|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00419
1 Center for Basic Neuroscience, University of Texas Southwestern Medical
Center, Dallas, TX 75390-9111, USA
2 Developmental Biology Program, Memorial Sloan-Kettering Cancer Center, New
York, NY 10021, USA
* Author for correspondence (e-mail: jane.johnson{at}utsouthwestern.edu)
Accepted 30 January 2003
| SUMMARY |
|---|
|
|
|---|
Key words: bHLH transcription factors, Transcriptional regulation, Transcription repressors, Chick electroporation, Dorsal spinal cord development, Neuronal differentiation, Math1/Cath1, Mash1/Cash1, Ngn1, Ngn2
| INTRODUCTION |
|---|
|
|
|---|
The bHLH factor Math1 is expressed transiently in proliferating neural
precursors in multiple domains of the developing murine nervous system,
including the dorsal hindbrain and neural tube, hair cells of the vestibular
and auditory systems, mechanoreceptor (Merkel) cells of the hairy skin, and
the cells of the external granule layer of the developing cerebellum
(Akazawa et al., 1995
;
Ben-Arie et al., 2000
;
Ben-Arie et al., 1996
;
Helms and Johnson, 1998
).
Analysis of the Math1 gene has identified two discrete
500 bp
sequences 3' of the Math1-coding sequence that exhibit
significant homology to sequences flanking the human ortholog HATH1
(ATOH1 Human Gene Nomenclature Database)
(Helms et al., 2000
). These
sequence domains are sufficient to direct heterologous lacZ reporter
activity to domains of native Math1 expression in transgenic mice.
The activity of the Math1 enhancer in transgenic mice requires both a
conserved E-box (binding site for bHLH factors) and Math1 expression
(Helms et al., 2000
). Similar
autoregulation has been reported for the Drosophila homolog
atonal (Sun et al.,
1998
) and a related chick gene CATH5
(Matter-Sadzinski et al.,
2001
). Thus, sustained expression of Math1, as with its
homologs, appears dependent on previous Math1 expression. Little is
known, however, about other factors controlling Math1 expression.
Initiation of Math1 expression appears to be dependent on BMP
signaling from the roof plate. Ablation of the roof plate in mouse embryos
resulted in the absence of multiple dorsal markers, including Math1
(Lee et al., 2000
). In naive
neural tube explants, application of BMP factors induced Math1
expression (Alder et al.,
1999
). In chick neural tube, expression of constitutively active
BMP receptor results in increased Math1 expression
(Timmer et al., 2002
). The
direct effectors of regulation of Math1 expression by BMP signaling
are unknown.
In a screen to isolate factors involved in the regulation of Math1
expression, we have identified Zic1, a zinc-finger transcription factor that
is also induced by BMPs in the neural tube
(Alder et al., 1999
;
Aruga et al., 2002b
;
Aruga et al., 1994
). It belongs
to a family of related proteins including Zic2, Zic3, Zic4 and Zic5, all of
which share homology to the Drosophila gene odd paired
(Aruga et al., 1996a
;
Aruga et al., 1996b
;
Nakata et al., 2000
), in
addition to weaker homology to the Gli family of vertebrate genes and their
Drosophila homolog cubitus interruptus
(Aruga et al., 1994
).
Loss-of-function and gain-of-function studies with Zic factors in the neural
tissue of Xenopus, mouse, and chicken have suggested that Zic1
inhibits neuronal differentiation and maintains cells as progenitors
(Aruga et al., 2002b
;
Brewster et al., 1998
;
Kuo et al., 1998
;
Mizuseki et al., 1998
).
Although Zic1 and Math1 are both expressed in the dorsal neural tube, and both
are induced in response to BMP signaling, we have found that high expression
of Zic1 and Math1 occurs only in distinct cells. We demonstrate that in the
chick neural tube Zic1 represses Math1 expression. This repression blocks
Math1 auto-activation and inhibits bHLH induced neuronal differentiation.
Thus, BMP signaling induces both Zic1
(Aruga et al., 2002b
) and Math1
(Alder et al., 1999
;
Timmer et al., 2002
), setting
up antagonistic pathways that must be in balance to form a spinal cord with
the correct cell number and cell type.
| MATERIALS AND METHODS |
|---|
|
|
|---|
E.
coli and sequenced.
Plasmid construction
Math1/lacZ transgenes were constructed by PCR from the
Math1 enhancer (Helms et al.,
2000
) (Accession Number, AF218258) and cloned into the BGZA
reporter construct (Yee and Rigby,
1993
), which places the enhancer region 5' to the
ß-globin basal promoter, the lacZ-coding region and SV40
polyadenylation sequences. Specific enhancer fragments used and mutations
within these fragments are shown in Fig.
5 and Fig. 1B. Tg22
also contains a mutation in a possible Zic1-binding site within the
non-conserved regions between enhancers A and B. Templates for in vitro
transcription coupled translation (TNT) were generated as follows. The
truncated Zic1 construct was derived by PCR using the
Zic1-containing yeast one-hybrid clone and primers 5'
ACCATGGGCCCACACGGCCATAC 3' (sense) and 5' GGGTCGGCATGTTTTGTTTC
3' (antisense), and then subcloned into pSP64-TEN. Full-length
Zic1 was generated by hybrid PCR from a genomically derived
Zic1 fragment corresponding to the 5' region of the coding
sequence, as well as the yeast one-hybrid clone used to generate the truncated
Zic1 construct (details available upon request). All chick expression
plasmids are in pMIWIII (Muramatsu et al.,
1997
). pMIWIII-mycZic1 was constructed by cloning the
full-length coding sequences in frame into pMIWIII-mycNgn1, after
the removal of the Ngn1-coding sequence
(Gowan et al., 2001
). The
co-electroporation vector EGFP-N1 is from Clontech.
pMIWIII-myccontrol contains a Myc tag fused to a missense Ngn1
(Gowan et al., 2001
). The
Math1 expression construct is from Gowan et al.
