
;
Davis and Turner, 2001
).
Neuroblasts that engage into the differentiation process are then selected
following similar genetic cascades to those originally defined in
Drosophila. In the zebrafish neurectoderm for example, Neurogenin1
(Ngn1) (Blader et al., 1997
;
Korzh et al., 1998
) drives the
expression of Delta homologues delta A (delA) and delta
D (Dornseifer et al.,
1997
; Appel and Eisen,
1998
; Haddon et al.,
1998
). delA, delD and ngn1 transcripts are
expressed by engaged but probably still proliferating neuronal precursors.
Delta then activates Notch in its neighboring cells, an inhibitory interaction
that allows only a subset of precursors within each proneuronal cluster to
become neurons. The selected neuronal precursors exit the cell cycle and begin
expressing genes characteristic of differentiating neurons, such as delB,
zcoe2, neuroD transcripts and Hu proteins, expressed by committed and no
longer proliferating cells (Bally-Cuif et
al., 1998
; Haddon et al.,
1998
; Korzh et al.,
1998
; Mueller and Wullimann,
2002
).
While a broad network of genes that positively instructs where neurons
differentiate has been identified in vertebrates, mechanisms that define where
neurons are not permitted to form remain less studied. To date, Hairy/Enhancer
of split [E(spl)]-like proteins (Davis and
Turner, 2001
) such as Xenopus ESR6e
(Chalmers et al., 2002
), and
Xenopus Zic2 (Brewster et al.,
1998
), have been identified as inhibitors but the role of their
homologs during neural plate development in other species remain unexplored.
In Drosophila, Hairy has a prominent role in inhibiting neurogenesis.
Unlike most transcription factors encoded by the E(spl) Complex, Hairy is a
Hairy/E(spl) transcription factor that is not driven by Notch activation,
rather it acts as a prepattern gene to define domains in the notum where
sensory bristles are not permitted to differentiate (Fischer and Caudy, 1998;
Davis and Turner, 2001
). A
related Hairy/E(spl) factor, Hes1, was shown to be necessary, together with
Hes3, for maintaining a neuron-free zone at the MHB at a relatively late stage
(E10.5) in the mouse embryo (Hirata et
al., 2001
). However these genes did not have an early role in the
establishment of the neuron-free zone. Thus, globally, the inhibitory
processes regulating neurogenesis in the vertebrate neural plate remain poorly
understood.
Using manipulated and mutant contexts in zebrafish, we first demonstrate that the establishment of the neuron-free zone (IZ) at the MHB is crucial to the maintenance of MHB integrity. We next report that expression of the zebrafish Hairy/E(spl)- like gene her5 at late gastrulation precisely prefigures the IZ, separating the vcc from r2MN. By combining knock-down and conditional gain of Her5 function in zebrafish transgenics, we demonstrate that Her5 is essential in vivo for inhibiting neurogenesis and increasing cell proliferation in a medial domain of the IZ, without influencing other aspects of MH patterning. Our results demonstrate that Her5 is part of a key regulatory process that links early axial patterning mechanisms to the spatial pattern of neurogenesis and cell proliferation within the vertebrate anterior neural plate.
| MATERIALS AND METHODS |
|---|
|
|
|---|
hsp-her5 transgenic lines
To construct hsp-her5 (Fig.
2D), the published coding sequence of her5
(Müller et al., 1996
)
flanked by the 5' and 3' UTR of Xenopus
ß-globin was extracted from
pXT7-her5
3'
(Bally-Cuif et al., 2000
) and
cloned downstream of pzhsp70
(Shoji et al., 1996
) in
pBluescript SK(+). Wild-type her5 encodes 9 additional N-terminal
amino acids (Fig. 2D) (A.T. and
L. B-C., unpublished) but both proteins are intact in their bHLH and further
C-terminal sequence. The
hsp-5'ßglob-her5-3'ßglob
insert (2.5 kb) was extracted from the vector backbone by SmaI +
ApaI digestion, resuspended in water and injected at 50 ng/µl into
freshly laid AB embryos. Injected embryos were raised to sexual maturity and
pair-wise crossed to AB fish. DNA was extracted from pools of 1- to 2-day-old
embryos by incubating for 3 hours at 60°C in 250 µl lysis buffer (10 mM
Tris-HCl pH 8.3, 1.5 mM MgCl2, 50 mM KCl, 3% Tween-20, 3% NP40; 1.5
mg/ml proteinase K). The samples, complemented with 750 µl H2O,
were heated at 95°C for 10 minutes and PCR reactions were carried out
using an upstream primer from the zebrafish hsp70 promoter sequence
(5' GTGGACTGCCTATGTTCATCT 3') and a downstream primer within the
her5 sequence (her5#2: 5' TTTCTCCATGAGAGGCTTGG
3') that yielded a 900 bp PCR product. For genomic DNA control the
following primers were used, which amplified the endogenous her5 cDNA
(her5#6: 5' AGTTCTTGGCACTCAAGCTCAA 3' and
her5#4AP: 5' GCTCTCCAAAGACTGAAAAGAC 3'). PCR was
performed with 5 µl of the diluted genomic DNA in 1x PCR buffer with
2.5 mM MgCl2, 2.5 mM of each primer and 0.2 mM dNTPs, for 35 cycles
at an annealing temperature of 56°C. Carrier G0 fish were re-crossed to
wild-type fish to test for expression of the transgene upon heat-shock: the
resulting embryos were submitted to a 1-hour heat-shock pulse before the 24
hpf stage and tested in whole-mount using situ hybridisation for ubiquitous
her5 expression. G0 carriers transmitting inducible hsp-her5
were then crossed to wild-type fish and the F1 generation was
raised. F1 carriers were identified by PCR on tail genomic DNA.
