|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online May 5, 2004
doi: 10.1242/10.1242/dev.01133


1 Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry Russian Academy of
Sciences, Moscow, Russia
2 University of Virginia, Department of Biology, Charlottesville, VA 22904,
USA
Authors for correspondence (e-mail:
zar{at}humgen.siobc.ras.ru
and
rmg9p{at}virginia.edu)
Accepted 11 December 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Homeobox, Fluorescent proteins, Neural plate, Regulation of spatial expression, Transgenic embryos, Anterior posterior patterning, Xenopus
| Introduction |
|---|
|
|
|---|
Recently, we demonstrated by a luciferase reporter assay that deleting a 14
bp element in the Xanf1 promoter results in increased reporter
expression within the prospective hindbrain
(Eroshkin et al., 2002
). By use
of transgenic embryos in conjunction with a novel bi-colour fluorescent
reporter technique, we show now that this posterior increase in reporter
expression is a result of expansion of the expression posterior to normal
expression zone of Xanf1. Using the crucial cis-regulatory element as
the target in yeast one-hybrid system, we identified two transcription
factors, FoxA4a/Pintallavis (Knochel et
al., 1992
; Ruiz i Altaba et
al., 1993
; Kaestner et al.,
2000
) and Xvent2 (also known as Xvent-2)
(Onichtchouk et al., 1997
),
that can bind to the element and act as Xanf1 repressors posterior to
its natural expression limit.
| Materials and methods |
|---|
|
|
|---|
The resulting PCR fragments were cut with HindIII and BamHI (blunted), and cloned into HindIII and EcoRI (blunted) sites of the RFP cassette of the bi-colour vector. To generate the one-reporter vector, the same fragments of the Xanf1 promoter were cloned into the pEGFP-1 promoter reporter vector (Clontech).
All the reporter vectors were linearised with SfiI and purified on
Qiagen columns. Transgenic embryos bearing these vectors were prepared by the
nuclear transplantation technique as described
(Offield et al., 2000
).
Yeast one-hybrid screening
To prepare the reporter strain bearing the target sequence, the following
oligomers containing this sequence, along with flanking restriction sites,
were annealed and sequentially inserted three times into pHisi and pLacZi
reporter vectors (Clontech Laboratories) upstream of the reporters HIS3 and
lacZ, respectively:
5'-aattcatgtcgacTGCTAATTACACACCAAACAAATAAACAATTAAC and
5'-tcGAGTTAATTGTTTATTTGTTTGGTGTGTAATTAGCAgtcgacatg.
The resulting pHisi and pLacZi reporter plasmids were sequentially integrated into the genome of the YM4271 yeast strain (Matchmaker one-hybrid system) at HIS3 and URA3 loci, respectively. As the resulting reporter strains in YM 4271 carry deletions of wild-type genes required for activation of the Gal1 promoter used in the gastrula cDNA expression library (LexA yeast two-hybrid system), they were mated with the Egy48 strain (Ade- and Tyr-) from the LexA two-hybrid system that can drive expression of the library-encoded protein from the Gal1 promoter. The resulting strain could grow on a selective medium (-Ade/-His/-Tyr/-Ura) because of leaky HIS3 expression but was completely suppressed on this medium in the presence of 80 mM 3-aminothriasol (3-AT). This strain containing the 36 bp element as the target was transformed with the Xenopus laevis embryo stage 12 Matchmaker LexA cDNA library in a pB42 AD cloning vector (Clontech Laboratories). Transformants were plated on selective medium (-Ade/-His/-Trp/-Tyr/-Ura) containing 80 mM 3-AT that allowed growth of only those colonies in which the HIS3 reporter gene appeared to be activated by transcription factors binding with the 36 bp target sequence. To eliminate false positives, we tested lacZ reporter gene expression in colonies grown on the selective medium by a ß-galactosidase filter assay. Plasmids containing cDNA inserts from the Xenopus stage 12 library were isolated from selected yeast colonies and re-transformed into E. coli for sequencing.
