|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online May 5, 2004
doi: 10.1242/10.1242/dev.01113
Program in Developmental Biology, Sloan-Kettering Institute, Memorial Sloan-Kettering Cancer Center, Weill Graduate School of Medical Sciences at Cornell University, 1275 York Avenue, New York, NY 10021, USA
* Author for correspondence (e-mail: m-baylies{at}ski.mskcc.org)
Accepted 9 February 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila, Mesoderm, Muscle, Subdivision, Signaling, Transcriptional regulation, Notch, Suppressor of Hairless, bHLH, twist, daughterless, extra machrochaetae, Enhancer of split
| Introduction |
|---|
|
|
|---|
Essential to the process of Drosophila mesoderm subdivision and
patterning is the regulation of the bHLH transcription factor Twist
(Baylies and Bate, 1996
).
Twist is initially required for mesoderm specification. It is expressed at
high levels in all mesodermal cells through the activity of the NFKB
homologue, Dorsal, and the bHLH protein, Daughterless
(Castanon et al., 2001
;
Jiang et al., 1991
;
Leptin, 1991
;
Simpson, 1983
;
Thisse et al., 1991
).
Following gastrulation, a segmentally repeated pattern of Twist expression
forms along the anterior-posterior axis of the embryo, subdividing each
mesodermal segment into a low and high Twist domain. Cells located in the high
Twist domain develop into somatic muscles and heart, whereas cells located in
the low Twist domain differentiate into visceral muscle, fat body, heart and
mesodermal glia (Baylies and Bate,
1996
; Borkowski et al.,
1995
). High Twist levels are required for somatic myogenesis, and
they inhibit the differentiation of other mesodermal tissue fates, such as the
visceral mesoderm and fat body (Baylies
and Bate, 1996
). While it is known that Wingless and Hedgehog
signaling modulate Twist expression, through the pair-rule genes
sloppy-paired (slp) and even-skipped
(eve), respectively (Azpiazu et
al., 1996
; Lee and Frasch,
2000
; Riechmann et al.,
1997
), Twist regulation during mesoderm subdivision and patterning
is not fully understood.
Recently, genetic data implicated the Notch signaling pathway in early
somatic myogenesis (Brennan et al.,
1999
). Following mesodermal subdivision, somatic myogenesis
proceeds within the high Twist domain. Wingless signaling leads to the
specification of groups of equipotent myoblasts, which express the gene
lethal of scute (Carmena et al.,
1995
; Carmena et al.,
1998
). While all cells within an equivalence group have the
potential to develop into a muscle progenitor, lateral inhibition, mediated by
Notch signaling, leads to the selection of one progenitor per group
(Bate et al., 1993
;
Carmena et al., 2002
;
Corbin et al., 1991
). Analysis
of Notch and Wingless signaling double mutants revealed that in addition to
its later role in lateral inhibition, Notch activity represses somatic
development concurrently or prior to Wingless signaling and equivalence group
formation, possibly during the time of Twist modulation
(Brennan et al., 1999
).
Classical Notch signaling is activated by the DSL (Delta and Serrate in
Drosophila and vertebrates; Lag-2 in C. elegans) ligand
family and is mediated by the CSL (CBF1/RBP-JK in vertebrates; Suppressor of
Hairless [Su(H)] in Drosophila; Lag-1 in C. elegans)
transcription factor family
(Artavanis-Tsakonas et al.,
1999
). A transcriptional switch model has been put forward to
describe Notch target gene regulation
(Bray and Furriols, 2001
;
Hsieh et al., 1996
;
Klein et al., 2000
). In the
absence of Notch signaling, default repression by Su(H) prevents transcription
(Barolo and Posakony, 2002
;
Barolo et al., 2002
). Su(H)
binds specific enhancer sequences, recruits corepressors, such as Hairless,
and represses transcription (Barolo et
al., 2002
; Furriols and Bray,
2000
; Klein et al.,
2000
; Morel et al.,
2001
). Upon ligand binding, the Notch intracellular domain,
Nicd, is released from the cell membrane and translocates into the
nucleus (Kidd et al., 1998
;
Struhl and Adachi, 1998
).