From more than 100 injected embryos, the integration rate in the G0 generation
was 15%, of which 50% transmitted the transgene to their progeny. The
transgene was inducible in a ubiquitous fashion upon heat-shock in 50% of
these families.
|
|
RNA injections
Capped RNAs were synthesized using Ambion mMessage mMachine kits following
the recommended procedure. RNAs were injected at the following concentrations:
25 ng/µl (low dose) or 125 ng/µl (high dose) ngn1
(Blader et al., 1997
), with or
without nls-lacZ (40 ng/µl) as lineage tracer.
In situ hybridization and immunohistochemistry
Probe synthesis, in situ hybridization and immunohistochemistry were
carried out as previously described
(Hammerschmidt et al., 1996
).
The following antibodies were used: mouse anti-myc (Sigma M 5546) (dilution
1:1000), rabbit anti-ß-galactosidase (Cappel 55976) (dilution 1:4000),
rabbit anti-phosphohistone H3 (Upstate Biotechnology, no. 06-570) (dilution
1:200), mouse anti-HNK1 (DSHB Zn12) (dilution 1:500), mouse anti-human
neuronal protein HuC/HuD (MoBiTec A-21271) (dilution 1:300). Secondary
antibodies HRP-conjugated goat anti-mouse or goat anti-rabbit antibody
(Jackson ImmunoResearch Laboratories) diluted to 1:200. The staining was
revealed with DAB following standard protocols.
Cloning of zebrafish Cdk inhibitor-encoding cDNAs
Random-primed cDNA prepared from 15-somite AB zebrafish RNA was amplified
using oligonucleotides directed against cDNA AF398516 (forward primer:
5' TCCGCTTGTCTAATGGCAGCC 3'; reverse primer: 5'
CACTTCATCCACACAGATGTGC 3'), and EST BI887574 (forward primer: 5'
CAAGCATCT GGAGCGTCATGTTG 3'; reverse primer: 5'
TAACGGCGTTCATCCTGCTCCG 3'). PCR products were subcloned and sequenced
according to standard protocols. EST fx62e01.y1 was obtained from the rzpd
(Berlin). All subclones were used for the generation of in situ hybridization
probes following standard procedures. Sequence analyses revealed that the
three clones encode CDI domain-containing proteins, characteristic of Cdk
inhibitors. The CDI domains of BI887574 and fx62e01.y1 are 60% identical to
each other and most related to that of Xenopus p27XIC1
(53-56% identity). They are equally distant from the CDI domain of AF398516
(45% identity). The CDI domain of AF398516 is itself is more related to that
of mammalian p27Kip1 (56-59% identity) than to Xenopus
p27XIC1 (46% identity). Based on these findings, and on the fact
that BI887574 is expressed earlier than fx62e01.y1 (see text), we re-named
BI887574 zebrafish p27Xic1-a.
Aphidicolin treatments
Embryos were incubated for 2 hours (from 70% epiboly to the 3-somite stage)
[compared to an estimated 4-hour cell cycle length at this stage in the neural
plate (Kimmel et al., 1994
)]
in embryo medium containing 1 or 10 µg/ml aphidicolin (Sigma A-9914) at
28.5°C (Marheineke and Hyrien,
2001
). The embryos were then washed in embryo medium, fixed and
processed for in situ hybridization and immunodetection.
| RESULTS |
|---|
|
|
|---|
|
Because the IZ develops at the MHB, we explored whether and to what extent IZ formation relates to and/or is required for isthmic organizer activity. We observed that ectopic expression of ngn1 does not generally impair the establishment of MH identity (as revealed by eng2, her5 or pax2.1 expression) at early somitogenesis stages (not shown). At 24 hpf however, the expression of MHB markers such as wnt1 and pax2.1 was abolished upon injection of ngn1 mRNA (Fig. 1G-J). Thus forced neurogenesis within the IZ eventually interfered with maintenance of genes that define MHB identity, suggesting that inhibition of Ngn1 expression and function may be necessary to maintain MHB identity and/or continued function of the isthmic organizer.
headless (hdl) mutants, characterized by reduced
repression of Wnt target genes by Tcf3, have expanded expression of genes that
define MHB identity (Kim et al.,
2000
). We observed that this phenotype correlates with an
expansion of the ngn1-free domain in the MH
(Fig. 1K,L).