(Gowan et al., 2001
). All
constructs were sequenced to confirm the lack of PCR incorporation errors.
|
|
32P ATP (Amersham, Piscataway, NJ), 10 U polynucleotide
kinase (Roche, Indianapolis, IN). Labeled oligonucleotides were purified over
a G-50 sephadex column and quantified by scintillation analysis. The enhancer
B (374 bp) probes were generated by adding 50 µCi
32P
dCTP to a standard PCR reaction with primers 5' AAGCCGAGTGTACGTTTAGT
3' and 5' TAAATGTGGCCGCTCAGCTC 3'. The reaction was purified
using High Pure PCR Product Purification kit (Roche) to reduce primer-dimer
contamination, and quantified by scintillation analysis. Pre-binding reactions
of unlabeled competitor oligonucleotides at
100-fold molar excess
occurred for 15 minutes at room temperature. Binding reactions were performed
for 30 minutes at room temperature, followed by electrophoresis on a prerun
5%-0.08% acrylamide-bisacrylamide non-denaturing 0.5xTBE gel for 3-5
hours at 20 mA constant current, followed by drying and exposure to X-ray film
for several hours.
|
) were injected into the lumen of the neural tube using a General
Valve Corporation Picospritzer II (Fairfield, NJ) and pulled glass pipettes.
Electroporations were performed using a BTX ECM 830 power supply and BTX
Genetrodes electrodes (San Diego, CA) with 3-50 ms pulses at 25 V. Embryos
used for lacZ reporter construct analysis were electroporated at
stages 14-17, and harvested for ß-gal activity assays 24-36 hours later
as previously described (Timmer et al.,
2001
Immunocytochemistry, ß-gal activity and in situ
hybridization
Mouse and chick embryos were dissected in 1xPBS on ice, rinsed, fixed
in 2-4% formaldehyde for 2-4 hours at 4°C, rinsed with 1xPBS and
sunk in 30% sucrose at 4°C overnight. Embryos were embedded in OCT
compound (Tissue Tek) and cryosectioned at 30 µm. Slides were incubated in
the appropriate dilution of primary antibody in PBS/1% goat serum/0.1% triton
X-100, followed by either goat anti-rabbit or goat anti-mouse IgG, conjugated
to Alexa Fluor 488 and 594 (Molecular Probes). Primary antibodies used for
this study include: rabbit anti-Math1
(Helms and Johnson, 1998
),
mouse anti-Math1 (Gowan et al.,
2001
), rabbit anti-Zic (gift of R. Segal), rabbit
anti-ß-galactosidase (5prime-3prime), mouse anti-c-myc (9E10 Santa Cruz
Biotechnology), mouse anti-Mash1 (Lo et
al., 1991
) and mouse anti-islet1 (Developmental Studies Hybridoma
Bank). Fluoresence imaging was carried out on a BioRad MRC 1024 confocal
microscope. EGFP signal was imaged using a standard FITC filter. For detection
of ß-gal activity, chick embryos were dissected in room temperature
1xPBS, fixed for 30 minutes at room temperature in 2% formaldehyde,
rinsed and stained in X-gal solution as described
(Timmer et al., 2001
).
In situ hybridization was performed as described
(Gowan et al., 2001
) using in
situ probes for Cath1 (PCR generated), Cash1 (obtained from T. Reh), and chick
Ngn1 and Ngn2 (obtained from D. Anderson).
| RESULTS |
|---|
|
|
|---|
3.4 kb
3' of the Math1-coding sequence was sufficient to direct
restricted expression of a lacZ reporter to most domains of
Math1 expression in transgenic mice
(Helms et al., 2000
1.7 kb 3' of
the Cath1 coding sequence. The Cath1 enhancer sequence is
less conserved with Math1 (75% and 62% for the two regions) relative
to the conservation between Math1 and HATH1 (91% and 87% for
the two regions) (Fig. 1A).
Notably, an E-box site, previously shown to be essential for Math1
enhancer function in transgenic mice
(Helms et al., 2000
We then tested for functional conservation by assaying the activity of the
chick Cath1 enhancer in mouse transgenic assays, and conversely,
testing the activity of the mouse Math1 enhancer in the chick neural
tube by in ovo electroporation. The sequences with highest homology between
the chick and mouse enhancers were tested for activity. A 1.2 kb
Math1 enhancer sequence (which corresponds to the region conserved
with the chick enhancer) was tested using the BGZA reporter
(Yee and Rigby, 1993
) both in
transgenic mice, and in the chick neural tube after electroporation.
Expression of a 1.2 kb Math1/lacZ transgene in mouse E10.5 embryos
resulted in restricted expression of lacZ in the dorsal neural tube
(Fig. 1C,E) as had been seen
previously with a longer sequence (Helms
et al., 2000
). Electroporation of this same construct in the chick
neural tube (stage HH14-17) resulted in lacZ expression on the
electroporated side of the neural tube in a similar dorsal pattern when
assayed 24-36 hours after electroporation
(Fig. 1F). The activity of this
1.2 kb Math1 enhancer in chick is identical to previously published
results using a 1.7 kb enhancer sequence
(Timmer et al., 2001
).
Conversely, we tested the activity of a 950 bp Cath1 sequence with
the BGZA reporter in transgenic mice. This Cath1/lacZ construct
resulted in lacZ expression in a dorsally restricted pattern in the
neural tube of E10.5 embryos from the midbrain/hindbrain boundary caudally to
the tail (Fig. 1D), identical
to that seen with the comparable Math1/lacZ transgene
(Fig. 1C). Thus, conserved
sequences between Math1 and Cath1 reflect a functional
conservation that suggests conserved mechanisms control Cath1/Math1
transcription in chick and mouse.
Zic1 is identified as a candidate upstream regulator of
Math1 expression
To identify factors that interact with the Math1 enhancer, we
initiated a yeast one-hybrid screen using a 374 bp region of the enhancer
(nucleotides 898-1271) to screen an E10.5 mouse embryo library (a gift from Dr
Eric Olson). Upon screening
1x106 independent clones for
binding to the 374 bp sequence, the zinc-finger transcription factor Zic1 was
identified six times. This study addresses the possible role of this factor in
the regulation of Math1 transcription.