Nicd then associates with Su(H) and alleviates Su(H)-mediated
repression, for example by displacing corepressors. Depending on the specific
enhancer and the particular combinations of transactivators present in the
cell, Notch target genes are proposed to have different requirements for Su(H)
and Nicd (Bray and Furriols,
2001
; Klein et al.,
2000
). Nicd instructive enhancers additionally require
Nicd to serve as a coactivator for Su(H) and activate
transcription. Nicd permissive enhancers solely require
Nicd to alleviate the repression caused by Su(H). Once the enhancer
is de-repressed, Su(H) and/or the other bound transactivators promote
transcription.
In this paper, we demonstrate that Notch signaling plays a critical role in
mesoderm subdivision prior to its well-established role in lateral inhibition.
Proper modulation of Twist into low and high expression domains requires Notch
signaling. By focusing on how Notch and Su(H) regulate Twist, we unraveled the
molecular mechanism that Notch utilizes to regulate a single target gene: (1)
Notch acts as a transcriptional switch that converts Su(H) from a repressor
into an activator; and (2) Notch/Su(H) regulate twist directly, as
well as indirectly, by activating proteins that repress twist. We
hypothesize that these `Repressors of Twist' are the transcriptional
repressors of the Enhancer of split complex [E(spl)-C] and
the HLH protein Extra machrochaetae (Emc) which dimerizes and inhibits the
activity of Daughterless, a bHLH transcription factor required for high levels
of twist (Castanon et al.,
2001
). Our work underscores the complexity of Notch/Su(H) bHLH
regulation in the early Drosophila embryo and suggests a mechanism
for the analogous process of somite formation and patterning in vertebrate
embryos.
| Materials and methods |
|---|
|
|
|---|
Dp(?;2) bwD, S1 wgSp-1
Ms(2)M1 bwD/CyO flies, were used to produce embryos
lacking maternally contributed and zygotically expressed Su(H),
Su(H)null (Morel and
Schweisguth, 2000
).
The GAL4/UAS system (Brand and
Perrimon, 1993
) was used to express Notch and
Su(H) constructs. Females carrying twist-GAL4 on both the X
and the second chromosomes {2X twist-GAL4}
(Baylies et al., 1995
) were
crossed to males carrying constitutively active forms of Notch or Su(H):
UAS-Nintra (Lieber et
al., 1993
) or UAS-Su(H)VP16
(Kidd et al., 1998
).
Nintra encodes the intracellular domain of Notch (Nicd)
that is released upon Notch cleavage. Su(H)-VP16 is a Su(H)/VP-16 activation
domain fusion protein. The VP16 activation domain inhibits the repressive
activity of Su(H) and promotes transcriptional activation. Similar results
were obtained with UAS-Nintra and UAS-Su(H)-VP16
utilizing twi-GAL4; Dmef2-GAL4 (data not shown). 2X
twist-GAL4 was additionally used to drive expression of
UAS-Su(H) (Kidd et al.,
1998
).
Su(H)null embryos that express Nintra panmesodermally were created by recombining twist-GAL4 onto the Su(H)del47 chromosome. Su(H)del47, twist-GAL4/CyO, ftz-lacZ males were then crossed to females carrying Su(H)del47; UAS-Nintra GLCs.
Notch deletion constructs, constitutively active forms of Notch and Su(H),
and 2X UAS-emc (gift of M. Ruiz-Gomez) were expressed in
Nnull embryos with one copy of twist-GAL4.
Females producing Df(1)N81k1; twist-GAL4 GLCs
were crossed to males carrying FM7c, ftz-lacZ and one of the
following constructs: UAS-FLN, UAS-Nintra,
UAS-FLN
cdc10, UAS-FLN
10-12
(Zecchini et al., 1999
),
UAS-Su(H)-VP16, or two copies of UAS-emc {2X
UAS-emc}. FLN encodes the full length Notch receptor. The
Notch protein encoded by FLN
cdc10 lacks the RAM-23
domain and the cdc10/ankyrin repeats, while the Notch protein encoded by
FLN
10-12 contains a deletion in the extracellular
domain that removes EGF-like repeats 10-12.