Together, these results suggest that IZ formation depends on the combination of two antagonistic cues: positive neuronal differentiation signals, and an opposite inhibitory activity that is spatially associated with the isthmic organizer. In addition, they demonstrate that suppression of neurogenesis at the MHB is crucial to the maintenance of MHB integrity.
her5 expression at the onset of neurogenesis is sufficient
to prevent neurogenesis around the MHB
The above results suggest that factors expressed at the MHB in response to
early anteroposterior patterning cues may actively contribute to the local
suppression of neurogenesis. Among those factors, Her5 appeared to be a good
candidate to encode the anti-neurogenic influence spatially associated with
the MHB. First, it is the earliest selective marker of the MH domain, and its
expression precedes the onset of neurogenesis
(Müller et al., 1996
;
Bally-Cuif et al., 2000
).
Second, it belongs to the Hairy/E(spl) family of bHLH transcription factors,
which generally orient cell fate decisions during development
(Kageyama et al., 1997
;
Fisher and Caudy, 1998
;
Guillemot, 1999
). In support
of our hypothesis, we found that her5 expression faithfully outlines
the IZ from the onset of neurogenesis at late gastrulation
(Fig. 2A) until at least 24 hpf
(compare Fig. 2B and C).
To examine the potential role of Her5 in IZ formation, we first used a
gain-of-function approach. Ectopic expression of her5 severely
perturbs gastrulation (Bally-Cuif et al.,
2000
), precluding an unambiguous interpretation of a neural
phenotype at late stages. To overcome this problem we constructed
hsp-her5 transgenic lines carrying the her5 cDNA
(Müller et al., 1996
)
under control of the zebrafish heat-shock promoter zhsp70
(Shoji et al., 1996
;
Halloran et al., 2000
)
(Fig. 2D). Three independent
hsp-her5 lines were generated. Because they produced similar results,
they are considered together below.
We tested the reliability of hsp-driven transcription in these
lines by monitoring her5 expression in transgenic embryos immediately
before and after heat-shock. At all stages examined, all embryos originating
from a cross between a hsp-her5 heterozygote and a wild-type fish
displayed the endogenous her5 expression profile
(Fig. 3A). Upon heat-shock,
strong and ubiquitous expression of her5 was observed in 50% of the
embryos (Fig. 3B), thus
hsp-driven transcription is only induced upon heat-shock in our
lines. In a time-course assay, transgenic her5 mRNA, revealed by
whole-mount in situ hybridization, was detectable as soon as 15 minutes after
the beginning of the heat-shock but was gradually lost within the 1.5 hours
following its end (Fig. 3C).
These results are comparable to those of Scheer et al.
(Scheer et al., 2002
) and
indicate that a heat-shock pulse translates into a narrow time-window when
transgene her5 mRNAs are available for translation.
Heat-shock pulses between 80% epiboly and tail-bud stages resulted in severe defects of ngn1 expression in most hsp-her5 transgenic embryos by the 3-somite stage (85% of cases, n=30) (Fig. 3E). Strikingly, ngn1 expression was strongly diminished in some cases abolished in territories normally giving rise to the vcc and r2MN, located immediately adjacent to the domain of endogenous her5 expression (Fig. 2A) (compare Fig. 3E with D). Other sites of neurogenesis, such as the motor, sensory and interneurons of the developing spinal cord or the trigeminal ganglia, were only marginally affected, if at all. In contrast, ngn1 expression was not affected when transgenic embryos were injected, prior to heat-shock, with a morpholino selective for the hsp-her5 transgene (MOtg) (Fig. 2D). This morpholino has no effect on the translation of endogenous her5 and does not affect embryonic development (see Materials and Methods). Thus, heat-shocked hsp-her5 MOtg-injected transgenic embryos (80% of cases, n=20) showed normal ngn1 expression (Fig. 3F, compare with Fig. 3D and E), demonstrating that the inhibition of ngn1 expression in the vcc and r2MN areas upon her5 misexpression (Fig. 3E) is a selective consequence of ectopic Her5 activity.
To test whether ectopic her5 mRNA provided at late gastrulation is sufficient to permanently inhibit ngn1 expression in domains adjacent to the IZ, we heat-shocked embryos under the conditions described above, then resumed development at normal temperature and analyzed ngn1 expression at the 20-somite stage. As hsp-driven her5 mRNA is no longer detectable at this stage, transgenic embryos were identified a posteriori by PCR genotyping (Fig. 3I). We observed long-lasting inhibition of ngn1 expression, which was still downregulated at the 20-somite stage around and within the MH (83% of cases, n=28) (bar in Fig. 3H, compare with G). Later, this phenotype was followed by a lack of neuronal differentiation: at 24 hpf, hsp-her5 transgenic embryos harbored a significantly reduced number of differentiated vcc-derived nMLF neurons (identified by their HNK1 immunoreactivity) compared to non-transgenic heat-shocked siblings (73% of cases, n=15) (brown arrows in Fig. 3O, compare with N). Thus ectopic Her5 activity at the onset of neurogenesis is sufficient to inhibit ngn1 expression and the subsequent steps of neuronal differentiation around and within the MH domain.
