|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 21 April 2004
doi: 10.1242/dev.01099
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Dipartimento di Fisiologia e Biochimica, Laboratorio di Biologia Cellulare e
dello Sviluppo, Università di Pisa, 56010 Ghezzano, Pisa, Italy
2 Developmental Biology Programme, EMBL Heidelberg, Meyerhofstrasse 1, 69012
Heidelberg, Germany
3 Centro di Eccellenza AmbiSEN, Università di Pisa, Pisa, Italy
* Author for correspondence (e-mail: rvignali{at}dfb.unipi.it)
Accepted 28 January 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Retinal differentiation, Ganglion cell, Photoreceptor, Retinal cell fate, Bar, Xenopus laevis, Homeobox
| Introduction |
|---|
|
|
|---|
Potential factors acting downstream of Ath5 to specify ganglion
cell fate are the POU-domain transcription factors Brn3, expressed in
postmitotic precursors and in differentiating RGCs
(Hirsch and Harris, 1997
;
Hutcheson and Vetter, 2001
;
Perron et al., 1998
;
Xiang et al., 1995
). All Brn3
factors are able to promote ganglion cell fate in the chick
(Liu et al., 2000
). In
Xenopus, both Xbrn3.0 and Xbrn3d are activated by
Xath5 in the whole embryo or in the animal cap assay
(Hirsch and Harris, 1997
;
Hutcheson and Vetter, 2001
;
Perron et al., 1998
).
Similarly, forced expression of both chick and mouse Ath5 in RPCs is
able to activate cBrn3c expression
(Liu et al., 2001
), further
corroborating the hypothesis that Brn3 genes act downstream of Ath5
to bias retinoblasts toward ganglion cell fate. However, targeted disruption
of the POU gene Brn3b (Pou4f3) in the mouse does not affect retinal
specification, but rather blocks terminal differentiation of a subset of RGCs,
causing them to die (Gan et al.,
1996
; Xiang et al.,
1998
). This suggests that Brn3 factors may instead play a later
role in differentiation and survival of subsets of RGCs.
In the present work, we addressed the function of the Xenopus
BarH1 homeobox gene Xbh1 during RGC differentiation. Vertebrate Bar
homeobox genes are related to Drosophila BarH1 and BarH2
genes. Mutations in these genes result in the suppression of the anterior part
of the eye (Higashijima et al.,
1992a
; Kojima et al.,
1991
). Both genes act in a redundant way, and are necessary for
the correct development of the external sensory organs and the eye
(Higashijima et al., 1992b
).
In the Drosophila eye, BarH1/BarH2 are necessary for the
differentiation of the external photoreceptors (R1/R6) and primary pigment
cells, where they are regulated by two other transcription factors:
lozenge (lz), which modulates the expression of
BarH1/BarH2 in R1/R6 precursors; and sparkling
(spa; shaven, sv - FlyBase), a homologue of mammalian
Pax2, necessary for BarH1/BarH2 expression in the cone and
primary pigment cell precursors (Daga et
al., 1996
; Fu and Noll,
1997
). In the developing notum, BarH1/BarH2 genes are
regulated by the secreted factors decapentaplegic and wingless, and exert
their function by modulating the proneural achaete-scute genes
(Sato et al., 1999
). Mammalian
homologues of BarH genes, MBH1 and MBH2 (Barhl2 and
Barhl1, respectively - Mouse Genome Informatics, Human Gene
Nomenclature Database), have been isolated and show similar but not identical
expression patterns in the central nervous system and retina
(Bulfone et al., 2000
;
Saito, 2000
;
Saito et al., 1998
). Though
recent data show that MBH1 acts in the specification of commissural
neurones in the dorsal spinal cord (Saba
et al., 2003
), the role of Bar-related genes in vertebrate eye
development has not been investigated. Similar to MBH1, Xenopus Xbh1
and medaka OlBar are expressed in the retina in a spatiotemporal
pattern that appears to follow the differentiation of RGCs
(Patterson et al., 2000
;
Poggi et al., 2002
). This
finding suggests that vertebrate BH1 is involved in RGC type specification.
Here, we show that Xbh1 expression follows and overlaps the
dorsoventral wave of Xath5 expression during retinal neurogenesis. In
the CMZ of the mature retina, Xbh1 transcripts were found in the
central-most part containing early postmitotic precursors that are about to
undergo the differentiation process. We also provide functional data strongly
supporting a role for Xbh1 in promoting RGC fate. In addition, we
find that Xbh1 both enhances and is required for the ability of
Xath5 to bias retinal precursors toward ganglion cell fate. Our data
suggest that Xbh1 acts in a genetic pathway downstream of
Xath5 and upstream of Xbrn3 in the regulation of RGC
development.
| Materials and methods |
|---|
|
|
|---|
In situ hybridization
Whole-mount in situ hybridization was performed as described by Harland
(Harland, 1991
). Standard RNA
synthesis from linearized plasmids using SP6, T7 or T3 RNA polymerases were
carried out incorporating a digoxigenin (DIG)- or fluorescein-substituted
ribonucleotide. Alkaline phosphatase detection was performed with BM-purple.