Transgenic lines carrying 1428twist-GFP
(Cox, 2004
;
Thisse et al., 1991
), and
1428twistmutSu(H)-GFP were generated by injection
of yw embryos as previously described
(Rubin and Spradling, 1982
;
Spradling and Rubin, 1982
).
Four 1428twist-GFP and two 1428twistmutSu(H)-GFP
independent transformant lines were obtained, mapped, expanded into homozygous
stocks and analyzed. 2X twist-GAL4, and in additional experiments,
twist-GAL4; Dmef2-GAL4 (data not shown), were utilized to drive
UAS-Nintra and UAS-Su(H)-VP16 in wild-type and
mutated reporter construct backgrounds.
Two E(spl)-C deficiency strains were analyzed:
Df(3R)E(spl)R1 and Df(3R)E(spl)b32.2,
P[gro+] (gifts of A. Martinez-Arias).
Df(3R)E(spl)R1 deletes all E(spl)-C genes,
including groucho (gro)
(de Celis, 1991
;
Knust et al., 1987
).
Df(3R)E(spl)b32.2 deletes all E(spl)C genes,
except for gro. However, while Df(3R)E(spl)b32.2
leaves the gro coding region intact, its disruption of gro's
5' noncoding region partially affects gro function
(Schrons et al., 1992
).
gro function is restored in Df(3R)E(spl)b32.2,
P[gro+] flies, which carry a wild-type groucho allele
(Heitzler et al., 1996
).
twist-GAL4; Dmef2-GAL4 (at 29°C) and/or 2X twist-GAL4,
in an otherwise wild-type or sensitized twiID96 (null
twist allele) heterozygous background, were used to drive the
following UAS-E(spl)-C constructs: UAS-m2, UAS-m3,
UAS-m4, UAS-m5, UAS-m7, UAS-m8, and
UAS-m
(gifts of C. Delidakis, J. W. Posakony, S. Bray, and A.
Preiss). 2X twist-GAL4 was employed to drive expression of
UAS-da (Castanon et al.,
2001
), UAS-da-da, two copies of UAS-emc
(Baonza et al., 2000
), and
UAS-da-da; UAS-emc. In an additional experiment,
UAS-da was expressed with twist-GAL4; Dmef2-GAL4 at 29°C
to increase da expression. Transgenic UAS-da-da flies were
generated by injection of yw embryos as previously described
(Castanon et al., 2001
).
Embryos carrying the following emc loss-of-function alleles were
analyzed: emc1, emcip15, and
emcE12 (Cubas et al.,
1994
). emc1 and emcip15
are recessive lethal hypomorphs. The emcE12 deficiency is
recessive lethal; it removes 10 chromosomal bands, including the emc
locus. To minimize the effect of maternal inheritance, mutant embryos were
obtained from heterozygous emcE12 females that were
crossed to heterozygous emc1, emcip15,
or emcE12 males.
In addition to the above strains, wild-type Oregon-R and da
maternal/zygotic mutant embryos were examined. Maternal and zygotic Da levels
were reduced with the temperature sensitive da1 allele:
permissive at 18°C, lethal at 25°C
(Castanon et al., 2001
).
All crosses were conducted at 25°C unless otherwise noted.
Plasmid construction
A 1428 base pair twist regulatory region (1428twist) was
PCR amplified from a pBS plasmid containing a minimal twist
promoter, a 3141 base pair insert of sequence that lies upstream of the
twist ORF (Cox, 2004
;
Thisse et al., 1991
). Primers
5'GCTCTAGAGCGACCAATAGTTTAAG3' and
5'CGGGATCCCTTGGTGATCTTGCTTGG3' containing an Xba and BamHI
restriction site, respectively, amplified the region we termed
1428twist. 1428twist was then subcloned as a Xba-BamHI
fragment into the pH-Stinger transformation vector upstream of
nuclear enhanced GFP (Barolo et
al., 2000a
).
Sequence analysis, using MacVector, of 1428twist identified one
site (TGTGGGAA) matching the YRTGDGAD consensus Su(H) binding sequence
(Barolo et al., 2000b
). Using
site-directed mutagenesis (Promega, USA, Gene Editor), the conserved Su(H)
binding site was mutated to TTCTATCC. The mutation was verified by sequencing.