Her5 activity is necessary for IZ formation at early neurogenesis
stages
To test whether Her5 activity was necessary for IZ formation, we
`knocked-down' her5 translation by injecting a morpholino selective
for endogenous her5 (MOher5) into wild-type embryos
(Fig. 2D, see Materials and
Methods). Strikingly, when MOher5-injected embryos were assayed at
the 3-somite stage for ngn1 expression, no IZ was discernible in the
medial MH domain: the vcc and r2MN clusters were bridged (84% of cases,
n=19) (compare Fig. 3K with
J). TUNEL assays performed between the normal onset of
her5 expression (70% epiboly) and the 3-somite stage consistently
failed to reveal a significant difference in the number of apoptotic cells at
any site between wild-type and MOher5-injected embryos
(Fig. 3L,M, and data not shown)
(92% of cases, n=25). In contrast, cell counts indicated a large
increase in the number of ngn1-expressing cells within the medial MH
territory in MOher5-injected embryos (91 cells ±5) compared
to wild-type siblings (48 cells ±4) (90% of cases, n=10).
Thus, lack of Her5 activity results in the generation of ectopic
ngn1-positive cells in the territory located between the vcc and r2MN
clusters. Importantly, this phenotype was followed by the development of
ectopic differentiated neurons at later stages: in most cases (67% of cases,
n=12), bilateral clusters of HNK1-positive neurons formed across the
MHB in MOher5-injected embryos by 36 hpf, but not wild-type embryos
(brown arrows in Fig. 3Q,
compare with P and N). Together, our results demonstrate that Her5 is both
necessary and sufficient for inhibition of neurogenesis in the medial MHB
domain at the onset of neurogenesis, an activity that helps keep the MHB free
of differentiated neurons during later development.
Her5 can act in a dose-dependent manner on newly selected neuroblasts
to inhibit neurogenesis at least until 24 hpf
Because her5 expression delineates the IZ until at least 24 hpf,
we tested whether it might also be involved in inhibiting neurogenesis at
these late stages. When hsp-her5 transgenic embryos were heat-shocked
for 2 hours at the 8- or 15-somite stages, ngn1 expression was
down-regulated across the entire neural plate
(Fig. 4A-C,G,I), in a
dose-dependent fashion (86% of cases, n=22) (data not shown, and
compare Fig. 4B and C). Within
and around the MH domain, this phenotype was stable over time
(Fig. 4D,E), while in other
territories, ngn1 expression was restored within a few hours of
development at normal temperature (data not shown, and blue arrows in
Fig. 4E) (87% of cases,
n=24). When ectopic Her5 activity was induced at 24 hpf,
ngn1 expression was decreased within the MH domain (77% of cases,
n=18) (compare Fig. 4K and
J), while other sites remained unaffected (blue arrows in
Fig. 4K). Thus Her5 activity is
capable of inhibiting neurogenesis throughout somitogenesis.
|
Her5 activity is not involved in patterning events within the MH
domain
Because her5 expression coincides with a number of markers that
define MH identity or the MHB (Lun and
Brand, 1998
; Reifers et al.,
1998
; Belting et al.,
2001
; Reim and Brand,
2002
), we asked whether Her5 activity is involved in controlling
aspects of MH regionalization. Strikingly, ectopic her5 expression
from the onset of endogenous MH her5 expression (70% epiboly) in
hsp-her5 transgenic embryos had no detectable effect on the
expression of MH patterning markers (iro1, iro7, pax2.1, eng2, eng3)
or IsO activity markers (wnt1, fgf8) at the 5- and 15-somite stages
(n=35; Fig. 5A-C, also
data not shown). Because a single short heat-shock pulse might induce only a
transient burst in Her5 activity, insufficient to trigger stable defects, we
repeatedly heat-shocked hsp-her5 embryos until 24 hpf. Again, even in
these embryos that received a constant supply of ectopic her5 mRNAs,
no patterning defects were detected (n=25;
Fig. 5D, also data not shown),
although strong and ubiquitous ectopic expression of her5 was
achieved (Fig. 5D, red
staining). These results indicate that ectopic expression of her5
from late gastrulation onwards is not capable of altering neural
patterning.
|
Her5 activity regulates cell proliferation and the expression of the
zebrafish cyclin-dependent kinase inhitor-encoding gene
p27Xic1-a
We next examined the cellular mode of Her5 action. Neuronal differentiation
generally correlates with cell cycle exit
(Ross, 1996
;
Ohnuma et al., 2001
)
suggesting that Her5 activity might be associated with the maintenance of a
proliferating state. To test this hypothesis, we counted the number of
dividing cells per cell row (phosphohistone H3-immunoreactive, indicating M
phase) across the neural plate in wild-type and Her5-manipulated contexts at
the onset of neurogenesis (Fig.