For histological examination, stained embryos were washed in 1xPBS
several times, equilibrated in sucrose 30% (in 1xPBS) and cryostat
sectioned at the thickness of 30 µm.
In situ hybridization on sections was performed using the same protocol but with the following modifications: rehydrated sections were fixed to slides using 100% methanol for 10 minutes, then rinsed in 1xPBS for 2 minutes and washed 3 times for 5 minutes in PBST (PBS+0.1% Triton). Sections were treated with 20 µg/ml proteinase K for 30 seconds with subsequent wash times reduced by half.
For double in situ hybridization, sections were hybridized simultaneously with both a DIG- and a fluorescein-labeled probe under standard conditions. After detection of the first probe with BM-purple, the alkaline phosphatase was inactivated in 100 mM glycine (pH 2.2) and 0.1% Tween-20, then the sections blocked in MAB [100 mM maleic acid, 150 mM NaCl (pH 7.5)] and Blocking Reagent supplemented with 20% lamb serum. Following incubation with the second antibody, the alkaline phosphatase reaction was performed with Magenta-Phos (Sigma).
Lipofections
DNA isolated by Qiagen maxi preps was diluted in nuclease-free water to a
concentration of 1.5 µg/µl. These stocks were spun down for at least 10
minutes at 4°C before use. Each construct (1 µl) was mixed with 1 µl
pCS2+-GFP (green fluorescent protein) DNA to label transfected
cells. pCS2+-GFP with pCS2+ vector alone was used as the
control. DOTAP (9 µl; Roche) was added to 3 µg DNA and injected into the
eye presumptive region of stage 17-18 or stage 25-26 embryos. At stage 42,
embryos were fixed in 4% paraformaldehyde for 1 hour at room temperature, sunk
in 30% sucrose overnight at 4°C and cryostat sectioned (10 µm). Samples
were rehydrated with two washes of 1xPBS for 5 minutes, mounted in
FluorSave (CalBioChem) containing 2% DABCO (Sigma) and dried overnight at room
temperature.
BrdU experiments
Stage 42 embryos were injected with BrdU (5-bromo-2'-deoxyuridine,
Roche) in the gut, fixed 1 hour later and cryostat sectioned. In situ
hybridization was performed on 10 µm sections as follows: DIG-labelled
probes (2 ng/ml in hybridization buffer)
(Shimamura et al., 1994
) were
heated to 70°C for 10 minutes and then incubated on sections at 60°C
overnight. The rest of the protocol was performed as previously described
(Myat et al., 1996
). Following
NBT/BCIP reaction, sections were stained for BrdU. To do this, sections were
washed with 2 N HCl for 45 minutes then neutralized with several PBST washes.
The anti-BrdU antibody (Molecular Probes) was added at 1:10 dilution and
incubated at 37°C for 30 minutes. After three changes of PBST, Cy3 goat
anti-mouse (Chemicon) secondary antibody was added at 1:500 dilution and
incubated for 30 minutes at 37°C. The samples were washed three times with
PBST and stained with 15 µg/µl Hoechst solution for 3 minutes at room
temperature, to visualize nuclei. After three final washes in PBST, sections
were mounted in FluorSave (CalBioChem) containing 2% DABCO.
DNA constructs
A partial open reading frame of Xbh1 cloned in pGEM3Z vector was
kindly provided by Dr P. Krieg (University of Texas), lacking the first two
codons at the N-terminal domain. The two missing codons were restored by
performing a RT-PCR reaction on cDNA from stage 31 Xenopus embryos. A
forward primer (AAGAATTCTTGTGTCTGAACTGGA), with an additional
EcoRI site, and a reverse primer (CGGTTCCATAGTGACTGATAT) were used to
amplify a region spanning from nucleotide (nt) -24 to nt 265 of the published
Xbh1 open reading frame (ORF)
(Patterson et al., 2000
),
containing a SacI restriction site at nt 227. The resulting PCR
fragment was EcoRI/SacI digested and cloned into
pGEM3ZXbh1 linearized with EcoRI and SacI, thereby
restoring the complete ORF. Xbh1 full-length ORF was afterwards
subcloned into the EcoRI/XbaI site of pCS2+.