Gel-shift analysis
Xenopus laevis oocytes microinjected with mRNA encoding EGFP,
FoxA4a/Pintallavis or Xvent2 (10 ng/oocyte) and incubated 48 hours in OR-2
solution were disrupted by pipetting in EMSA buffer (100 mM KCl, 0.25 mM EDTA,
0.2 mM EGTA, 20% glycerol, 100 mg/ml BSA, 20 mM HEPES pH 7.9 and a protease
inhibitor cocktail containing chymostatin, leupeptin, pepstatin and PMSF each
at final concentration of 10 µg/ml) in a volume of 10 µl/oocyte and
centrifuged at 13,400 g for 5 minutes at 4°C. The oocyte
extract (10 µl) was diluted with EMSA buffer (sevenfold and twofold for
FoxA4a/Pintallavis and Vent2 respectively) were mixed with 2 µg of
Poly(dI-dC) and incubated at 4°C for 15 minutes. The following double
stranded oligomers were used for the EMSA: 5'-tctgtcccaTGCTAATTACACAC
(`14 bp element'); 5'-tctgcatgtcgaCAAACAAATAAACAATTAACTCga (`22 bp
element'). Mutated oligomers were:
5'-tctgtcccaTGCTACGTCCACAC and
5'-tctgtcccaTGCTATTTACACAC for the 14 bp element;
5'-tctgcatgtcgaCAAACAAATAAACAAGTAACTCga and
5'-tctgcatgtcgaCAAAAAAAAAAACAATTAACTCga for the 22
bp element. Each oligomer (50 pmol) was 32P-end-labelled with T4
polynucleotide kinase, added to oocyte extract (15,000 cpm for one reaction)
and incubated at 4°C for 40 minutes. The final volume was adjusted to 15
µl with EMSA buffer. The reaction products were immediately loaded on a 6%
polyacrylamide gel containing 0.5 TBE and run for 50-60 minutes at constant
current (100 mA).
Preparation of constructs and mRNA for microinjections
To prepare vectors for synthesis of mRNA of FoxA4a/Pintallavis and Xvent2,
their full-length coding sequences were obtained by RT-PCR with the following
pairs of primers: Xvent2 forward,
5'-agaaccgctcgccaccATGACCAAAGCTTTCTCCTCAGTAG; Xvent2 reverse,
5'-ttagtcgacAGGCCAGAGACTGCCCAA; FoxA4a/Pintallavis forward,
5'-agaaccgGTGGACTCCAGAACATGCTA; FoxA4a/Pintallavis reverse,
5'-ttactcgagGGGAGCTGAGGATAGGTCTG.
The PCR fragments were digested with AgeI and XhoI and
cloned into the pSP-EGFP plasmid instead of EGFP [see Ermakova et al.
(Ermakova et al., 1999
) for a
description of pSP-EGFP].
To prepare the P40 dominant-negative mutant of Xvent2, PCR was used to obtain two overlapping parts of the Xvent2 full-length coding sequence. The following pairs of primers were used: 5' fragment: 5'-agaaccgctcgccaccATGACCAAAGCTTTCTCCTCAGTAG and 5'-CTTCAGAAgGCTGGAGTTTGGCT; 3' fragment, 5'-GCCAAACTCCAGCcTTCTGAAGTCCAGA and 5'-ccggtcgaCTTAATAGGCCAGAGACTGCCCAAGGTGC.
The resulting PCR fragments were purified, mixed together, denatured at
96°C, annealed at 60°C and subjected to PCR with flanking primers. The
resulted PCR fragment, containing a mutant codon coding for P instead of L at
position 40 of the homeodomain, was digested with AgeI and
XhoI and cloned into pSP-EGFP
(Ermakova et al., 1999
). The
point mutation was confirmed by sequencing.
To prepare vectors coding for fusions of FoxA4a/Pintallavis and Xvent2 with the herpes virus VP16 activation domain or repression domain from Drosophila engrailed, we obtained, by PCR, fragments of FoxA4a/Pintallavis and Xvent2 cDNAs coding for DNA-binding regions of these proteins. The following pairs of primers were used: Xvent2 forward, 5'-agtggatCCAGCTAAAACTCCTACAACCA; Xvent2 reverse, 5'-aataagcttCTAATAGGCCAGAGACTGCCCAAGGTGC; FoxA4a/Pintallavis forward, 5'-ttagtcgacTGCTAAATAGAGTCAAATTGGAAA; and FoxA4a/Pintallavis reverse, 5'-cttctcgagAATGTTTAAAGGGAGCTGAGG.
In place of the Xanf1-BDGR cassette, the resulting two PCR fragments were
cloned into the pSP-VP16-Xanf1-BDGR and pSPEnR-Xanf1-BDGR plasmids [this
plasmid is described elsewhere (Ermakova et
al., 1999
)], into
BamHI/BamHI-HindIII/HindIII (for Xvent2)
and BamHI/BamHI-XhoI/SalI (for
FoxA4a/Pintallavis) sites.
To prepare plasmids coding for VP16-FoxA4a/Pintallavis-BDGR and VP16-Xvent2-BDGR, PCR fragments containing DNA binding segments of FoxA4a/Pintallavis and Xvent2 were obtained with the following pairs of primers: Xvent2 forward, 5'-agtggatCCAGCTAAAACTCCTACAACCA; Xvent2 reverse, 5'-aatctcgagCTAATAGGCCAGAGACTGCCCAAGGTGC; FoxA4a/Pintallavis forward, 5'-ttagtcgacTGCTAAATAGAGTCAAATTGGAAA; FoxA4a/Pintallavis reverse, 5'-ttactcgagGGGAGCTGAGGATAGGTCTG.