6A-F).
|
In hsp-her5 transgenic embryos that were heat-shocked during late gastrulation, the number of cells in M phase was significantly increased throughout the presumptive midbrain and hindbrain regions (Fig. 6A, A-D domains). This included the domain endogenously expressing her5 (Fig. 6A, A and B domains) as well as the 16 cell rows immediately anterior and posterior to it (Fig. 6A, C and D domains), from which the vcc and r2MN originate (Fig. 6B, C and Fig. 6F, left panel) (n=5). In the presumptive forebrain (Fig. 6A, E domain) the number of dividing cells was not altered, although this area also prominently expressed her5 (Fig. 6C). Conversely, in MOher5-injected embryos, the number of dividing cells was significantly and selectively reduced in domain A (Fig. 6D, E; Fig. 6F, left panel) (n=5). Proliferation in this domain was not abolished but rather brought to a level equivalent to other neural plate territories (Fig. 6F). Together, these results suggest that Her5 activity can influence cell proliferation within and around the MH domain, and that it specifically accounts for the increased number of dividing cells within the medial IZ. In addition, Her5 loss-of-function results point to a strict correlation between domains with a decrease in cell proliferation and an increase in neuronal differentiation.
Cell proliferation involves the tight spatiotemporal control of expression
and activity of a number of cellular factors including the cyclin-dependent
kinases (Cdk) inhibitors p27 and p57
(O'Farrell, 2001
;
Ohnuma et al., 2001
). Among
these, p27Xic1 (Bourguignon et
al., 1998
; Ohnuma et al.,
1999
), its mammalian relative p27Kip1
(Lyden et al., 1999
;
Levine et al., 2000
;
Dyer and Cepko, 2001
;
Li et al., 2002
) and
p57Kip2 (Dyer and Cepko,
2000
) play prominent roles in the control of developmental
neurogenesis downstream of neurogenic cascades in Xenopus and mouse.
To identify potential downstream effectors of Her5 proliferative activity, we
conducted database searches for zebrafish Cdk inhibitors-encoding genes. Three
clones or ESTs encoding probable zebrafish homologs of p27Kip1 and
two closely related forms of p27Xic1 (-a and -b) were recovered
(see Materials and Methods), and the corresponding genes were PCR-amplified
from tail bud-stage cDNA. In situ hybridization analyses revealed that only
p27Xic1-a was expressed in wild-type embryos at the onset
of neurogenesis (Fig. 6G,I,
also data not shown). Most interestingly, p27Xic1-a
expression strongly resembles that of ngn1, identifying the first
primary neurons of the neural plate and avoiding the IZ
(Fig. 6G,I). This expression
profile is compatible with a role in linking cell cycle arrest with the
differentiation of primary neurons. We thus addressed whether
p27Xic1-a expression was modulated by Her5 activity. Upon
a brief heat-shock at late gastrulation, p27Xic1-a
expression was severely down-regulated in hsp-her5 transgenic
embryos, while it was unaffected in heat-shocked wild-type siblings (80% of
cases, n=20; Fig.
6G,H). Conversely, in embryos where Her5 activity was abolished,
p27Xic1-a expression expanded ectopically across the IZ,
overlapping the unaffected expression of pax2.1 (82% of cases,
n=22; Fig. 6I,J).
Thus, modulating Her5 activity triggers opposite effects on cell proliferation
and p27Xic1-a expression. This suggests that
down-regulation of p27Xic1-a expression by Her5 might be
involved in mediating the Her5-effected higher cell proliferation of the
medial IZ domain in wild-type embryos.
To determine whether Her5-induced effects on neurogenesis and proliferation are causally linked, we assessed neurogenesis in embryos where cell proliferation was blocked. To block cell proliferation, we incubated wild-type embryos in aphidicolin from the onset of her5 expression until early neurogenesis. Although this treatment virtually abolished cell division (Fig. 6K-N, phosphoH3 staining), it had no effect on ngn1 (n=20; Fig. 6L) or her5 (n=20; Fig. 6N) expression. Thus the activation of cell proliferation by Her5 is not an intermediate step in its inhibition of ngn1 expression across the IZ. Conversely, our results demonstrate that enhanced Her5 activity in hsp-her5 transgenics can further upregulate cell proliferation within the endogenous her5-positive territory (Fig. 6F, left panel, A+B domain), which is devoid of ngn1 expression and neurogenesis at all stages. Thus, at least within the IZ, the inhibition of ngn1 expression by Her5 is unlikely to be an intermediate step in its activation of cell proliferation. Together, these results suggest that the regulation of neurogenesis and cell proliferation across the medial IZ in vivo reflect two parallel but distinct activities of endogenous Her5.