The Xbh1Vp16 construct was generated by PCR cloning by in frame
fusion of an Xbh1 fragment spanning the N-terminal domain, the two
FIL peptides and the homeodomain (AA residues 1-282), into the ClaI
site of pCS2/VP16 (Kessler,
1997
) (primers used: forward,
CCATCGATGAATTCTTGTGTCTGAACTGGA; reverse,
CCATCGATATAATTGCCGGCTTCGGCTAG).
The Xbh1EngR was constructed by in-frame PCR cloning (forward,
AAGAATTCTTGTGTCTGAACTGGA; reverse,
CGGAATTCAATAATTGCCGGCTTCGGCTAG) of the same Xbh1 fragment (AA
1-282) into the EcoRI site of pCS2/EnR
(Kessler, 1997
).
Microinjection of in vitro transcribed mRNA
Capped synthetic mRNAs were generated by in vitro transcription of
linearized plasmids using SP6 or T7 Cap Scribe kits (Roche). For animal caps
experiments, 250-1000 pg of mRNA of Xbh1, Xbh1EngR, Xbh1VP16, Xath3,
Xath5 and XneuroD constructs were injected into the animal
region of 2-cell-stage embryos, using a Drummond `Nanoject' apparatus. Embryos
were injected in 0.1xMMR and 4% Ficoll 400, and cultured overnight at
14°C in the same solution. Animal caps were then dissected at stage 9 and
grown to stage 28 in 0.5xMMR before processing for RT-PCR. As controls
for staging animal caps, sibling embryos were grown in 0.1xMMR.
RNA extraction and RT-PCR analysis
RNA extraction and RT-PCR were performed as described in Lupo et al.
(Lupo et al., 2002
). Primers
used were as follows: Xbh1, ATGGAAGGATCCAGCTTTGGGATA (forward) and
GATATGGGCGAAGATGGGGAG (reverse); Xbrn3.0, TTGATCTCTACCTCGGCCCAT
(forward) and TGAGTCGCAGATAGACGCCAA (reverse); Xbrn3d,
GATGACACTTTGCTTAGAGGA (forward) and GCCATGTGGTTAATGGCTGA (reverse);
Xath3, GAGAGGTTCCGTGTCCGTAG (forward) and GCTTGTTGGCTGAGAAAGACC
(reverse); and Xath5, ATCGTTACCTGCCCCAGACT (forward) and
CTTGGCTTTTCCAGTGTTCC (reverse). ODC primers were from Bouwmeester et
al. (Bouwmeester et al., 1996
).
PCR conditions were as described by Hutcheson and Vetter
(Hutcheson and Vetter, 2001
),
except for ODC (Lupo et al.,
2002
).
| Results |
|---|
|
|
|---|
|
Xbh1 is expressed in postmitotic retinal precursors in the central CMZ
The expression of Xbh1 in the retina is reminiscent of the
dorsoventral pattern of neurogenesis, but starts at slightly later stages than
has been reported for the onset of retinal differentiation
(Holt et al., 1988
;
Stiemke and Hollyfield, 1995
).
The CMZ recapitulates in cellular and molecular terms the temporal sequence of
retinal differentiation, and can be roughly subdivided into three main regions
(Perron et al., 1998
)
(Fig. 2A): the peripheral-most
region harbors the youngest proliferating retinal stem cells; the undetermined
proliferating retinoblasts are located more towards the center; and
postmitotic retinoblasts that are about to undergo the differentiation process
are found in the central-most part of the CMZ. Consistently, genes expressed
early during neurogenesis are expressed in the peripheral-most region of the
CMZ, whereas later genes are expressed more centrally in the CMZ
(Perron et al., 1998
). We
focused on Xbh1 expression in the CMZ more in detail, and determined
its temporal expression with respect to retinal neurogenesis, using
Xath5 and BrdU incorporation as molecular landmarks. Within the CMZ,
Xath5 is expressed in a region containing cells in transition between
proliferating and postmitotic retinoblasts
(Perron et al., 1998
) (see
Fig. 2A).
|
Xath5 is able to regulate Xbh1, which in turn regulates Xbrn3 genes
The fact that Xath5 expression precedes and later partially
overlaps Xbh1 expression in the CMZ (see also
Fig. 2A), suggests a possible
regulatory interaction. We used the animal cap assay to investigate whether
Xbh1 can be transcriptionally regulated by Xath5.
One-cell-stage embryos were injected into the animal pole with 1 ng of
Xath5 RNA. Animal caps were cut at blastula stage, harvested at stage
28, and processed for RT-PCR assays to detect possible activation of
Xbh1, and of the ganglion cell markers Xbrn3.0 and
Xbrn3d, the earliest markers of RGCs, known as Xath5
downstream genes (Hutcheson and Vetter,
2001
; Perron et al.,
1998
). Xath5 is able to activate Xbh1, Xbrn3d
and Xbrn3.0 transcription in injected animal caps, whereas none of
these genes was transcribed in control caps
(Fig. 2B). We also found that
Xath3 is able to activate Xbh1, as well as Xbrn3.0
and Xbrn3d (Fig. 2B).