The resulting two PCR fragments were cloned, into a modified Xanf1 plasmid, pSP-VP16-Xanf1-BDGR, at BamHI/BamHI-XhoI/XhoI sites. All mRNAs were synthesised from linearised plasmids using the Ambion SP6 mRNA MESSAGE MACHINE kit and purified by QIAGEN RNeasy mini-columns. To test the activity of various mRNAs in embryos 50-250 pg of mRNA was injected per blastomere.
Design and microinjections of morpholino oligonucleotides
The following morpholino oligonucleotides were designed as suggested by the
manufacturer (Gene Tools, LLC) on the basis of BLAST analysis of the
Xenopus laevis NR and EST databases: for FoxA4a/Pintallavis
(5'-GAGGTATGGTTTCTCCAACAAGAAG) and for Xvent2
(5'-CTTGTCTGTATTAGTCCTTGTGTTC). A water solution (2-3 nl) containing
these oligonucleotides (from 1 mM to 0.01 mM in different experiments) was
microinjected into animal-dorsal blastomeres of Xenopus laevis
embryos at 8-32 blastomere stages.
| Results |
|---|
|
|
|---|
First, we tested reporter expression pattern driven by the `full-length'
(-2200 to +1) promoter of Xanf1
(Eroshkin et al., 2002
) using
transgenic embryos bearing pEGFP-1 or pDsRed reporter vectors. Ten percent of
normally developing tadpoles (more than 30 embryos in a total of three
experiments for each vector) demonstrated appropriate localisation of the EGFP
or DsRed signals, in that part of the brain derived from the neural plate
region where endogenous Xanf1 expression domain in the forebrain and
ventral part of the midbrain (not shown).
Interestingly, while Xanf1 expression ceases in normal development by the end of neurulation, because of the high stability of EGFP and DsRed proteins in living cells (Matz et al., 1999), EGFP and DsRed reporters driven by Xanf1 promoter, though becoming progressively weaker, could be visualised until tadpole stages, providing an integrative image of the Xanf1 expression.
To make further promoter deletion analysis more effective, we developed a novel method using a bicolour fluorescent reporter vector (Fig. 1). These vectors containing DsRed and EGFP cDNAs under the control of `full-length' (-2200 to +1) and deletion fragments (-510, -320, -203, -189, -167, -133) of the Xanf1 promoter, respectively, were prepared and used for generation of transgenic Xenopus tropicalis embryos. For each construct, 7-15 embryos (obtained in two or three independent experiments) that demonstrated the expected expression patterns of DsRed driven by the `full-length' promoter, were selected and analysed for spatial distribution of EGFP.
|
Identification of transcription factors binding to the Xanf1 promoter by the yeast one-hybrid system
To identify transcription factors that could bind with the 14 bp
cis-regulatory element of the Xanf1 promoter in living embryos, we
performed screening of a Xenopus late gastrula cDNA expression
library with a yeast one-hybrid system. We used as a target the 36 bp element
from the Xanf1 promoter that included, along with the 14 bp element
(TGCTAATTACACAC), the 22 bp element (CAAACAAATAAACAATTAACTC) abutting the 14
bp element from the proximal side. As it was shown previously, this 22 bp
element is important for the maintenance of moderate expression levels of
Xanf1 (Eroshkin et al.,
2002
). Ten unique clones encoding transcription factors were
identified in this screen: Dlx2, Dlx5, Hoxb9, Msx1, Nkx5.1,
FoxA4a/Pintallavis, Xvent1, Xvent2, Xanf1 and Xanf2 (see Materials and methods
for technical details).
Only two of these genes, FoxA4a/Pintallavis and Xvent2, have expression patterns consistent with those of hypothetical suppressors that could be responsible for posterior restriction of the Xanf1 expression: their expression domains in the neural plate are complementary to that of Xanf1. In the case of the homeobox gene Xvent2, the expression is along all the trunk part of the neural plate excluding the notoplate, bordering the expression zone of Xanf1 from the posterior and lateral sides (Fig. 2B,D). The fork-head gene FoxA4a/Pintallavis is expressed in a complementary pattern to Xvent2, within the notoplate, with the anterior tip of its expression domain contacting the central part of the posterior limit of the Xanf1 expression domain (Fig. 2C,E).
|
|
To further confirm specificity of binding of FoxA4a/Pintallavis with the 14
bp element, we inserted several point mutations that, according to the
literature (Kaufmann et al.,
1995
), should totally disrupt specific binding of this factor:
CTACGTC instead of CTAATTA. As a result, we observed
dramatic reduction of the EMS (Fig.
3C, lane 2). Reversion of GTAATTA to the consensus
FoxA4a/Pintallavis site, GTATTTA, increased the shift signal in
comparison with the intact 14 bp element
(Fig. 3C, lanes 3 and 4).