Following the same procedures described for 1428twist, the mutated
1428 base pair twist regulatory region
[1428twistmutSu(H)] was subcloned into
pH-Stinger.
To create the Da-Da tethered dimer, da cDNA (provided by M. Caudy)
and a pcDNA3 plasmid containing a 16 amino acid Gly/Ser rich flexible
polypeptide linker were used (Castanon et
al., 2001
; Markus,
2000
; Neuhold and Wold,
1993
). da cDNA was cloned in frame on either side of the
flexible linker so that translation results in a Da homodimer. For P-element
transformation, da-da was subcloned into pUAST
(Brand and Perrimon,
1993
).
Immunocytochemistry and imaging
Embryos for immunocytochemistry were fixed following standard techniques
for whole mounts (Wieschaus and
Nüsslein-Volhard, 1986
). The following antibodies were used:
anti-Twist (1:5000; gift of S. Roth), anti-Emc (1:1000; gift of Y. N. Jan),
anti-Da (1/50; gift of C. Cronmiller), anti-ß-galactosidase (1:2000;
Promega, USA), and anti-GFP (1:250 with glutaraldehyde treatment; Abcam
ab6556). Double staining with anti-ß-galactosidase was performed to
identify embryos carrying lacZ marked chromosomes. Biotinylated
secondary antibodies were utilized in combination with the Vector Elite ABC
Kit (Vector Laboratories, USA). Embryos were embedded in Araldite. Images were
captured using Nomarski optics on an Axiocam digital camera (Zeiss). Lateral
views of whole embryos are shown at 40X magnification, close-ups at 63X.
Anterior is left. Embryos were staged according to Campos-Ortega and
Hartenstein (1985
). Since the
neurogenic phenotype of Notch signaling mutants disrupts the mesodermal layer,
all embryo pictures (mutant, transgenics, and wild type) are a merge of
several mesodermal sections. Sections were photographed with Axiovision and
merged together using Adobe Photoshop. Different focal planes were also merged
in the pictures of embryos stained with anti-Emc so that both the ectoderm and
mesoderm are visualized.
| Results |
|---|
|
|
|---|
Twist is expressed in all mesodermal cells at high levels throughout gastrulation. However, during mesoderm subdivision, Twist expression is modulated. The distinctive uniform high Twist expression pattern seen when gastrulation is complete (stage 9) changes into a segmented pattern of low and high Twist domains, so that at stage 10, each mesodermal segment consists of a low and high Twist domain (Fig. 1A-D).
|
Su(H) regulates Twist differently from Notch
To establish the mechanism by which Notch represses Twist expression, we
investigated how Su(H), the only identified transcriptional effector of Notch
signaling, affects Twist. Twist expression was examined in
Su(H)null mutant embryos derived from
Su(H)del47 germline clones. In sharp contrast to
Nnull mutants, Su(H)null mutant
embryos modulate Twist levels properly and exhibit the low and high Twist
pattern characteristic of wild-type embryos at stage 10
(Fig. 2A,B; compare with
Fig. 1E,F). In addition, Su(H)
gain of function was analyzed. Panmesodermal expression of a constitutively
transactivating form of Su(H), Su(H)-VP16, resulted in expanded high Twist
domains. UAS-Su(H)-VP16 embryos ectopically expressed high levels of
Twist in presumptive low Twist domains
(Fig. 2C,D; compare with wild
type in Fig. 1C,D). This result
contrasted with the repressed Twist expression seen in embryos that
panmesodermally express Nintra (compare with
Fig. 1G,H). Panmesodermal
expression of UAS-Su(H), which simply increased the amount of wild
type Su(H), did not affect Twist expression (data not shown). Taken together,
the disparities between the phenotypes of Nnull mutants
versus Su(H)null mutants and
UAS-Nintra versus UAS-Su(H)-VP16 embryos
indicated that Notch and Su(H) regulate Twist differently.