Interestingly, injection of 500 pg of XneuroD mRNA, although able to
trigger Xbrn3d in animal caps
(Hutcheson and Vetter, 2001
),
was not able to activate Xbh1 expression
(Fig. 2B). This suggests that
Xbh1 transcription may be specifically controlled by atonal-like
factors, but not by any bHLH factor.
To test whether Xbh1 could activate Xbrn3.0 and Xbrn3d, we injected 1 ng of RNA encoding Xbh1 into 1-cell-stage embryos and assayed for the expression of Xbrn3 genes in stage 28 animal caps. We found that Xbh1 triggers both Xbrn3.0 and Xbrn3d transcription in animal caps (Fig. 2C). We also tested whether Xbh1 was able to activate Xath5 and/or Xath3 in animal caps. We found that Xbh1 does not activate Xath5, but does activate Xath3 transcription (Fig. 2C).
Xbh1 promotes ganglion cell fate and represses photoreceptor cell fate in early RPCs
The expression pattern and the results of the animal cap assay suggest that
Xbh1 may be involved in the specification of RGCs. To investigate
this, we lipofected a pCS2 DNA construct encoding Xbh1, together with
a similar construct encoding GFP, into the presumptive eye region of stage
17-18 embryos (Holt et al.,
1990
). We subsequently analyzed the progeny of early transfected
cells in retinae of stage 42 embryos, when most cells in the central retina
are postmitotic and fully differentiated
(Holt et al., 1988
;
Stiemke and Hollyfield, 1995
).
Compared with controls, retinae lipofected with Xbh1 cDNA exhibited a
significant increase in the percentage of RGCs, together with a significant
decrease of photoreceptor cells (Fig.
3A-C). No significant variations in the frequency of other cell
types were observed instead. Significantly, Xbh1-lipofected cells in
the RGC layer showed GFP-labeled axons clearly extending into the optic nerve,
demonstrating that they are indeed ganglion cells
(Fig. 3D).
|
|
|
|
To further corroborate these data, we tested whether the Xbh1Vp16
construct was able to suppress Xath5 induction of Xbrn3d in
animal cap assays. We confirmed that Xath5 is able to elicit
Xbrn3d expression in animal caps
(Hutcheson and Vetter, 2001
)
(Fig. 6E), and that this effect
is suppressed by co-injection of Xbh1Vp16
(Fig. 6E), suggesting that
Xath5 requires Xbh1 function to activate
Xbrn3d.
Xbh1 promotes ganglion cell fate in late lipofections
Timing of expression of bHLH factors is important for retinal cell fate
specification. For instance, early lipofection of Xath5 at stage
17-18 promotes ganglion cell fate in Xenopus, whereas lipofection at
stage 26 promotes bipolar cells and photoreceptors
(Kanekar et al., 1997
;
Moore et al., 2002
). This
suggests that, at least in some cases, bHLH factors may not have a strong
instructive role, but rather that their in vivo action may largely depend on
the temporal window of their activity
(Moore et al., 2002
). We
therefore decided to assay whether lipofection of Xbh1 at stage 25-26
had similar effects as early lipofections. We found that lipofection of
Xbh1 at late stage led to a significant increase in the frequency of
RGCs, but had no significant effect on other cell types
(Fig. 7A-C).
|
| Discussion |
|---|
|
|
|---|
Although Ath5 is essential for establishing the competence of retinal
precursors to acquire a RGC fate, increasing evidence suggests that other
factors may be required to specify RGC fate in addition to Ath5
(Moore et al., 2002
;
Ohnuma et al., 2002
;
Yang et al., 2003
). In this
study, we introduce Xbh1 as a new factor potentially involved in this process.
In different vertebrate species, homologues of the Drosophila
homeobox BarH genes are expressed in ganglion cells during the retinal
differentiation process (Patterson et al.,
2000
; Poggi et al.,
2002
; Saito et al.,
1998
), thus suggesting that they may regulate RGC formation.
We observed a tight correlation between the expression of Xbh1 and
that of the proneural gene Xath5 during retinal neurogenesis. In the
CMZ, where retinal neurogenesis is recapitulated, Xath3 and
Xath5 mark a cell population in transition from proliferating
retinoblasts to differentiating retinal neurones
(Perron et al., 1998
). We show
that Xbh1 expression in the CMZ is more centrally located than the
expression of Xath5 and only partially overlaps with that of
Xath5, being restricted nearly exclusively to postmitotic cells.