FoxA4a/Pintallavis and Xvent2 act as transcriptional repressors of Xanf1
To test if ectopic FoxA4a/Pintallavis and Xvent2 can downregulate
Xanf1 in vivo, we microinjected synthetic mRNA encoding these factors
mixed with the cell tracer fluorescein-lysine-dextran (FLD) into one or two of
the animal-most dorsal blastomeres of 32 cell embryos, the progeny of which
give rise predominantly to the neural plate and very rarely to the underlying
head mesoderm and endoderm (Bauer et al.,
1994
). These localised injections helped us to exclude effects of
a possible indirect influence of the microinjected FoxA4a/Pintallavis and
Xvent2 on the neurectoderm via effects on the inductive properties of the
underlying mesoderm.
At the early neurula stage, the embryos with an FLD signal within the anterior neural plate were selected and processed for whole-mount in situ hybridisation with the probe to Xanf1 mRNA. In order to visualise possible changes in the expression pattern of Xanf1 more precisely, we mixed Xanf1 probe with a probe encoding the midbrain/hindbrain boundary marker, engrailed 2.
In all of the embryos selected (37 embryos for FoxA4a/Pintallavis and 39 for Xvent2 in 4 independent experiments), we observed inhibition of Xanf1 expression in the neural plate cells containing ectopic FoxA4a/Pintallavis or Xvent2 mRNAs (Fig. 4A,A',B,B'). To assess the tissue distribution of the microinjected cells, we prepared histological sections of four embryos injected with each mRNA. In good agreement with the expected blastomere fate map, FLD-labelled cells were seen essentially exclusively within the ectoderm that always included regions where inhibition of the Xanf1 expression was seen (Fig. 4B1,B1'). Rarely, single labelled cells were seen in the underlying anterior endomesoderm. By contrast, in the same embryos, cells expressing Xanf1 in the normal pattern did not contain FLD and thus the microinjected mRNA (Fig. 4B2,B2'). All of these data confirm that the observed inhibition of Xanf1 by exogenous FoxA4a/Pintallavis and Xvent2 was not the result of their indirect influence via underling inducing tissue but was caused by direct action of these proteins within neurectodermal cells.
|
To further confirm that FoxA4a/Pintallavis and Xvent2 play roles as
Xanf1 transcriptional repressors, we microinjected mRNAs coding for
dominant-negative versions of these genes. Two types of dominant negatives
were used. First, we prepared mRNA coding for fusions of FoxA4a/Pintallavis or
Xvent2 with the activation domain of the herpes virus VP16 protein. Strong
positive transcriptional activation as a result of the latter domain should
result in the reversion of the repressor function of FoxA4a/Pintallavis and
Xvent2. Second, in the case of Xvent2, we also generated mRNA coding for the
protein with the point mutation, L/P, in position 40 of the homeodomain
(Xvent-P40). As shown previously, this mutant was able to neutralise activity
of the normal Xvent2 by forming a non-functional dimer with it, preventing DNA
binding (Onichtchouk et al.,
1998
; Trindade et al.,
1999
).
In these experiments, we observed an expansion of the Xanf1 expression zone within the areas occupied by descendants of medial animal blastomeres of the 32-cell embryos microinjected with mRNA of FoxA4a/Pintallavis and Xvent2 dominant-negative mutants (Fig. 4E,E',F,F',G,G'). However, cells ectopically expressing Xanf1 occupied only a part of the area populated by the microinjected cells (as evaluated in 31, 34 and 26 embryos in three independent experiments, respectively, for the VP16-FoxA4a/Pintallavis, Vent-P40 and VP16-Xvent2 constructs). Thus, within the neural plate, ectopic expression of Xanf1 expanded posteriorly only up to the prospective rostral part of the hindbrain, which was marked by engrailed 2 expression [Fig. 4E-G, compare positions of the Xanf1 expression posterior limits marked by the red (area of expanded expression) and black (area of normal expression) arrows].
As in the cases described above, histological sections of the experimental embryos (four embryos of each type were sectioned) confirmed that the observed effects were not resulting from influence of the dominant-negative constructs via underlying mesoderm (Fig. 4E1,E1').
To further validate the repressive role of FoxA4a/Pintallavis and Xvent2 in regulating Xanf1, we suppressed translation of their mRNAs by microinjections of antisense morpholino oligonucleotides. With the anti-FoxA4a/Pintallavis morpholino we observed posterior expansion of the Xanf1 expression area. Notably, the expression of Xanf1 spread toward the posterior only within the area of the prospective floor plate (arrows on Fig. 5A,A'), i.e. just in those regions where the expression of the endogenous FoxA4a/Pintallavis would be expected to be suppressed by the morpholino. By contrast, no expansion was seen when the morpholino-containing cells occupied the lateral parts of the neural plate, i.e. those areas in which FoxA4a/Pintallavis is never expressed in normal development (Fig. 5A,A', upper row of embryos). It is noteworthy, as in the case of dominant-negative constructs, ectopic expression of Xanf1 expanded posteriorly only up to the prospective rostral part of the hindbrain (compare with Fig. 4E-G), which might indicate the presence of some other transcription factors inhibiting expression of Xanf1 posterior to this limit.