| DISCUSSION |
|---|
|
|
|---|
Differential competence of the MH junction towards neurogenesis
A first conclusion of our findings is that the IZ is not a homogeneous
territory but is composed of two subdomains that differ strikingly both in
their proliferation properties and in their competence to undergo
neurogenesis. The medial IZ exhibits a single block in the differentiation
pathway, encoded by Her5 activity, while the dorsolateral IZ likely bears
multiple blocks, one operating upstream of ngn1 expression, and at
least one operating downstream or in parallel to this step. These intrinsic
differences are unlikely to reflect general lateral versus medial properties
of the entire neural plate, since neurons develop elsewhere in lateral domains
at the same time as in basal territories (for instance the sensory neurons of
r2). They might be due to other local inhibitors redundant to Her5 function in
the laterodorsal territory. The transcriptional inhibitors Eng2 and 3
(Ekker et al., 1992
), also
expressed within the IZ from the onset of neurogenesis
(Lun and Brand, 1998
), do not
appear to be sufficient cofactors. Indeed their ectopic expression is capable
of inhibiting ngn1 expression within the MH, however blocking the
activities of Her5, Eng2 and Eng3 together by co-injecting the relevant
morpholinos does not extend the neurogenic phenotype triggered by the lack of
Her5 activity alone (M.I. and A.C., unpublished). Other candidates might be
found within antagonists to neurogenic bHLH proteins, such as Hairy/E(spl) or
non-basic HLH factors (A.T. and L.B.-C., unpublished), or among factors
related to known neurogenesis inhibitors such as Zic2
(Brewster et al., 1998
). The
combined use of multiple inhibitors to locally prevent neurogenesis has been
postulated to explain the non-differentiation of the superficial ectoderm
layer in Xenopus (Chalmers et
al., 2002
). Our results thus provide a new example of this
strategy to delimit neuronal differentiation domains during neural plate
development.
An intriguing aspect of the phenotype triggered by Her5 gain-of-function is
its prominence around and within the MH domain
(Fig. 3E,H and
Fig. 4), suggesting the
presence of local cofactors. These might act on the regulatory elements of
ngn1 or of genes encoding redundant proneural factors to potentiate
Her5 activity, or might behave as partners of Her5 to reinforce its activity
and/or the stability of the Her5 protein. In favor of these ideas, the
ngn1 enhancer contains an element driving expression preferentially
within the MH domain (Blader et al.,
2003
). In addition, we found that a mutant form of Her5, deleted
of its C-terminal Groucho-binding WRPW domain, was inactive in regulating
ngn1 expression (A.G. and L.B.-C., unpublished), suggesting that
Groucho-like cofactors are necessary to Her5 function. Along this line,
groucho4 is selectively expressed within the MH domain in the mouse
and chick (Sugiyama et al.,
2000
; Ye et al.,
2001
).
Her5 activity shapes the midbrain-hindbrain neurogenesis pattern
Her5 acts in vivo as a local inhibitor of neurogenesis at the MHB. Our
findings suggest that in the basal MH area, neurogenesis is primarily shaped
into a pattern of separate neuronal clusters by a process of local inhibition
that likely splits a continuous MH proneural field. Recent studies in
Xenopus brought to attention the role of neurogenesis inhibitors in
organizing zones of differentiation within the neural plate
(Bourguignon et al., 1998
;
Brewster et al., 1998
;
Chalmers et al., 2002
). Our
analysis of IZ formation illustrates how neurogenesis inhibitors, superimposed
on differentiation-competent territories, are crucial elements in shaping the
embryonic neurogenesis pattern in vertebrates.
MOher5-injected embryos display ectopic neurogenesis across the medial IZ from the very onset of ngn1 expression (Fig. 3K), demonstrating that Her5 activity is essential to the establishment of this neuron-free zone. Whether Her5 is also
involved in medial IZ maintenance at later stages cannot be directly
concluded from our loss-of-function data. Such a role, however, would be in
line with the observation that her5 expression continues to define
the neuron-free area untill the 24 hpf stage and that ectopic her5
expression can prevent neurogenesis within the MH domain at least until 24 hpf
(Fig. 4). In the mouse, IZ
maintenance relies on the combined action of two other Hairy/E(spl) bHLH
factors, Hes1 and Hes3 (Hirata et al.,
2001
), which separately inhibit neurogenesis in a number of
instances in vivo (Ishibashi et al.,
1994
; Ishibashi et al.,
1995
; Ohtsuka et al.,
1999
):
Hes1/;Hes3/
double-mutant embryos display premature neuronal differentiation across the MH
junction from late somitogenesis (E10.5)
(Hirata et al., 2001
). No
earlier neurogenic phenotype was detected in these embryos, however,
suggesting that Hes1 and Hes3, unlike zebrafish Her5, are not involved in IZ
generation. These observations are in keeping with the relatively late onset
of Hes1 and Hes3 expression within the MH domain (Lobe et
al., 1997; Allen and Lobe,
1999
; Hirata et al.,
2001
), and with the observation that Hes1 and Hes3 are more
related in sequence to zebrafish Her6 and Her3 than to Her5. Whether Her5
function is, all or in part, relied on by other Her factors at late stages to
maintain medial IZ development in the zebrafish will require further
study.