Because of the genetic and cellular organization of the CMZ
(Perron et al., 1998
), a
temporal and hierarchical relationship was suggested between Xath5,
expressed earlier and more peripherally, and Xbh1, expressed later
and more centrally. We found that both Xath5 and Xath3 can
indeed positively regulate Xbh1 transcription in animal cap assays.
This may not be a general effect of any bHLH, as XneuroD was not able
to activate Xbh1 in the same assay. Moreover, in animal caps,
Xbh1 itself is able to elicit transcription of Xbrn3
genes.
Our functional studies demonstrate that Xbh1 regulates RGC formation in the retina. In fact, in vivo targeted overexpression of Xbh1 in developing RPCs strongly biases this population toward ganglion cell fate. These results are further corroborated by lipofection experiments performed with the Xbh1Vp16 construct, which represents a dominant-negative form of Xbh1, and the oppositely acting Xbh1EngR. Early lipofections with the Xbh1EngR construct exhibit an increased number of ganglion cells together with a decrease in the number of photoreceptors (similar to the wild-type construct); on the contrary, retinae transfected with the Xbh1Vp16 construct displayed an increase of photoreceptors together with a decrease of ganglion cells. Consistent with these data are the results obtained in animal caps injected with RNA from the same constructs, either singly or in combination: whereas both wild-type Xbh1 and Xbh1EngR trigger Xbrn3d expression, a dominant-negative effect is exerted by Xbh1VP16 on either Xbh1 or Xbh1EngR. These results suggest that Xbh1 acts as a transcriptional repressor in retinal precursors to regulate a switch towards ganglion cell fate.
Because of the particular combination of transcription factors being
expressed in each region of the CMZ, as well as in each layer of the central
retina, it has been proposed that retinal cell types are specified by the
combinatorial action of several specific genes
(Perron et al., 1998
).
Therefore, the competence for a particular cell fate might result from a
balance between several positive and negative influences concomitantly acting
at a given time on one cell. Interestingly, recent studies suggest that
Xath5 ability to promote RGC determination may be modulated by the
presence of agonistic and antagonistic factors present in retinal precursors
at different times of retinal neurogenesis
(Moore et al., 2002
;
Ohnuma et al., 2002
).
Particularly, recent evidence shows that Xath5 alone is not
sufficient to promote RGC specification when misexpressed in later RPCs. In
this respect, Xbh1 might constitute a factor cooperating with Xath5 to bias
late RPCs towards a ganglion cell fate. Indeed, we show that Xbh1
strongly enhances the RGC promoting activity of Xath5, but not of
Xath3. Conversely, the Xbh1Vp16 activator construct inhibits
the ability of both Xath5 and Xath3 to bias RPCs towards a
ganglion cell fate. Taken together, these results suggest that Xbh1
may specifically potentiate Xath5, rather than Xath3, action
to enhance ganglion cell fate, but, nonetheless, Xbh1 also seems to
be required for Xath3 ganglion cell-promoting activity. Consistent
with the lipofection results is the observation that Xbh1Vp16 mRNA is
able to block the activation of Xbrn3d by Xath5 in animal
caps. Altogether, these data suggest that repression of Xbh1 target
genes is required to promote RGC fate, and for the activation of
Xbrn3 genes by Xath5, and indicate a genetic hierarchy
regulating RGCs formation, with Xath5 being epistatic to
Xbh1, which in turn is epistatic to Xbrn3 factors. Finally,
the observation that the effect of Xbh1Vp16 in suppressing RGCs seems
much weaker on its own than when co-lipofected with Xath5 may suggest
that some RGCs are specified in a Xath5/Xbh1-independent pathway;
indeed, small populations of Ath5-independent RGCs are present in
mouse and zebrafish (Brown et al.,
1998
; Wang et al.,
2001
).
Our study demonstrates important differences between Xath5 and
Xbh1. Whereas Xath5 is expressed in early retinal
precursors, with wider developmental potential, Xbh1 expression is
found in later precursors, whose competence is presumably more restricted (see
also Harris, 1997
;
Livesey and Cepko, 2001
).