|
Unfortunately, we were unable to obtain similar clear results with the anti-Xvent2 morpholino because the microinjected embryos failed to complete gastrulation. This effect, observed with high frequency (from 80% to 95% of embryos) through a wide range of anti-Xvent2 morpholino concentrations (from 1 to 0.1 mM), was usually accompanied by disintegration of the ectoderm into separate cells by the end of gastrulation. Nevertheless, in a low number of cases (five embryos out of 72 surviving embryos in two independent experiments), we still observed slight posterior expansion of the Xanf1 expression in embryos microinjected with 0.03 mM anti-Xvent2 morpholino (Fig. 5B,B'). Interestingly, in contrast to anti-FoxA4a/Pintallavis morpholino, the expansion of the Xanf1 expression was observed only in the lateral part of the neural plate, i.e. just in the region where endogenous Xvent2 was expressed. No expansion was seen in the midline, even if the morpholino-containing cells occupied this region of the embryo (see central and right embryos on Fig. 5B,B').
To assess the specificity of the morpholino effects, we tested the ability of the FoxA4a/Pintallavis and Xvent2 mRNAs from which sequences complementary to their respective morpholinos had been deleted to interfere with the effect of the posterior expansion of the endogenous Xanf1 expression elicited by the morpholinos. Because the morpholino oligonucleotides were complementary to the 5'-non-translated part of the endogenous mRNAs of FoxA4a/Pintallavis and Xvent2, we mixed them with synthetic mRNAs which contained only the reading frames of FoxA4a/Pintallavis and Xvent2 (final concentrations: 1 mM morpholino + 20 ng/ml of RNA for FoxA4a/Pintallavis and 0.03 mM of morpholino + 50 ng/ml of mRNA for Xvent2). Microinjections of these mixtures into embryos, resulted in, instead of expansion, inhibition of Xanf1 expression, which looked very similar to the inhibition elicited by injection of FoxA4a/Pintallavis and Xvent2 mRNAs alone (Fig. 5C for FoxA4a/Pintallavis and not shown for Xvent2). Importantly, in contrast to experiments with pure anti-Xvent2 morpholino, 50% of the microinjected embryos retained ectodermal integrity when this morpholino was microinjected, even at a concentration of 1 mM, in the mixture with the Xvent2 mRNA (50 ng/ml). All these results taken together confirm the specificity of the morpholino effects.
FoxA4a/Pintallavis and Xvent2 act directly on Xanf1 within embryonic cells
To verify if Xanf1 is the direct target for FoxA4a/Pintallavis and
Xvent2 within embryonic cells, we designed experiments with
dexamethasone-inducible versions of these proteins. We microinjected embryos
with mRNA coding for fusions of VP16-FoxA4a/Pintallavis or VP16-Xvent2 with
the binding domain of the glucocorticoid receptor (BDGR). Owing to
sequestration of BDGR by the hsp90 heat-shock protein complex, such fusion
proteins appear to be inactivated within the embryonic cells
(Gammill and Sive, 1997
;
Ermakova et al., 1999
). At the
end of gastrulation, the microinjected embryos were placed for 1 hour into a
10 mg/ml cycloheximide (CHX) solution. According to the literature
(Gammill and Sive, 1997
) and
our own data (Fig. 5D) this
period of time is enough to block the total protein synthesis by more than
90%. After this period, dexamethasone (DEX) was added to the same incubation
solution at a 2 µM final concentration, which resulted in release of the
previously accumulated VP16-FoxA4a/Pintallavis-BDGR and VP16-Xvent2-BDGR from
the hsp90 complex. Under these conditions, only direct targets of
FoxA4a/Pintallavis and Xvent2 should be activated because mRNA translation is
blocked by CHX. After 2 hours of incubation with CHX and DEX, the embryos were
processed for whole-mount in situ hybridisation. An expansion of the
Xanf1 expression area was observed in both cases (42 and 21 embryos
with the expanded Xanf1 expression were scored in two independent
experiments for VP16-FoxA4a/Pintallavis-BDGR and VP16-Xvent2-BDGR mRNA,
respectively), which verify a direct effect of VP16-FoxA4a/Pintallavis-BDGR
and VP16-Xvent2-BDGR proteins on the Xanf1 promoter
(Fig. 5E,F).