Her5 effectors in the control of MH neurogenesis
Her5 belongs to the Hairy/E(spl) class of bHLH transcription factors,
generally functioning as transcriptional repressors (see
Kageyama et al., 1997
; Fischer
and Caudy, 1998; Davis and Turner,
2001
). Indeed, we demonstrated previously that Her5 functions as
an inhibitor of transcription during a first developmental cell fate choice
event required for endoderm patterning
(Bally-Cuif et al., 2000
). The
direct targets of Hairy/E(spl) factors remain largely unknown outside of
achate-scute-related genes (Chen
et al., 1997
) and some instances of autoregulation
(Takebayashi et al., 1994
).
Our results demonstrate that a rapid response to manipulating Her5 activity is
the regulation of ngn1 expression. Thus the most parsimonious
interpretation of Her5 function is that it directly inhibits the transcription
of ngn1. Alternatively, Her5 might primarily inhibit expression (or
activity) of upstream proneural factors such as those belonging to the Ash or
Ath bHLH familes. Several such factors have been isolated in the zebrafish
(Allende and Weinberg, 1994
;
Masai et al., 2000
;
Itoh and Chitnis, 2001
), but
their expression in the early neural plate was not reported. Addressing this
point will be an important issue.
Her5 might also act at other steps of the neurogenic cascade, but our
results indicate that the time-window of Her5 action is limited. Upstream of
ngn1 expression are the specification of the MH proneural field
(possibly by Iro1 and 7) (Lecaudey et al.,
2001
; Itoh et al.,
2002
), the definition of proneural clusters and the singling-out
of individual precursors by the Notch-dependent lateral inhibition process
(Haddon et al., 1998
;
Lewis, 1998
;
Chitnis, 1999
;
Takke et al., 1999
). An action
of Her5 at any of these upstream steps is unlikely. First, knocking-down Her5
activity has no effect on the expression of markers of the MH proneural fields
or clusters (Fig. 5D and data
not shown). In contrast, perturbing Iro function affects her5
expression (M.I. and A.C., unpublished), placing her5 downstream of
these factors. Second, manipulating the lateral inhibition machinery, and in
particular suppressing Notch signaling, did not affect IZ formation (A.G. and
L.B.-C., unpublished), arguing against a role for Her5 upstream of Notch
signaling. Further, Her5 does not act far downstream of ngn1
expression in the neurogenic cascade, as expression of the post-mitotic marker
HuC protein (Mueller and Wullimann,
2002
) was never reversed upon ectopic Her5 activation
(Fig. 4). In the same
individuals, ngn1 expression was virtually abolished. Thus our
results support a role for Her5 in regulating the expression (or activity) of
proneural factors at a level equivalent to Ngn1 in the neuronal
differentiation process.
An important question is, to what extent the mechanism regulating
neurogenesis at the MHB differs from those operating elsewhere in the neural
plate. All studied bHLH neurogenesis inhibitors in the vertebrate central
nervous system act as downtream effectors of Notch activity, with the
exception of Xenopus HES6 and mouse Hes3. Her5 joins these exceptions
as both its expression and activity within the neural plate are independent of
Notch signaling in vivo (A.G. and L.B.-C., unpublished). Within the neural
plate, Her5 expression and function appear more reminiscent of those of
Drosophila Hairy than of other vertebrate Hairy/E(Spl) factors known
to date. Indeed Hairy operates independently of Notch signaling and is
involved in pre-patterning broad non-differentiation zones within the
Drosophila notum, prior to the onset of neurogenesis (Fischer and
Caudy, 1998; Davis and Turner,
2001
). Similarly, mouse Hes1 was proposed to negatively delimit
neurogenesis domains within the olfactory epithelium
(Cau et al., 2000
). Her5
appears as the first vertebrate Hairy/E(spl) factor with similar function
within the neural plate, and it will be interesting to determine whether our
findings can be extended to other family members.
Proliferation and neurogenesis at the MH junction
Two classes of G1 CyclinD:Cdk inhibitors play a prominent role in a
developmental context: p16, and the Cip/Kip family members p21, p27 and p57
proteins (O'Farrell, 2001
;
Ohnuma et al., 2001
;
Ho and Dowdy, 2002
). Zebrafish
p27Xic1-a expression is negatively regulated by Her5
activity, adding strong support to the idea that Cdk inhibitors control
spatiotemporally regulated cell cycle events during embryogenesis and are, at
least in part, controlled themselves at the transcriptional level (see
Dyer and Cepko, 2000
;
Dyer and Cepko, 2001
;
Hardcastle and Papalopulu,
2000
; Levine et al.,
2000
; Ohnuma et al.,
1999
; Ohnuma et al.,
2001
). Our findings strongly suggest that the transcriptional
inhibition of p27Xic1-a is a downstream event of Her5
activity in its activation of cell proliferation within the medial IZ. Her5
thus appears reminiscent of mammalian Hes1 and 3, which inhibit the expression
of Cip/Kip family members in vitro (Kabos
et al., 2002
), and it is possible, like for other Hes factors
(Sasai et al., 1992
;
Kageyama et al., 1997
;
Hirata et al., 2000
;
Pagliuca et al., 2000
), that
p27Xic1-a is a direct transcriptional target of Her5.