Consistently, the action of Xbh1 is different from that of
Xath5. In fact, Xath5 has a broader range of effects:
whereas it promotes ganglion cell fate in early RPCs, it promotes late retinal
fates at later stages (Kanekar et al.,
1997
; Moore et al.,
2002
). In this sense, Xath5 may not instruct ganglion
cell fate per se, but only permit precursors to exit the cell cycle; the
actual retinal cell fate would be dictated by the repertoire of other factors
co-expressed in the cell (Moore et al.,
2002
). Consistent with this is the recent demonstration that
Math5-expressing cells give rise to multiple retinal cell types, and
not only to RGCs, in the mouse retina
(Yang et al., 2003
). Similar
to Xath5, Xbh1 promotes ganglion cell fate in early RPCs. In contrast
to Xath5, Xbh1 increases RGCs also at later stages, without
significant variation in the other cell types. However, it may be interesting
to note that if bipolar and Müller cells are ranked together, as a unique
population of late born cells, their diminution becomes statistically
significant (P=0.026), and appears to compensate for the increase in
RGCs (about 9% of the total GFP-positive cells). Thus, in late lipofections,
Xbh1 favours RGCs at the expense of late retinal cell fates. If the
increase of RGCs was due to a later effect on differentiation/maintenance
(e.g. a selective cell death protective effect on RGCs compared with other
cell types), then the observed decrease of late cell types only would be less
likely. In conclusion, although we cannot exclude a later role for
Xbh1, our lipofection data suggest that Xbh1 regulates cell
fate by restricting the state of competence in retinal precursors or by
providing them with more instructive cues that commit them to a RGC fate.
Although Xbh1 has a definite RGC-promoting activity and is
regulated by Xath5, it may not mediate all of the abilities of
Xath5. For example, Xath5 has a bipolar and
photoreceptor-promoting activity in later RPCs
(Kanekar et al., 1997
;
Moore et al., 2002
), which is
not shared by Xbh1. These different activities may in part depend
upon gene sets that Xath5, but not Xbh1, is able to
regulate; in addition, they may in part depend on competence changes in RPCs
during retinogenesis. In molecular terms, the competence could be thought of
as the complement of factors that cooperate with Xath5 to refine its action.
Our data suggest that Xbh1 is one such factor, acting for a more specific cell
commitment to RPCs, once they have been specified to become neurones by the
proneural genes. Both the results of combined Xath5 and Xbh1
lipofections, in which more than 60% of early RPCs are driven to a RGC fate,
and of the late lipofections, are completely consistent with this. The later
activities of Xath5, and of other bHLH factors involved in cell fate
specification within the retina, may instead involve other cooperative
factors, such as Chx10 or Xotx2, which were shown to favour bipolar cell fate
(Hatakeyama et al., 2001
;
Viczian et al., 2003
), or Crx
and Xotx5b, which are involved in photoreceptor specification and
differentiation (Furukawa et al.,
1997
; Furukawa et al.,
1999
; Viczian et al.,
2003
).
Interestingly, a switch role played by BarH1/BarH2 in the choice
between different types of cells has been described in the external sensory
organs and photoreceptors in Drosophila. When both Bar genes are
deleted in the Drosophila notum, papillae are transformed into hairs,
whereas the ubiquitous expression of one of them turns hairs into papillae.
Analogously, overexpression of BarH1 in the eye region transforms
cones into R1/R6 photoreceptors, whereas deletion of BarH1/BarH2
function in the eye transforms R1/R6 photoreceptors into cone cells
(Higashijima et al., 1992a
;
Higashijima et al., 1992b
;
Sato et al., 1999
).
In spite of some similarities in their activity as a switch for cell fate
determination, the exact correspondence between the role of BarH genes in the
eye of Drosophila and of vertebrates is not clear, as are the
possible homologies of morphological components of the eye in different
organisms. Recent data in Platynereis dumerilii have suggested that
rhabdomeric photoreceptors of ancestral invertebrates may correspond to
vertebrate RGCs, with which they share a common origin from
atonal-expressing precursors and expression of orthologous
r-opsin and six1/2 genes
(Arendt et al., 2002
;
Arendt and Wittbrodt, 2001
). A
possible interpretation of this view could be that all photoreceptors of
Drosophila, being rhabdomeric, correspond to vertebrate ganglion
cells. A different view suggests that only R8 photoreceptors of
Drosophila are homologous to vertebrate RGCs, as only specification
of R8 directly requires the atonal gene
(Frankfort and Mardon, 2002
).
In this context, data on Drosophila BarH1 may not resolve this issue,
as this gene is only expressed in R1/R6, and not in other photoreceptors
including the atonal-positive R8. However, it is possible that
Drosophila represents a rather divergent model, and that study of
BarH1 homologues in more primitive and generalized systems will help
in reconstructing the possible descendance of vertebrate ganglion cells during
evolution.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Arendt, D. and Wittbrodt, J. (2001). Reconstructing the eyes of Urbilateria. Phil. Trans. Roy. Soc. Lond. Ser. B. 356,1545 -1563.
Arendt, D., Tessmar, K., Medeiros de Campos-Baptista, M.-I.,
Dorresteijn, A. and Wittbrodt, J. (2002). Development of
pigment-cup eyes in the polychaete Platynereis dumerilii, and evolutionary
conservation of larval eyes in Bilateria. Development
129,1143
-1154.