|
First we analyzed whether Notch requires Su(H) to repress Twist by expressing Nintra panmesodermally in Su(H)null mutant embryos [Su(H)null; UAS-Nintra]. We expected that if Notch signals through an Su(H)-independent pathway, Twist would still be repressed by UAS-Nintra in the Su(H)null background. Interestingly, Twist is not repressed in Su(H)null; UAS-Nintra embryos. Unlike UAS-Nintra embryos, which have few cells that express Twist at high levels, Su(H)null; UAS-Nintra mutant embryos, similarly to Su(H)null mutant embryos, exhibit a `wild-type-like' Twist pattern (compare Fig. 3A,B with Fig. 1G,H). This result indicated that Nintra requires Su(H) to repress Twist. Furthermore, it strongly suggested that Twist is not regulated by Su(H)-independent Notch signaling at subdivision.
|
As a control, we first tested whether panmesodermal transgene expression could restore wild-type-like Twist expression in Nnull embryos. Panmesodermal expression of a full-length Notch construct (UAS-FLN) rescued the Twist phenotype of Nnull embryos. Instead of the uniform high Twist levels characteristic of Nnull mutant embryos, low and high Twist domains were observed in Nnull; UAS-FLN embryos (compare Fig. 3C,D with Fig. 1E,F). Similarly, panmesodermal expression of Nintra restored Twist modulation. Nnull; UAS-Nintra embryos exhibited low and high Twist domains; as expected, UAS-Nintra repressed Twist more strongly than UAS-FLN (Fig. 3E,F).
In addition, we assessed whether panmesodermal expression of a Notch
protein that lacks its Su(H) interaction domain
(FLN
cdc10) would rescue Twist modulation.
FLN
cdc10 is a full-length Notch transgene
that carries an intracellular deletion that removes the RAM23 domain and cdc10
repeats, both of which have been shown to bind Su(H)
(Fortini and Artavanis-Tsakonas,
1994
; Matsuno et al.,
1997
). Published work has also shown that cdc10 repeats are
required for Notch signal transduction
(Lieber et al., 1993
). In
contrast to what was seen with FLN, FLN
cdc10 did not rescue Twist
modulation in Nnull embryos. Nnull;
UAS-FLN
cdc10 embryos maintained Twist at uniform high
levels throughout the mesoderm at stage 10
(Fig. 3G,H). This finding
strengthens our conclusion that Notch requires Su(H) to repress Twist.
Finally, we found that panmesodermal expression of the constitutively transactivating form of Su(H), Su(H)-VP16, rescued Twist modulation in Nnull embryos. Su(H)-VP16 repressed Twist expression in Nnull mutant embryos such that low and high Twist expression domains were restored (Fig. 3 I,J). This result was consistent with our finding that Notch signals through Su(H) to regulate Twist. It also supported our hypothesis that the Nnull Twist phenotype results from the loss of a transcriptional switch that converts Su(H) from a constitutive repressor into an activator. However, the simple model that Su(H) acts only on the twist promoter - first as a repressor and then upon Notch signaling as an activator - implies that Su(H)-VP16, as seen in Fig. 2C,D, should activate twist transcription. However, the rescue experiment showing that Su(H)-VP16 is capable of repressing Twist (Fig. 3I,J) suggested that Su(H) affects Twist by activating a gene that represses twist. This paradox can be resolved by the hypothesis that Su(H) can regulate the twist gene both directly and indirectly.
Lastly, the rescue experiments also suggested that the ability of UAS-Su(H)-VP16 to repress Twist is not as strong as that of UAS-FLN and UAS-Nintra. Compared to Nnull; UAS-FLN and Nnull; UAS-Nintra embryos, Nnull; UAS-Su(H)-VP16 embryos exhibit higher Twist expression (Fig. 3). Although this may reflect variations in transgene expression, incomplete rescue by UAS-Su(H)-VP16 was also consistent with the finding that UAS-Su(H)-VP16 can activate, as well as repress, Twist.
Taking all our data together, we concluded that Su(H)-mediated Notch signaling regulates Twist. We proposed that Notch signaling acts as a transcriptional switch that alleviates Su(H)-mediated repression and converts Su(H) from a transcriptional repressor into a transcriptional activator. Furthermore, these results suggested that Su(H) could affect Twist expression through a multi-layered mechanism that includes direct, as well as indirect, transcriptional regulation.