Zic1 is a zinc-finger transcription factor originally identified based on
enriched expression in the cerebellum
(Aruga et al., 1994
). Published
reports on the expression of Zic1 are consistent with a role for this
molecule in the regulation of Math1 expression. In mouse neural
tissue, Zic1 mRNA is detected in the neural plate at E7.5
(Nagai et al., 1997
), in
advance of the initiation of Math1 expression at E9.0
(Akazawa et al., 1995
;
Ben-Arie et al., 1996
). By
E10.5, Zic1 expression is restricted to the dorsal third of the
neural tube, including spinal and hindbrain regions that overlap the domain of
Math1 expression (Aruga et al.,
1994
; Nagai et al.,
1997
). Like Math1, Zic1 is also expressed in cerebellar
granule cell progenitors from rhombic lip stages through postnatal stages
(Akazawa et al., 1995
;
Aruga et al., 1994
;
Ben-Arie et al., 2000
;
Helms and Johnson, 1998
;
Nagai et al., 1997
). The
multiple overlapping domains of Zic1 and Math1 expression
are consistent with Zic1 playing a role in the regulation of
Math1.
To compare the distribution of Math1 to the Zic factors at the single cell
level, we used double immunofluorescence with a rabbit polyclonal antisera
that recognizes multiple members of the Zic factor family (gift of R. Segal)
and mouse monoclonal antibodies specific to Math1
(Gowan et al., 2001
). At E10.5
in mouse, Math1 is restricted to the dorsal neural tube in cells adjacent to
the roof plate (Fig. 2B)
(Akazawa et al., 1995
;
Ben-Arie et al., 1996
;
Helms and Johnson, 1998
).
Expression of Zic factors is broader, extending from the roof plate through
the dorsal third of the neural tube with the highest expression within the
roof plate region (Fig. 2A)
(Aruga et al., 1994
;
Nagai et al., 1997
).
Unexpectedly, Zic expression appears to be diminished specifically in the
dorsal domain where Math1 is expressed
(Fig. 2C). Analysis at higher
magnification reveals cells co-expressing low levels of both Zic and Math1,
but cells co-expressing Zic and Math1 at high levels are not detected
(Fig. 2D-F). This inverse
expression pattern suggests a negative role for Zic1 in Math1
transcription. Conversely, as seen in the Math1 mutant, the Zic
expression pattern is uniform in the dorsal neural tube
(Fig. 2G), suggesting Math1 may
inhibit Zic expression as well.
|
25 bp from the previously identified E-box site required for
Math1 enhancer activity (see Fig.
1B). No additional Zic1 binding sites within this enhancer
fragment were identified as shown using EMSA with the 374 bp Math1
enhancer probe and Zic1 extract. A single complex, in addition to that seen
with control extract, was detected (Fig.
3B, lane 2). This complex was lost when the identified Zic1 site
was mutated (Fig. 3B, lanes 2,
4, and 6). Thus, this enhancer sequence contains only one Zic1-binding
site.
To characterize the novel Zic1-binding site further in the Math1
enhancer, we performed EMSA with mutant oligonucleotide probes spanning the
Z-site oligonucleotide. This analysis defined a 15 bp region required for Zic1
binding (Fig. 3C, consensus).
EMSA using probes from the homologous human (HATH1) and chick (Cath1) regions
revealed that the ability to interact with Zic1 is conserved among all three
species (Fig. 3C). This
consensus has some similarity (8 out of 12 nucleotides) to a recently
published Zic1 binding site in the apolipoprotein E enhancer
(Salero et al., 2001
) and no
significant similarity to the published Gli site. In conclusion, a novel Zic1
binding site conserved between multiple species is present in the
Math1 enhancer.
Ectopic expression of Zic1 inhibits expression of Cath1 and
a Math1/lacZ transgene in vivo
To test whether Zic1 functions in vivo in regulating Math1/Cath1
expression, we examined Cath1 expression when Zic1 was overexpressed
in the chick neural tube. A construct containing the full-length
Zic1-coding sequence fused to five N-terminal Myc tags in the pMiWIII
vector was electroporated into stage HH13-14 chick neural tubes and assayed
for Cath1 expression by immunofluorescence at 24 hours
post-electroporation (HH20-21). Neural tubes ectopically expressing
mycZic1 had a dramatic decrease in the number of cells expressing
Cath1 (Fig. 4B). This loss of
Cath1-positive cells was not seen with neural tubes electroporated with a
control expression vector (Fig.
4A). These data support a negative role for Zic1 in the regulation
of Cath1 expression. Electroporation of mycZic1 after normal
initiation of Cath1 expression (HH18) had no effect on Cath1 expression (data
not shown). Thus, Zic1 appears to repress expression of Cath1 but this
repression is stage dependent and occurs during early stages of Cath1
expression.
|
The Zic1-binding site in the Math1 enhancer is required for
enhancer activity in chick neural tube
Zic1 represses Cath1 and Math1/lacZ transgene expression in the
chick neural tube. This suggests that mutation of the Zic1 binding site in the
Math1 enhancer might result in increased enhancer activity due to
loss of Zic1 binding. To test this, we mutated or deleted specific nucleotides
to disrupt Zic1 binding, and tested enhancer activity in the chick
electroporation assay. Electroporation of multiple Math1
enhancer/lacZ constructs that include the Zic1 site into chick embryos
resulted in consistent restricted expression of lacZ in the dorsal
neural tube (Fig. 1F, Fig. 4C and
Fig. 5; Tg18 and 20)
(Timmer et al., 2001
).
Contrary to our prediction, mutation (Fig.
5, Tg19 and 22) or deletion
(Fig. 5, Tg21) of the Zic1 site
within the context of the Math1 enhancer completely eliminated
expression of the construct. Thus, the Zic1 site is necessary for enhancer
activity in the chick neural tube, suggesting a positive role for this site in
enhancer function. Given our findings that Zic1 is acting to repress
Cath1 expression, the loss of enhancer activity when Zic1-binding
site is lost suggests that Zic1 may either compete for this site with an
activator, or that Zic1 also has a role as an activator, but only in the
presence of a co-factor.