Bouwmeester, T., Kim, S., Sasai, Y., Lu, B. and De Robertis, E. M. (1996). Cerberus is a head-inducing secreted factor expressed in the anterior endoderm of Spemann's organizer. Nature 382,595 -601.[CrossRef][Medline]
Brown, N. L., Kanekar, S., Vetter, M. L., Tucker, P. K., Gemza, D. L. and Glaser, T. (1998). Math5 encodes a murine basic helix-loop-helix transcription factor expressed during early stages of retinal neurogenesis. Development 125,4821 -4833.[Abstract]
Brown, N. L., Patel, S., Brzezinski, J. and Glaser, T.
(2001). Math5 is required for retinal ganglion cell and optic
nerve formation. Development
128,2497
-2508.
Bulfone, A., Menguzzato, E., Broccoli, V., Marchitiello, A.,
Gattuso, C., Mariani, M., Consalez, G. G., Martinez, S., Ballabio, A. and
Banfi, S. (2000). Barhl1, a gene belonging to a new subfamily
of mammalian homeobox genes, is expressed in migrating neurons of the CNS.
Hum. Mol. Gen. 9,1443
-1452.
Cepko, C. L., Austin, C. P., Yang, X. J. and Alexiades, M.
(1996). Cell Fate Determination in the Vertebrate Retina.
Proc. Natl. Acad. Sci. USA
93,589
-595.
Daga, A., Karlovich, C. A., Dumstrei, K. and Banerjee, U.
(1996). Patterning of cells in the Drosophila eye by Lozenge,
which shares homologous domains with AML1. Genes Dev.
10,1194
-1205.
Frankfort, B. J. and Mardon, G. (2002). R8 development in the Drosophila eye: a paradigm for neural selection and differentiation. Development 129,1295 -1306.
Fu, W. and Noll, M. (1997). The Pax2 homolog
sparkling is required for development of cone and pigment cells in the
Drosophila eye. Genes Dev.
11,2066
-2078.
Furukawa, T., Morrow, E. M. and Cepko, C. L. (1997). Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell 91,531 -541.[CrossRef][Medline]
Furukawa, T., Morrow, E. M., Li, T., Davis, F. C. and Cepko, C. L. (1999). Retinopathy and attenuated circadian entrainment in Crx-deficient mice. Nat. Genet. 23,466 -470.[CrossRef][Medline]
Gan, L., Xiang, M., Zhou, L., Wagner, D. S., Klein, W. H. and
Nathans, J. (1996). POU domain factor Brn-3b is required for
the development of a large set of retinal ganglion cells. Proc.
Natl. Acad. Sci. USA 93,3920
-3925.
Grant, P. and Rubin, E. (1980). Ontogeny of the retina and optic nerve in Xenopus laevis. II. Ontogeny of the optic fiber pattern in the retina. J. Comp. Neurol. 189,671 -698.[CrossRef][Medline]
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36,685 -695.[Medline]
Harris, W. A. (1997). Cellular diversification in the vertebrate retina. Curr. Opin. Genet. Dev. 7, 651-658.[CrossRef][Medline]
Hatakeyama, J., Tomita, K., Inoue, T. and Kageyama, R. (2001). Roles of homeobox and bHLH genes in specification of a retinal cell type. Development 128,1313 -1322.[Abstract]
Higashijima, S., Kojima, T., Michiue, T., Ishimaru, S., Emori,
Y. and Saigo, K. (1992a). Dual Bar homeobox genes of
Drosophila required in two photoreceptor cells, R1 and R6, and primary pigment
cells for normal eye development. Genes Dev.
6, 50-60.
Higashijima, S., Michiue, T., Emori, Y. and Saigo, K.
(1992b). Subtype determination of Drosophila embryonic external
sensory organs by redundant homeo box genes BarH1 and BarH2. Genes
Dev. 6,1005
-1018.
Hirsch, N. and Harris, W. A. (1997). Xenopus Brn-3.0, a POU-domain gene expressed in the developing retina and tectum. Investigative Ophthalmol. Visual Sci. 38,960 -969.
Holt, C. E., Bertsch, T. W., Ellis, H. M. and Harris, W. A. (1988). Cellular determination in the Xenopus retina is independent of lineage and birth date. Neuron 1, 15-26.[CrossRef][Medline]
Holt, C. E., Garlick, N. and Cornel, E. (1990). Lipofection of cDNAs in the embryonic vertebrate central nervous system. Neuron 4,203 -214.[CrossRef][Medline]
Hutcheson, D. A. and Vetter, M. L. (2001). The bHLH factors Xath5 and XNeuroD can upregulate the expression of XBrn3d, a POU-homeodomain transcription factor. Dev. Biol. 232,327 -338.[CrossRef][Medline]
Kanekar, S., Perron, M., Dorsky, R., Harris, W. A., Jan, L. Y., Jan, Y. N. and Vetter, M. L. (1997). Xath5 participates in a network of bHLH genes in the developing Xenopus retina. Neuron 19,981 -994.[CrossRef][Medline]
Kay, J. N., Finger-Baier, K. C., Roeser, T., Staub, W. and Baier, H. (2001). Retinal ganglion cell genesis requires lakritz, a zebrafish atonal homolog. Neuron 30,725 -736.[CrossRef][Medline]
Kessler, D. S. (1997). Siamois is required for
formation of Spemann's organizer. Proc. Natl. Acad. Sci.