Notch/Su(H) regulation of a minimal twist promoter
To explore the transcriptional mechanism that Notch and Su(H) utilize to
affect Twist expression, we conducted promoter analysis. We uncovered a
1428-bp region of the twist promoter (1428twist), which lies
immediately upstream of the transcriptional start site, that faithfully drives
GFP reporter gene expression in a wild-type Twist pattern through
mid-embryogenesis (Cox, 2004
;
Thisse et al., 1991
). At stage
10, 1428twist embryos modulated GFP into low and high expression
domains along the anterior-posterior axis
(Fig. 4A,B).
|
1428twist contains only one site (TGTGGGAA) that matches the
YRTGDGAD Su(H)-binding consensus sequence
(Barolo et al., 2000b
).
Published gel shift experiments have shown that Su(H) binds oligonucleotides
containing this GTGGGAA core sequence with high affinity
(Morel and Schweisguth, 2000
).
Hence, it is likely that Su(H) strongly binds 1428twist in vivo.
To test how the Notch signaling pathway regulates twist modulation during subdivision, we mutated the conserved Su(H) site on the 1428twist promoter [1428twistmutSu(H)] and cloned the mutated promoter upstream of a GFP reporter gene. We had two expectations: (1) if Su(H) binds the twist promoter and represses transcription until Notch signaling acts as a transcriptional switch that converts Su(H) into an activator, Su(H) site mutation should cause the 1428twist promoter to be de-repressed; and (2) if Notch signaling also represses twist indirectly, as suggested by our genetic experiments, Su(H) site mutation should not abolish Notch repression and modulation of the 1428twist reporter - another site should be employed. Hence, rather than exhibiting a Nnull-like phenotype and uniformly maintaining high GFP levels throughout the mesoderm, we expected 1428twistmutSu(H) embryos to display a modulated low/high GFP pattern. This indirect mode of twist repression is consistent with the classic model of Notch signaling in which Notch stimulates Su(H) to activate direct targets, such as Enhancer of split complex [E(spl)-C] genes, which in turn repress achaete-scute (ac-sc) complex genes.
At stage 10, 1428twistmutSu(H) embryos modulate GFP into low and high domains (Fig. 4E,F). In addition, high GFP domains appear slightly expanded when compared with 1428twist embryos, a result consistent with de-repression of the twist promoter. These data suggested that normally, Su(H) binds its consensus site on 1428twist and represses transcription until Notch signals. However, since 1428twistmutSu(H) embryos still modulate GFP, we concluded that a Notch/Su(H) regulated non-Su(H) site is also required to repress twist and create a modulated pattern. This result probably explains why the 1428twistmutSu(H) promoter is only mildly de-repressed; the indirect repressive activity of Notch inhibits strong de-repression. In sum, these findings, combined with our earlier genetic data, provide evidence for a direct effect of Su(H) on the twist promoter, as well as an indirect effect of Notch signaling that represses twist.
To gather further support for this conclusion, we examined how panmesodermal expression of Nintra affects the 1428twistmutSu(H) promoter. Since we hypothesized that Notch indirectly represses Twist, we predicted that Nintra would repress GFP expression, despite the elimination of the only Su(H) binding site in the twist promoter. Indeed, the GFP pattern seen in 1428twistmutSu(H); UAS-Nintra embryos revealed that Nintra can repress the activity of the 1428twistmutSu(H) promoter (Fig. 4G,H). GFP expression in presumptive high GFP domains, especially laterally, was repressed compared with 1428twist embryos. However, at the same time, some cells in presumptive low GFP domains expressed higher amounts of GFP, suggesting that the GFP reporter was de-repressed in presumptive low GFP domains. As noted above, this de-repression was probably caused by the removal of Su(H) mediated repression of twist. Thus, the abnormal GFP pattern of 1428twistmutSu(H); UAS-Nintra embryos appeared to be a combination of indirect Nintra repression and Su(H) de-repression of the 1428twist promoter. Panmesodermal expression of UAS-Su(H)-VP16 in a 1428twistmutSu(H) background resulted in a phenotype similar to that seen in 1428twistmutSu(H); UAS-Nintra embryos (data not shown).