Interestingly, in the case of VP16-Xvent2-BDGR, the observed expansion of the Xanf1 expression was much broader than in experiments performed without CHX treatment (compare Fig. 5F with Fig. 4F). Thus, in all embryos, in which descendants of the microinjected cells extended along the neural plate, the area of abnormal expression of Xanf1 also spread along all the neural plate (Fig. 5F,F'). We surmise that the cycloheximide treatment resulted in rapid degradation of putative negative regulators of Xanf1 expression, which normally operate in the trunk part of the neural plate.
| Discussion |
|---|
|
|
|---|
FoxA4a/Pintallavis and Xvent2 play roles as transcriptional repressors of Xanf1 and determine the precise position of its posterior expression limit
Previously, we presented evidence that anterior localisation of
Xanf1 expression within the neural plate might be the result of
binding of transcriptional repressors, operating within more posterior areas
of the neural plate, interacting with a short regulatory region of the
Xanf1 promoter (Eroshkin et al.,
2002
). Now we demonstrate that two transcription factors, the
fork-head domain FoxA4a/Pintallavis and the homeodomain Xvent2, are sufficient
and essential for precise determination of the Xanf1 posterior
expression limit. This conclusion is based on their native expression
patterns, misexpression of mRNAs encoding these factors and variants
containing engrailed expression domains, as well as evidence from blocking
their expression both by morpholino oligonucleotides and dominant negative
constructs.
Interestingly, while FoxA4a/Pintallavis and its mammalian homologues,
members of the FoxA forkhead transcription factor family, have primarily been
thought to be transcriptional activators (for a review, see
Kaestner, 2000
), our
experiments reveal that they may act as transcriptional inhibitors as well.
Consistent with this proposal, it has been shown recently that mammalian
homolog of FoxA4a/Pintallavis, FoxA2 can bind TLE
(Wang et al., 2000
) or SMAD3
(Li et al., 2002
)
corepressors.
The other repressor of Xanf1 expression identified in this study,
Xvent2, was initially determined to be a transcriptional inhibitor of several
dorsally expressing genes (Schuler-Metz et
al., 2000
). Along with its paralog, Xvent1, Xvent2 is known to be
a key transcriptional regulator of the BMP4 cascade in the ventral part of
embryo (Ladher et al., 1996
;
Schmidt et al., 1996
;
Onichtchouk et al., 1998
). Now
we show that Xvent2 is also involved in controlling the early anteroposterior
patterning of the neural plate.
It is noteworthy that the nucleotide sequence of the cis-regulatory element
in the Xanf1 promoter that was studied here appears to be highly
conserved in Anf genes among highly diverged vertebrates, including
Xenopus, chick and human (Eroshkin
et al., 2002
) (Fig.
3D). This suggests that there is likely to be conservation of the
mechanism of suppression of Anf expression by orthologues of
FoxA4a/Pintallavis and Xvent2 in other vertebrates as well.
Interestingly, the closest relatives of vertebrates, hemichordates and all
lower animals, seemingly have no anatomical structures homologous to the brain
unit derived from the territory of the rostral neural plate in which
Anf genes are expressed in vertebrate embryos (for a review, see
Shimeld and Holland, 2000
).
Moreover, genomic data hint that the Anf type of homeobox
(Kazanskaya et al., 1997
)
itself might also be an evolutionary invention of vertebrates as this type of
homeobox is not seen among other animal groups, including the close relatives
of vertebrates, the ascidians. All of these results and observations allow one
to hypothesise that the appearance of Anf type of homeobox gene and
the mechanism ensuring rostral localisation of its expression via posterior
downregulation by FoxA4a/Pintallavis and Xvent2 progenitors might be crucial
steps in the evolution of the forebrain in vertebrates.
Negative regulation of Xanf1 posterior to its natural expression domain is consistent with the Nieuwkoop activation-transformation model of neural induction
In his famous model of neural induction, Nieuwkoop suggested that during
the first step of the induction all the presumptive neuroectoderm is activated
by the influence of the `early' Spemann organiser in initiating neural
development toward anterior fates
(Nieuwkoop and Nigtevecht,
1954
). At the second step, a signal emanating from the `later',
more posterior, Spemann organiser transforms the anterior potencies of the
trunk part of the neural plate into posterior fates
(Fig. 6A). An important finding
from Nieuwkoop's experiments is that signalling responsible for the activation
of the anterior potentials are still present in the posterior neural plate
even at the second step of neural induction, but its influence in this region
is masked by the influence of the transformation signalling.
|
However, in contrast to the massive shift of the reporter expression revealed in promoter deletion experiments, all dominant-negatives of FoxA4a/Pintallavis and Xvent2, as well as their antisense morpholinos, appeared to be able to elicit the posterior shift of the Xanf1 expression only up to the prospective midbrain-hindbrain boundary. This indicates that other repressors with much higher affinity to the same sites that bind FoxA4a/Pintallavis and Xvent2 might operate posterior to this boundary. Alternatively, these hypothetical repressors might bind to other sites within the promoter but have such a strong repressor potential that cannot be overcome by VP-16-FoxA4a/Pintallavis and VP-16-Xvent2. It is noteworthy as well that we observed a much wider posterior expansion of the Xanf1 expression under the conditions of inhibition of the total protein synthesis by cycloheximide. These results strengthen the argument for the presence of other posteriorly operating factors that normally inhibit Xanf1 expression in the trunk part of the neural plate.