Zic1 represses the auto-activation of Math1 expression
We have previously demonstrated that the Math1 enhancer requires
Math1 for activity and contains an essential E-box element (the binding site
for Math1) supporting the involvement of autoregulation in Math1
expression (Helms et al.,
2000
). We have found a similar requirement for the E-box for
activity of the enhancer in the chick neural tube
(Fig. 5, Tg23). Further data
supporting positive autoregulation is seen by the increase in expression of
endogenous Cath1 upon electroporation of Math1 in the chick
neural tube (Fig. 6A, the
endogenous increase in Cath1 was distinguished from the exogenous
Math1 using a Cath1-specific probe for mRNA in situ
analysis). The increase in Cath1 was mostly seen in the dorsal neural
tube, consistent with previous results showing context dependent activity of
Math1 in this assay (Gowan et al.,
2001
). An even more dramatic increase was seen in the expression
of the Math1/lacZ transgene upon co-electroporation with
Math1 (Fig. 6B). Note
that the expression is throughout the DV axis, in contrast to the normal
dorsal-restricted expression of the Math1/lacZ transgene
(Fig. 1F,
Fig. 4C,
Fig. 5B). These data further
support our previous result that demonstrated the involvement of positive
autoregulation in controlling Math1 expression.
|
Contrasting roles for Math1 and Zic1 in maintaining progenitors
versus inducing neuronal differentiation
Roles for Math1 and Zic1 in the developing dorsal neural tube have been
suggested previously from loss-of-function studies in mouse
(Aruga et al., 2002b
;
Bermingham et al., 2001
;
Gowan et al., 2001
) and
overexpression studies in Xenopus
(Brewster et al., 1998
;
Kim et al., 1997
;
Kuo et al., 1998
;
Mizuseki et al., 1998
).
Studies of the Math1 mutant mouse demonstrated that Math1 is required
for the formation of a specific population of interneurons
(Bermingham et al., 2001
;
Gowan et al., 2001
), and in
Xenopus, Xath1, drives ectopic neuronal differentiation
(Kim et al., 1997
). By
contrast, overexpression of Zic factors in Xenopus have suggested
that Zic factors mediate neural competence, but also induce dorsal cell fates
such as neural crest. The consequences for dorsal neural tube neuronal
differentiation are not clear, as the previous referenced reports suggest that
dorsal cell types may be induced, repressed or not affected
(Brewster et al., 1998
;
Kuo et al., 1998
;
Mizuseki et al., 1998
).
Studies of the Zic1 mutant mouse suggest that Zic1 normally represses
neuronal differentiation and maintains cells as neural progenitors
(Aruga et al., 2002b
).
Electroporation of Math1 and Zic1 into the chick neural tube provides another
paradigm to address the function of these factors in dorsal neural tube
development.
Electroporation of a GFP expression construct alone at HH11-12 and analysis 48 hours later illustrates the distribution of cells that have taken up the DNA. Many GFP-expressing cells are found in the dorsal root ganglia (DRG), a neural crest derivative, on the electroporated side (Fig. 7A,B). A few cells are found in the DRG opposite to the electroporated side, suggesting that neural crest cells can cross the midline. Within the neural tube, the GFP is distributed throughout the ventricular zone, presumably in neural progenitor cells, as well as cells that are found laterally where the differentiated neurons reside (Fig. 7A,B; asterisk marks the midline). By contrast, when a Math1 expression construct is co-electroporated with the GFP expression construct, cells expressing GFP are rarely found in either DRG (Fig. 7C,D). Furthermore, within the neural tube, the GFP is no longer evenly distributed within ventricular zone but rather is mostly found lateral to this progenitor domain (Fig. 7C,D, asterisk indicates the midline). This effect is seen within 24 hours of the electroporation (data not shown). The distribution of the GFP-expressing cells in the presence of Math1 suggests that Math1 promotes neuronal differentiation within the neural tube in a manner that prevents these cells from adopting the neural crest fate.
|
Differential effects by Zic1 on bHLH factor expression
The data presented here, and in previous studies, suggest that Zic1 plays a
role in maintaining cells as neural progenitors, and thus may play a role in
the timing of differentiation. We have shown that Zic1 represses expression of
the neuronal differentiation factor Math1. However, Zic1 is expressed not only
in the region encompassing the Math1 domain, but also extends ventrally to the
dorsal regions of expression of three other bHLH transcription factors: Ngn1,
Ngn2 and Mash1 (Gowan et al.,
2001
). To examine whether the Zic1 repression is specific to
Cath1, or whether repression of bHLH transcription factors is a general
mechanism for inhibiting differentiation, we analyzed expression of chick
Ngn1, chick Ngn2 and Cash1 in the
mycZic1 electroporated chick neural tubes. As seen previously with
Cath1 immunostaining (Fig. 4),
Cath1 mRNA is repressed relative to the non-electroporated side when
mycZic1 is electroporated (Fig.
8A). Similarly, Cash1 expression is repressed with
mycZic1 (Fig. 8B).
By contrast, Ngn1 and Ngn2 appear to be unaffected (or even
slightly induced) by mycZic1
(Fig. 8C,D). Thus, Zic1
differentially regulates these bHLH factors at this stage in the chick neural
tube.
|
| DISCUSSION |
|---|
|
|
|---|
Zic1: a repressor of Math1/Cath1 and Cash1
expression
The inverse relationship in expression of Zic factors and Math1 in the
dorsal neural tube is consistent with an inhibitory role for Zic1 in
Math1 expression. In ovo experiments analyzing Zic1 function
demonstrated that overexpression of Zic1 can repress both the endogenous
Cath1 and Cash1 genes, as well as a Math1
enhancer/lacZ reporter construct. Expression of related genes
encoding the bHLH factors Ngn1 and Ngn2 were not repressed. These data suggest
that Zic1 does not mediate global repression of neural differentiation, but
instead is directed at distinct neuronal subtypes, in particular those
descendant from Math1/Cath1- and Mash1/Cash1-expressing cells.