USA 94,13017
-13022.
Kojima, T., Ishimaru, S., Higashijima, S., Takayama, E.,
Akimaru, H., Sone, M., Emori, Y. and Saigo, K. (1991).
Identification of a different-type homeobox gene, BarH1, possibly causing Bar
(B) and Om(1D) mutations in Drosophila. Proc. Natl. Acad. Sci.
USA 88,4343
-4347.
Kumar, J. P. (2001). Signalling pathways in Drosophila and vertebrate eye development. Nat. Rev. Genet. 2,846 -857.[CrossRef][Medline]
Lillien, L. (1998). Neural progenitors and stem cells: mechanisms of progenitor heterogeneity. Curr. Opin. Neurobiol. 8,37 -44.[CrossRef][Medline]
Liu, W., Khare, S. L., Liang, X., Peters, M. A., Liu, X., Cepko, C. L. and Xiang, M. (2000). All Brn3 genes can promote retinal ganglion cell differentiation in the chick. Development 127,3237 -3247.[Abstract]
Liu, W., Mo, Z. and Xiang, M. (2001). The Ath5
proneural genes function upstream of Brn3 POU domain transcription factor
genes to promote retinal ganglion cell development. Proc. Natl.
Acad. Sci. USA 98,1649
-1654.
Livesey, F. J. and Cepko, C. L. (2001). Vertebrate neural cell-fate determination: lessons from the retina. Nat. Rev. Neurosci. 2,109 -118.[CrossRef][Medline]
Lupo, G., Harris, W. A., Barsacchi, G. and Vignali R.
(2002). Induction and patterning of the telencephalon in
Xenopus laevis. Development
129,5421
-5436.
Marquardt, T. and Gruss, P. (2002). Generating neuronal diversity in the retina: one for nearly all. Trends Neurosci. 25,32 -38.[CrossRef][Medline]
Marquardt, T., Ashery-Padan, R., Andrejewski, N., Scardigli, R., Guillemot, F. and Gruss, P. (2001). Pax6 is required for the multipotent state of retinal progenitor cells. Cell 105, 43-55.[CrossRef][Medline]
Masai, I., Stemple, D. L., Okamoto, H. and Wilson, S. W. (2000). Midline signals regulate retinal neurogenesis in zebrafish. Neuron 27,251 -263.[CrossRef][Medline]
Matter-Sadzinski, L., Matter, J.-M., Ong, M.-T., Hernandez, J. and Ballivet M. (2001). Specification of neurotransmitter receptor identity in developing retina: the chick ATH5 promoter integrates the positive and negative effects of several bHLH proteins. Development 128,217 -231.[Abstract]
Moore, K. B., Meredith, S. L. and Vetter, M. (2002). Posttranslational mechanisms control the timing of bHLH function and regulate retinal cell fate. Neuron 34,183 -195.[CrossRef][Medline]
Myat, A., Henrique, D., Ish-Horowicz, D. and Lewis, J. (1996). A chick homologue of Serrate and its relationship with Notch and Delta homologues during central neurogenesis. Dev. Biol. 174,233 -247.[CrossRef][Medline]
Neumann, C. J. and Nuesslein-Volhard, C.
(2000). Patterning of the zebrafish retina by a wave of sonic
hedgehog activity. Science
289,2137
-2139.
Nieuwkoop, P. D. and Faber, J. (1967).Normal table of Xenopus laevis (Daudin). Amsterdam: North Holland.
Ohnuma, S., Hopper, S., Wang, K. C., Philpott, A. and Harris, W. A. (2002). Co-ordinating retinal histogenesis: early cell cycle exit enhances early cell fate determination in the Xenopus retina. Development 129,2435 -2446.
Patterson, K. D., Cleaver, O., Gerber, W. V., White, F. G. and Krieg, P. A. (2000). Distinct expression patterns for two Xenopus Bar homeobox genes. Dev. Genes Evol. 210,140 -144.[CrossRef][Medline]
Perron, M., Kanekar, S., Vetter, M. L. and Harris, W. A. (1998). The genetic sequence of retinal development in the ciliary margin of the Xenopus eye. Dev. Bi