However, our data also suggest that additional cell cycle regulators are
responsive to Her5 activity in this domain, since an increased dose of Her5 at
the MHB further enhances cell proliferation in hsp-her5 transgenics
compared to wild-type embryos while this domain does not express
p27Xic1-a.
In its regulation of cell proliferation, Her5 does not appear as an all-or-none switch, but rather as a modulator. Indeed a basal level of proliferation is maintained in the absence of Her5 activity within the medial IZ. In addition, the laterodorsal IZ, which also expresses her5, does not proliferate at a higher rate than other neural plate domains. Several hypotheses might account for these observations. Her5 might act as a permissive factor that enhances the competence of its expressing cells towards extrinsic or intrinsic proliferation triggers. Alternatively, Her5 might alter the length of cell cycle phases to shorten those where cells are responsive to differentiation signals. Finally, Her5 might not act on the cell cycle per se but rather orient cell divisions towards a symmetrical mode at the expense of an asymmetrical one.
Finally, our results suggest that the effects of Her5 on cell proliferation
and neurogenesis are distinct. In hsp-her5 transgenics, increased
Her5 activity upregulates proliferation even at the MHB, a neurogenesis-free
territory. Conversely, blocking cell proliferation does not induce
ngn1 expression at the MHB. Thus, the activation of proliferation by
Her5 is not simply a consequence, and is also unlikely to be an upstream step,
of its inhibition of neurogenesis. Rather, our results support a model where
these two processes are, at least in part, independently regulated by Her5
activity in vivo. Her5 would thus appear as a coordinator of cell division and
neuronal differentiation within the MH domain, in a manner reminiscent of the
key regulator XBF-1 within the Xenopus anterior neural plate
(Hardcastle and Paplopulu,
2000
). A striking and relevant example is also provided by the
bifunctional Xenopus protein p27Xic1, which uses separate
molecular domains to regulate both cell cycle and cell differentiation in the
retina (Ohnuma et al.,
1999
).
Linking patterning, neurogenesis and proliferation at the MHB
Patterning of the MH domain relies on two series of components, IsO-derived
signals (e.g. Wnts and Fgfs) and general MH identity factors (e.g. Pax2/5/8
and Eng proteins) (Martinez et al., 2001;
Rhinn and Brand, 2001
;
Wurst and Bally-Cuif, 2001
).
The expression of markers of both types was reproducibly unaltered at any
stage in response to gain- and loss-of-function of Her5, under conditions that
influenced MH neurogenesis and proliferation. Her5 activity thus strikingly
differs from that of its probable Xenopus homolog XHR1
(Shinga et al., 2001
) and from
mouse Hes1/Hes3 (Hirata et al.,
2001
), all of which were interpreted as primarily acting on MH
patterning. Ectopically expressed XHR1 markedly enhances En2
expression, and its dominant-negative forms down-regulated XPax2 and
En2 in Xenopus (Shinga
et al., 2001
). Similarly, in double
Hes1/;Hes3/
mouse mutant embryos, the loss of organizer-specific gene expression such as
Pax2, Wnt1 and Fgf8 precedes neuronal differentiation
defects (Hirata et al., 2001
).
her5 expression is established by early axial patterning cues, and
later responds to isthmic organizer activity
(Lun and Brand, 1998
;
Reifers et al., 1998
;
Belting et al., 2001
;
Reim and Brand, 2002
). Our
results show that Her5 selectively controls neurogenesis and proliferation
without retroacting on MH patterning. Thus Her5 is part of a key coupling
pathway activated at the MHB to translate early axial patterning and later
isthmic organizer information into a local control of neurogenesis and
proliferation.
At early somitogenesis stages, the isthmic organizer controls MH patterning
and growth (Martinez, 2001
;
Rhinn and Brand, 2001
;
Wurst and Bally-Cuif, 2001
).
Later, the MHB remains a prominent source of proliferating cells
(Wullimann and Knipp, 2000
),
proposed to permit the massive and sustained growth of MH structures relative
to other neural territories in all vertebrates. Our findings demonstrate that
maintenance of an MHB neuron-free zone results from an active mechanism, and
further attests the biological significance of this process for MH
development, by demonstrating that neurogenesis must be prevented at the MHB
to maintain MHB integrity. The inhibitory process involving Her5 might perhaps
speculatively be viewed as a self-protective mechanism permitting the
maintenance of MHB activity over time, in a manner possibly reminiscent of
other signaling boundaries, such as, for instance the Drosophila wing
margin.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|