The data presented here strongly support a model in which Zic1 directly
represses Math1 expression. This repression could function to block initiation
of Math1 expression, to modulate the autoregulation phase of expression, or
both. It is intriguing that the Zic1 binding site and E-box site required for
autoregulation are separated by only 25 bp in the Math1 enhancer. It
is possible that the two sites cannot be occupied at the same time, thus
providing an explanation for why Zic1 was unable to repress endogenous
Cath1 expression when Zic1 was added after Cath1 was already
present. Localized repressive effects on the chromatin catalyzed by Zic1 could
undermine the ability of factors binding the E-box to activate transcription.
Consistent with this possibility, factors related to Zic proteins, the Gli
factors, recruit components of the mouse Sin3/histone deacetylase complexes by
interaction with the Fused kinase (Cheng
and Bishop, 2002
). Gli and Zic factors interact in specific cell
contexts, and this interaction can be direct, as shown in immunoprecipitation
and yeast two-hybrid experiments (Koyabu
et al., 2001
). These data suggest that a combination of Zic/Gli
factors (or possibly Zic alone) could act to recruit complexes to chromatin
that repress transcription activity, suppressing activation of the
autoregulatory E-box in the Math1 enhancer, and thus block or limit
the establishment of a Math1 expressing domain in the dorsal neural tube.
Although it is clear that Cath1 is directly repressed by Zic1, the
repression of Cash1 by overexpression of Zic1 may be indirect, based
on the relatively abundant co-expression of these two molecules in the dorsal
neural tube. An increase in expression of the neurogenic repressor Notch1 and
its effector Hes1 was seen in Zic1 overexpression paradigms
(Aruga et al., 2002b
),
providing a possible link to the indirect repression of Cash1
expression. The observation that Cash1 but not Ngn1/2 was
repressed by Zic1 could reflect a difference in how these genes are regulated
by Notch signaling. Such differences in sensitivity of bHLH genes to
inhibition by Notch signaling have been seen previously
(Cau et al., 2002
;
Chitnis and Kintner, 1996
;
Lo et al., 2002
).
Zic1: a bifunctional protein?
The conclusion that Zic1 acts to repress Math1 expression was
confounded by our findings that the Math1 enhancer lost activity in
the chick neural tube when the Zic1 site was mutated. Loss of activity of the
mutated enhancer suggests the Zic1-binding site is also required for
activating Math1 expression. We propose alternate mechanisms by which
Zic1 may temporally modulate Math1 transcription through binding to
the Math1 enhancer. First, Zic1 may compete with a positive regulator
for binding to the Math1 enhancer. Mutation of nucleotides critical
for Zic1 binding to the Math1 enhancer compromises the activity of
the enhancer in assays in vivo, suggesting that nucleotides bound by the
putative activator of Math1 transcription and Zic1 are similar.
Alternatively, a positive factor interacting with Zic1, or post-translational
modifications of Zic1, may convert it to an activator, explaining the
requirement for the Zic1-binding site for enhancer activity. Zic genes share
homology to the Gli family of transcription factors, which can alternately act
as repressors or activators of transcription depending on whether the
repressor domain of the protein has been proteolyticly removed
(Ruiz i Altaba, 1999
;
Sasaki et al., 1999
). Zic
factors may have a similar function, as they have been shown to either repress
or activate expression of reporter constructs containing Zic/Gli-binding sites
in a cell-type-specific manner (Brewster
et al., 1998
; Mizugishi et
al., 2001
; Salero et al.,
2001
; Yang et al.,
2000
; Kuo et al.,
1998
). In the Zic1 mutant, the number of Math1-expressing cells in
the dorsal neural tube was decreased at E11.5
(Aruga et a., 2002b
). This is
consistent with a role for Zic1 in activating Math1 expression.
However, this interpretation is complicated by the fact that in the absence of
Zic1 premature neuronal differentiation occurs. Thus, the progenitor pool will
be diminished and result in fewer cells that are competent to express
Math1, particularly when looking at the later stages of development
of this progenitor population. Further research into regulation of Zic1
protein function will be required to reveal if Zic1 can act as a bifunctional
protein.
Zic1 represses neuronal differentiation in the dorsal neural tube via
repression of Math1
What is the importance of repression of Math1 expression by Zic1?
One possibility is that a delay in Math1 expression would allow
expansion of the progenitor population needed to generate the correct number
of cells prior to cells exiting the cell cycle and differentiating. Because
Math1 is a regulator of neuronal differentiation of dorsal neuronal cell types
(Bermingham et al., 2001
;
Gowan et al., 2001
), a
Zic1-mediated delay in the onset of Math1 expression would allow
dorsal progenitors to proliferate to the needed population size. When the
repression of Math1 by Zic1 is subsequently overcome, possibly by the
expression of a positive factor that shares the binding site with Zic1, or a
modification of Zic1 itself, and Math1 expression is initiated, the
differentiation of dorsal neuronal cell types results. Such a model is
supported by multiple data generated in Xenopus, where ectopic
expression of Xzic factors result in the inhibition of neuronal
differentiation (Brewster et al.,
1998
; Kuo et al.,
1998
; Mizuseki et al.,
1998
). A role for Zic1 and Zic2 in inhibition of neuronal
differentiation has also been suggested in mice, as in Zic1 and
Zic2 mutants, premature neuronal differentiation was detected
(Aruga et al., 2002a
;
Aruga et al., 1998
;
Aruga et al., 2002b
). The role
for Zic1 in controlling the timing of differentiation is similar to functions
attributed to Notch. The increase in expression of Notch and its effector Hes1
when Zic1 was overexpressed suggests this function of Zic1 in inhibiting
differentiation may be mediated by the Notch pathway. Furthermore, the
negative regulation of Zic factors by Math1, suggested by the increased
expression of Zic factors in the Math1 mutant, may contribute to the
progression of neural progenitors towards the differentiated state.