Recently, we have shown that the Anf proximal promoter contains
core binding sites for two potential activators of this gene, namely Otx2 and
SoxD (Eroshkin et al., 2002
).
Consistent with this finding, Otx2 and SoxD were shown to be able to activate
Anf in embryonic tissues of the mouse and Xenopus
(Mizuseki et al., 1998
;
Rhinn et al., 1998
). Normally,
the expression domain of Xanf1 overlaps with the expression areas of
both these genes, which occupy broader territories in the neural plate.
Therefore, without the posterior repression exerted by FoxA4a/Pintallavis,
Xvent2 and possibly other factors, both Otx2 and SoxD would be able to
activate the expression of Xanf1 on a territory broader than its
natural expression domain. Again, this is consistent with key features of the
Nieuwkoop model, which predicts broad distribution of potential activator(s)
of anterior structures throughout the neural plate
(Fig. 6).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Bauer, D. V., Huang, S. and Moody, S. A. (1994). The cleavage stage origin of Spemann's Organizer: analysis of the movements of blastomere clones before and during gastrulation in Xenopus. Development 120,1179 -1189.[Abstract]
Chapman, S. C., Schubert, F. R., Schoenwolf, G. C. and Lumsden, A. (2002). Analysis of spatial and temporal gene expression patterns in blastula and gastrula stage chick embryos. Dev. Biol. 245,187 -199.[CrossRef][Medline]
Dattani, M. T., Martinez-Barbera, J. P., Thomas, P. Q., Brickman, J. M., Gupta, R., Mortensson, I. L., Toresson, H., Fox, M., Wales, J. K., Hindmarsh, P. C., Krauss, S., Beddington, R. S. and Robinson, I. C. (1998). Mutations in the homeobox gene HESX1/Hesx1 associated with septo-optic dysplasia in human and mouse. Nat. Genet. 19,125 -133.[CrossRef][Medline]
Ermakova, G. V., Alexandrova, E. M., Kazanskaya, O. V., Vasiliev, O. L., Smith, M. W. and Zaraisky, A. G. (1999). The homeobox gene, Xanf, can control both neural differentiation and patterning in the presumptive anterior neurectoderm of the Xenopus laevis embryo. Development 126,4513 -4523.[Abstract]
Eroshkin, F., Kazanskaya, O., Martynova, N. and Zaraisky, A. (2002). Characterization of cis-regulatory elements of the homeobox gene Xanf-1. Gene 285,279 -286.[CrossRef][Medline]
Gammill, L. S. and Sive, H. (1997). Identification of otx2 target genes and restrictions in ectodermal competence during Xenopus cement gland formation. Development 124,471 -481.[Abstract]
Hermesz, E., Mackem, S. and Mahon, K. A. (1996). Rpx: a novel anterior-restricted homeobox gene progressively activated in the prechordal plate, anterior neural plate and Rathke's pouch of the mouse embryo. Development 122, 41-52.[Abstract]
Jaynes, J. B. and O'Farrell, P. H. (1991). Active repression of transcription by the engrailed homeodomain protein. EMBO J. 10,1427 -1433.[Medline]
Kaestner, K. H. (2000). The hepatocyte nuclear factor 3 (HNF3 or FOXA) family in metabolism. Trends Endocrinol. Metab. 11,281 -285.[CrossRef][Medline]
Kaestner, K. H., Knochel, W. and Martínez, D. E.
(2000). Unified nomenclature for the winged helix/forkhead
transcription factors. Genes Dev.
14,142
-146.
Kaufmann, E., Muller, D. and Knochel, W. (1995). DNA recognition site analysis of Xenopus winged helix proteins. J. Mol. Biol. 248,239 -254.[Medline]
Kazanskaya, O. V., Severtzova, E. A., Barth, K. A., Ermakova, G. V., Lukyanov, S. A., Benyumov, A., Pannese, M., Boncinelli, E., Wilson, S. W. and Zaraisky, A. G. (1997). ANF: a novel class of homeobox genes expressed at the anterior end of the main embryonic axis of vertebrates. Gene 200,25 -34.[CrossRef][Medline]
Knochel, S., Lef, J., Clement, J., Klocke, B., Hille, S., Koster, M. and Knochel, W. (1992). Activin A induced expression of a fork head related gene in posterior chordamesoderm (notochord) of Xenopus laevis embryos. Mech. Dev. 38,157 -165.[CrossRef][Medline]
Knoetgen, H., Viebahn, C. and Kessel, M. (1999). Head induction in the chick by primitive endoderm of mammalian, but not avian origin. Development 126,815 -825.[Abstract]
Ladher, R., Mohun, T. J., Smith, J. C. and Snape, A. M. (1996). Xom: a Xenopus homeobox gene that mediates the early effects of BMP-4. Development 122,2385 -2394.[Abstract]
Li, C., Zhu, N. L., Tan, R. C., Ballard, P. L., Derynck, R. and
Minoo, P. (2002). TGF-beta inhibits pulmonary surfactant
protein-B gene transcription through SMAD3 interactions with NKX2.1 and HNF-3
transcription factors. J. Biol. Chem.