An additional consequence for Zic1-based repression of Math1
expression may be to allow early-born cells of the dorsal neural tube to
differentiate into a neural crest cell fate. Cells of the neural crest begin
to migrate from the dorsal regions of the neural tube shortly after fusion of
the neural tube, continuing up to
E9.0-E9.5 in the mouse. This latter
time period coincides with the induction of Math1 expression in the
dorsal neural tube. Electroporation of Math1 into the chick neural tube (prior
to native Cath1 induction) prevents transfected cells from accumulating in the
DRG, consistent with Math1 acting to bias cells toward neuronal cell fates and
blocking the adoption of neural crest fates. Zic repression of Math1
expression may allow the generation of neural crest cells early in embryonic
development. Overcoming this repression allows the induction of Math1
expression and subsequent generation of dorsal interneurons. In conclusion,
the role of Zic1 may be to control the timing of the initiation of
Math1 expression, to modulate the number of cells that take on a
neural crest fate versus those remaining in the neural tube that will adopt a
dorsal interneuron fate.
Concluding remarks
The regulation of Math1 expression is complex in that it both
integrates signals that pattern the neural tube and responds to signals that
initiate neuronal differentiation. Thus, the spatial and temporal components
of the Math1 expression pattern must be tightly controlled. The size
of the conserved enhancer suggests that the integration of spatial and
temporal signals may occur at the level of the enhancer. Identification of
autoregulation (Helms et al.,
2000
), cross-inhibition between neural bHLH classes
(Gowan et al., 2001
) and the
role of Zic1 in regulating different aspects of the Math1 expression
pattern provide inroads into our understanding of these processes. Further
experiments should be able to address how BMP signaling functions in
Math1 regulation, and how it relates to Zic1 function. In addition,
the studies to date have been focused on Math1 expression in the
dorsal neural tube at E10.5. Will the same regulatory relationships function
in the other domains of Math1 expression including the EGL of the
cerebellum, and sensory cell progenitors in the inner ear and skin? Many
transcription factors and signaling pathways functioning in the dorsal neural
tube are present in these tissues as well, suggesting that common themes in
regulation are likely.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Akazawa, C., Ishibashi, M., Shimizu, C., Nakanishi, S. and
Kageyama, R. (1995). A mammalian helix-loop-helix factor
structurally related to the product of the Drosophila proneural gene atonal is
a positive transcriptional regulator expressed in the developing nervous
system. J. Biol. Chem.
270,8730
-8738.
Alder, J., Lee, K. J., Jessell, T. M. and Hatten, M. E.
(1999). Generation of cerebellar granule neurons in vivo by
transplantation of BMP-treated neural progenitor cells. Nat.
Neurosci. 2,535
-540.[CrossRef][Medline]
Altmann, C. R. and Brivanlou, A. H. (2001).
Neural patterning in the vertebrate embryo. Int. Rev.
Cytol. 203,447
-482.[Medline]
Aruga, J., Yokota, N., Hashimoto, M., Furuichi, T., Fukuda, M.
and Mikoshiba, K. (1994). A novel zinc finger protein, Zic,
is involved in neurogenesis, especially in the cell lineage of cerebellar
granule cells. J. Neurochem
63,1880
-1890.[Medline]
Aruga, J., Nagai, T., Tokuyama, T., Hayashizake, Y., Okazaki,
Y., Chapman, V. M. and Mikoshiba, K. (1996a). The mouse Zic
gene family: homologues of Drosophila pair-rule gene odd-paired.
J. Biol. Chem. 271,1043
-1047.
Aruga, J., Yozu, A., Hayashizaki, Y., Okazaki, Y., Chapman, V.
M. and Mikoshiba, K. (1996b). Identification and
characterization of Zic4, a new member of the mouse Zic gene family.
Gene 172,291
-294.[CrossRef][Medline]
Aruga, J., Minowa, O., Yaginuma, H., Kuno, J., Nagai, T., Noda,
T. and Mikoshiba, K. (1998). Mouse Zic1 is involved in
cerebellar development. J. Neurosci.
18,284
-293.
Aruga, J., Inoue, T., Hoshino, J. and Mikoshiba, K.
(2002a). Zic2 controls cerebellar development in
cooperation with Zic1. J. Neurosci.
22,218
-225.
Aruga, J., Tohmonda, T., Homma, S. and Mikoshiba, K.
(2002b). Zic1 promotes the expansion of dorsal neural progenitors
in spinal cord by inhibiting neuronal differentiation. Dev
Biol 244,329
-341.[CrossRef][Medline]
Ben-Arie, N., Bellen, H. J., Armstrong, D. L., McCall, A. E.,
Gordadze, P. R., Guo, Q., Matzuk, M. M. and Zoghbi, H. Y.
(1997). Math1 is essential for genesis of cerebellar
granule neurons. Nature
390,169
-172.[CrossRef][Medline]
Ben-Arie, N., Hassan, B. A., Bermingham, N. A., Malicki, D. M.,
Armstrong, D., Matzuk, M., Bellen, H. J. and Zoghbi, H.
(2000). Functional conservation of atonal and
Math1 in the CNS and PNS. Development
127,1039
-1048.[Abstract]
Ben-Arie, N., McCall, A. E., Berkman, S., Eichele, G., Bellen,
H. J. and Zoghbi, H. Y. (1996). Evolutionary conservation of
sequence and expression of the bHLH protein Atonal suggests a conserved role
in neurogenesis. Hum. Mol. Genet.
5,1207
-1216.
Bermingham, N. A., Hassan, B. A., Price, S. D., Vollrath, M. A.,
Ben-Arie, M., Eatock, R. A., Bellen, H. J., Lysakowski, A. and Zoghbi, H.
Y. (1999). Math1: An essential gene for the generation of
inner ear hair cells. Science
284,1837
-1841.
Bermingham, N. A., Hassan, B. A., Wang, V. Y., Fernandez, M.,
Banfi, S., Bellen, H. J., Fritzsch, B. and Zoghbi, H. Y.
(2001). Proprioceptor pathway development is dependent on MATH1.
Neuron 30,411
-422.[CrossRef][Medline]
Brewster, R., Lee, J. and Ruiz i Altaba, A.
(1998). Gli/Zic factors pattern the neural plate by defining
domains of cell differentiation. Nature
393,579
-583.[CrossRef][Medline]
Briscoe, J., Alessandra, P., Jessell, T. M. and Ericson, J.