277,38399
-38408.
Mizuseki, K., Kishi, M., Shiota, K., Nakanishi, S. and Sasai, Y. (1998). SoxD: an essential mediator of induction of anterior neural tissues in Xenopus embryos. Neuron 21, 77-85.[CrossRef][Medline]
Nieuwkoop, P. D. and Nigtevecht, G. V. (1954). Neural activation and transformation in explants of competent ectoderm under the influence of fragments of anterior notochord in urodeles. J. Embryol. Exp. Morphol. 2,175 -193.[Medline]
Offield, M. F., Hirsch, N. and Grainger, R. M. (2000). The development of Xenopus tropicalis transgenic lines and their use in studying lens developmental timing in living embryos. Development 127,1789 -1797.[Abstract]
Onichtchouk, D., Gawantka, V., Dosch, R., Delius, H., Hirschfeld, K., Blumenstock, C. and Niehrs, C. (1997). The Xvent-2 homeobox gene is part of the BMP-4 signalling pathway controlling dorsoventral patterning of Xenopus mesoderm. Development 122,3045 -3053.
Onichtchouk, D., Glinka, A. and Niehrs, C. (1998). Requirement for Xvent-1 and Xvent-2 gene function in dorsoventral patterning of Xenopus mesoderm. Development 125,1447 -1456.[Abstract]
Rhinn, M., Dierich, A., Shawlot, W., Behringer, R. R., le Meur, M. and Ang, S. L. (1998). Sequential roles for Otx2 in visceral endoderm and neuroectoderm for forebrain and midbrain induction and specification. Development 125,845 -856.[Abstract]
Ruiz i Altaba, A., Cox, C., Jessell, T. M. and Klar, A.
(1993). Ectopic neural expression of a floor plate marker in frog
embryos injected with the midline transcription factor FoxA4a/Pintallavis.
Proc. Natl. Acad. Sci. USA
90,8268
-8272.
Schmidt, J. E., von Dassow, G. and Kimelman, D. (1996). Regulation of dorsal-ventral patterning: the ventralizing effects of the novel Xenopus homeobox gene Vox. Development 122,1711 -1721.[Abstract]
Schuler-Metz, A., Knochel, S., Kaufmann, E. and Knochel, W.
(2000). The homeodomain transcription factor Xvent-2 mediates
autocatalytic regulation of BMP-4 expression in Xenopus embryos. J.
Biol. Chem. 275,34365
-34374.
Shimeld, S. M. and Holland, P. W. (2000).
Vertebrate innovations. Proc. Natl. Acad. Sci. USA
97,4449
-4452.
Thomas, P. Q., Johnson, B. V., Rathjen, J. and Rathjen, P.
D. (1995). Sequence, genomic organization, and expression of
the novel homeobox gene Hesx1. J. Biol. Chem.
270,3869
-3875.
Trindade, M., Tada, M. and Smith, J. C. (1999). DNA-binding specificity and embryological function of Xom (Xvent-2). Dev. Biol. 216,442 -456.[CrossRef][Medline]
Wang, J. C., Waltner-Law, M., Yamada, K., Osawa, H., Stifani, S.
and Granner, D. K. (2000). Transducin-like enhancer of split
proteins, the human homologs of Drosophila groucho, interact with hepatic
nuclear factor 3beta. J. Biol. Chem.
275,18418
-18423.
Zaraisky, A. G., Lukyanov, S. A., Vasiliev, O. L., Smirnov, Y. V., Belyavsky, A. V. and Kazanskaya, O. V. (1992). A novel homeobox gene expressed in the anterior neural plate of the Xenopus embryo. Dev. Biol. 152,373 -382.[CrossRef][Medline]
Zaraisky, A. G., Ecochard, V., Kazanskaya, O. V., Lukyanov, S. A., Fesenko, I. V. and Duprat, A.-M. (1995). The homeobox-containing gene XANF-1 may control development of the Spemann organizer. Development 121,3839 -3847.[Abstract]
This article has been cited by other articles:
![]() |
M. B. Tereshina, A. G. Zaraisky, and V. V. Novoselov Ras-dva, a member of novel family of small GTPases, is required for the anterior ectoderm patterning in the Xenopus laevis embryo Development, February 1, 2006; 133(3): 485 - 494. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||