(2000). A homeodomain protein code specifies progeitor cell
identity and neuronal fate in the ventral neural tube.
Cell 101,435
-445.[CrossRef][Medline]
Cai, L., Morrow, E. M. and Cepko, C. L. (2000).
Misexpression of basic helix-loop-helix genes in the murine cerebral cortex
affects cell fate choices and neuronal survival.
Development 127,3021
-3030.[Abstract]
Cau, E., Casarosa, S. and Guillemot, F. (2002).
Mash1 and Ngn1 control distinct steps of determination and
differentiation in the olfactory sensory neuron lineage.
Development 129,1871
-1880.
Cheng, S. Y. and Bishop, J. M. (2002).
Suppressor of Fused represses Gli-mediated transcription by recruiting the
SAP18-mSin3 corepressor complex. Proc. Natl. Acad. Sci.
USA 99,5442
-5447.
Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J.
L., Westphal, H. and Beachy, P. A. (1996). Cyclopia and
defective axial patterning in mice lacking Sonic hedgehog gene function.
Nature 383,407
-413.[CrossRef][Medline]
Chitnis, A. and Kintner, C. (1996). Sensitivity
of proneural genes to lateral inhibition affects the pattern of primary
neurons in Xenopus embryos. Development
122,2295
-2301.[Abstract]
Farah, M. H., Olson, J. M., Sucic, H. B., Hume, R. I., Tapscott,
S. J. and Turner, D. L. (2000). Generation of neurons by
transient expression of neural bHLH proteins in mammalian cells.
Development 127,693
-702.[Abstract]
Fode, C., Gradwohl, G., Morin, X., Dierich, A., LeMeur, M.,
Goridis, C. and Guillemot, F. (1998). The bHLH protein
NEUROGENIN2 is a detemination factor for epibranchial placode-derived sensory
neurons. Neuron 120,483
-494.
Fode, C., Ma, Q., Casarosa, S., Ang, S.-L., Anderson, D. J. and
Guillemot, F. (2000). A role for neural determination genes
in specifying the dorsoventral identity of telencephalic neurons.
Genes Dev. 14,67
-80.
Gaiano, N., Nye, J. S. and Fishell, G. (2000).
Radial glial identity is promoted by Notch1 signaling in the murine forebrain.
Neuron 26,395
-404.[CrossRef][Medline]
Gowan, K., Helms, A. W., Hunsaker, T. L., Collisson, T., Ebert,
P. J., Odom, R. and Johnson, J. E. (2001). Crossinhibitory
activities of Ngn1 and Math1 allow specification of distinct dorsal
interneurons. Neuron 31,219
-232.[CrossRef][Medline]
Guillemot, F., Lo, L. C., Johnson, J. E., Auerbach, A.,
Anderson, D. J. and Joyner, A. L. (1993). Mammalian
achaete-scute homolog 1 is required for the early development of olfactory and
autonomic neurons. Cell
75,463
-476.[CrossRef][Medline]
Helms, A. W., Abney, A., Ben-Arie, N., Zoghbi, H. Y. and
Johnson, J. E. (2000). Autoregulation and multiple enhancers
control Math1 expression in the developing nervous system.
Development 127,1185
-1196.[Abstract]
Helms, A. W., Gowan, K., Abney, A., Savage, T. and Johnson, J.
E. (2001). Overexpression of MATH1 disrupts the coordination
of neural differentiation in cerebellum development. Mol. Cell.
Neurosci. 17,671
-682.[CrossRef][Medline]
Helms, A. W. and Johnson, J. E. (1998).
Progenitors of dorsal commissural interneurons are defined by MATH1
expression. Development
125,919
-925.[Abstract]
Isaka, F., Ishibashi, M., Taki, W., Hashimoto, N., Nakanishi, S.
and Kageyama, R. (1999). Ectopic expression of the bHLH gene
Math1 disturbs neural development. Eur. J. Neurosci.
11,2582
-2588.[CrossRef][Medline]
Kim, P., Helms, A. W., Johnson, J. E. and Zimmerman, K.
(1997). XATH1, a vertebrate homolog of Drosophila
atonal, induces neuronal differentiation within ectodermal progenitors.
Dev. Biol. 187,1
-12.[CrossRef][Medline]
Koyabu, Y., Nakata, K., Mizugishi, K., Aruga, J. and Mikoshiba,
K. (2001). Physical and functional interactions between Zic
and Gli proteins. J. Biol. Chem.
276,6889
-6892.
Kuo, J. S., Patel, M., Gamse, J., Merzdorf, C., Liu, X., Apekin,
V. and Sive, H. (1998). opl: a zinc finger protein that
regulates neuronal determination and patterning in Xenopus.
Development 125,2867
-2882.[Abstract]
Lee, J. E., Hollenberg, S. M., Snider, L., Turner, D. L.,
Lipnick, N. and Weintraub, H. (1995). Conversion of Xenopus
ectoderm into neurons by NeuroD, a basic-helix-loop-helix protein.
Science 268,836
-844.
Lee, K. J., Dietrich, P. and Jessell, T. M.
(2000). Genetic ablation reveals that the roof plate is essential
for dorsal interneuron specification. Nature
403,734
-740.[CrossRef][Medline]
Lee, K. J., Mendelsohn, M. and Jessell, T. M.
(1998). Neuronal patterning by BMPs: a requirement for GDF7 in
the generation of a discrete class of commissural interneurons in the mouse
spinal cord. Genes Dev.
12,3394
-3407.
Lo, L.-C., Johnson, J. E., Wuenschell, C. W., Saito, T. and
Anderson, D. J. (1991). Mammalian achaete-scute
homolog 1 is transiently expressed by spatially-restricted subsets of early
neuroepithelial and neural crest cells. Genes Dev.
5,1524
-1537.
Lo, L. C., Dormand, E., Greenwood, A. and Anderson, D. J.
(2002). Comparison of the generic neuronal differentiation and
neuron subtype specification functions of mammalian achaete-scute and atonal
homologs in cultured neural progenitor cells.
Development 129,1553
-1567.
Ma, Q., Chen, Z., del Barco Barrantes, I., de la Pompa, J. L.
and Anderson, D. J. (1998). neurogenin1 is essential
for the determination of neuronal precursors for proximal cranial sensory
ganglia. Neuron 120,469
-482.
Ma, Q., Kintner, C. and Anderson, D. J. (1996).
Identification of neurogenin, a vertebrate neuronal determination gene.
Cell 87,43
-52.[CrossRef][Medline]
Matter-Sadzinski, L., Matter, J. M., Ong, M. T., Hernandez, J.
and Ballivet, M. (2001). Specification of neurotransmitter
receptor identity in developing retina: the chick ATH5 promoter integrates the
positive and negataive effects of several bHLH proteins.
Development 128,217
-231.[Abstract]
Mizugishi, K., Aruga, J., Nakata, K. and Mikoshiba, K.
(2001). Molecular properties of Zic proteins as transcriptional
regulators and their relationship to GLI proteins. J. Biol.
Chem. 276,2180
-2188.
Mizuseki, K., Kishi, M., Matsui, M., Nakanishi, S. and Sasai,
Y. (1998). Xenopus Zic-related-1 and Sox-2, two
factors induced by chordin, have distinct activites in the initiation of
neural induction. Development
125,579
-587.[Abstract]
Morrison, S. J., Perez, S. E., Qiao, Z., Verdi, J. M., Hicks,
C., Weinmaster, G. and Anderson, D. J. (2000). Transient
Notch activation initiates an irreversible switch from neurogenesis to
gliogenesis by neural crest stem cells. Cell
101,499
-510.[CrossRef][Medline]
Muramatsu, T., Mizutani, Y., Ohmori, Y. and Okumura, J.
(1997). Comparison of three nonviral transfection methods for
foreign gene expression in early chicken embryos in ovo. Biochem.
Biophys. Res. Commun. 230,376
-380.[CrossRef][Medline]
Nagai, T., Aruga, J., Takada, S., Gunther, T., Sporle, R.,
Schughart, K. and Mikoshiba, K. (1997). The expression of the
mouse Zic1, Zic2, and Zic3 genes suggest an essential role for Zic genes in
body pattern formation. Dev. Biol.
182,299
-313.[CrossRef][Medline]
Nakata, K., Koyabu, Y., Aruga, J. and Mikoshiba, K.
(2000). A novel member of the Xenopus Zic family, Zic5, mediates
neural crest development. Mech. Dev.
99, 83-91.[CrossRef][Medline]
Ruiz i Altaba, A. (1999). Gli proteins encode
context-dependent positive and negative functions: implications for
development and disease. Development
126,3205
-3216.[Abstract]
Salero, E., Perez-Sen, R., Aruga, J., Gimenez, C. and Zafra,
F. (2001). Transcription factors Zic1 and Zic2 bind and
transactivate the apolipoprotein E gene promoter. J. Biol.
Chem. 276,1881
-1888.
Sasaki, H., Nishizaki, Y., Hui, C., Nakafuku, M. and Kondoh,
H. (1999). Regulation of Gli2 and Gli3 activities by an
amino-terminal repression domain: implication of Gli2 and Gli3 as primary
mediators of Shh signaling. Development
126,3915
-3924.[Abstract]
Sun, Y., Jan, L. Y. and Jan, Y. N. (1998).
Transcriptional regulation of atonal during development of the
Drosophila peripheral nervous system.
Development 125,3731
-3740.[Abstract]
Sun, Y., Nadal-Vicens, M., Misono, S., Lin, M. Z., Zubiaga, A.,
Hua, X., Fan, G. and Greenberg, M. E. (2001). Neurogenin
promotes neurogenesis and inhibits glial differentiation by independent
mechanisms. Cell 104,365
-376.[CrossRef][Medline]
Timmer, J., Johnson, J. and Niswander, L.
(2001). The use of in ovo electroporation for the rapid analysis
of neural-specific murine enhancers. Genesis
29,123
-132.[CrossRef][Medline]
Timmer, J., Wang, C. and Niswander, L. (2002).
BMP signaling patterns the dorsal and intermediate neural tube via regulation
of homeobox and helix-loop-helix transcription factors.
Development 129,2459
-2472.
Yang, Y., Hwang, C. K., Junn, E., Lee, G. and Mouradian, M.
M. (2000). ZIC2 and Sp3 repress Sp1-induced activation of the
human D1A dopamine receptor gene. J. Biol. Chem.
275,38863
-38869.
Yee, S. and Rigby, P. W. J. (1993). The
regulation of myogenin gene expression during the embryonic development of the
mouse. Genes Dev. 7,1277
-1289.
This article has been cited by other articles:
![]() |
M. K. Nyholm, S. Abdelilah-Seyfried, and Y. Grinblat A novel genetic mechanism regulates dorsolateral hinge-point formation during zebrafish cranial neurulation J. Cell Sci., June 15, 2009; 122(12): 2137 - 2148. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Nyholm, S.-F. Wu, R. I. Dorsky, and Y. Grinblat The zebrafish zic2a-zic5 gene pair acts downstream of canonical Wnt signaling to control cell proliferation in the developing tectum Development, February 15, 2007; 134(4): 735 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Hawkins and M. Lovett The developmental genetics of auditory hair cells Hum. Mol. Genet., October 1, 2004; 13(suppl_2): R289 - R296. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. F. Barald and M. W. Kelley From placode to polarization: new tunes in inner ear development Development, September 1, 2004; 131(17): 4119 - 4130. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-Q. Ding, J. Yin, A. Kania, Z.-Q. Zhao, R. L. Johnson, and Z.-F. Chen Lmx1b controls the differentiation and migration of the superficial dorsal horn neurons of the spinal cord Development, August 1, 2004; 131(15): 3693 - 3703. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gazit, V. Krizhanovsky, and N. Ben-Arie Math1 controls cerebellar granule cell differentiation by regulating multiple components of the Notch signaling pathway Development, February 15, 2004; 131(4): 903 - 913. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||