Taken together, promoter and genetic analyses indicated that, in addition to the conserved Su(H) site in the twist promoter, an additional, non-Su(H) site is involved in Notch-mediated twist repression. We suggest that this non-Su(H) site is the binding site of a Notch/Su(H) regulated gene that represses twist, called `repressor of twist'. We had four expectations of a `repressor of twist': (1) it would be regulated by Notch signaling; (2) it would act as a transcriptional repressor; (3) `Repressor of twist' would be expressed in the early mesoderm just before or at the time of apparent Twist modulation; and (4) it would impinge on the twist promoter, either by directly binding to specific sequences or by affecting the activity of bound factors. Two types of candidate genes emerged as possible `repressors of twist' based on these qualifications - Enhancer of Split complex [E(spl)-C] genes and extra machrochaetae (emc).
Notch represses Twist indirectly through E(spl)
E(spl)-C encodes 7 bHLH proteins (m3, m5, m7, m8,
mß, m
and m
) and six non-bHLH
proteins - m1, m2, m4, m6, m
, and groucho
(Knust et al., 1987
).
Expression of E(spl) complex genes is regulated by the classical
Notch signaling pathway. In loss-of-function Notch mutant embryos,
members of the complex show no detectable expression, indicating that Notch is
required for activation of these genes
(Furriols and Bray, 2000
;
Jennings et al., 1994
). In
loss-of-function Su(H) mutant backgrounds, the expression of m4,
m8 and m
in the wing
(Bailey and Posakony, 1995
;
Koelzer and Klein, 2003
) and
m2 in germline clone embryos
(Wurmbach et al., 1999
) is
upregulated, indicating that these genes are repressed by Su(H) in the absence
of Notch signaling.
E(spl) bHLH proteins are Notch-regulated transcriptional repressors.
Yeast-two hybrid experiments showed that they can homodimerize as well as
heterodimerize with each other (Alifragis
et al., 1997
). E(spl) bHLHs can directly and indirectly repress
transcription. They directly bind promoters, recruit corepressors, and repress
transcription (Oellers et al.,
1994
). In addition, they interact with other promoter-bound bHLH
proteins to indirectly repress transcription
(Giagtzoglou et al., 2003
). In
vitro, E(spl) bHLH homodimers have been shown to bind canonical E boxes
(CANNTG, preferably of the class B-type CACGTG), N boxes (CACNAG) and Hairy
sites (CACGCG) (Jennings et al.,
1999
). 1428twist contains a consensus E box (CAGTTG),
four `N box-like' (CANNAG) motifs, and seven `hairy-like' (CANNCG) motifs.
At stage 10, four E(spl) bHLHs - m3, m5, m8 and m7 - are
expressed throughout the mesoderm at uniform low levels
(Knust et al., 1987
). Four
non-bHLH E(spl)-C genes are also expressed in the early mesoderm,
prior to stage 11: m2, m4, m
and groucho
(Knust et al., 1987
;
Wurmbach et al., 1999
). M2 is
a novel Notch-regulated protein; M4 and M
are Notch-regulated
Bearded-like proteins. Lastly, Groucho is a ubiquitously expressed
transcriptional corepressor (Paroush et
al., 1994
). It interacts with E(spl) bHLHs as well as other
transcriptional regulators including Runt, Hairy, Dorsal, TCF, and Hairless,
all of which function in the early embryo
(Aronson et al., 1997
;
Barolo et al., 2002
;
Cavallo et al., 1998
;
Dubnicoff et al., 1997
;
Flores-Saaib et al., 2001
;
Levanon et al., 1998
;
Paroush et al., 1994
;
Roose et al., 1998
).
Since the E(spl)-C genes fulfill our four requirements for a possible Notch-regulated `repressor of twist', we analyzed Twist expression in E(spl) mutant embryos. Two sets of embryos were analyzed: embryos carrying a deficiency that deletes the entire E(spl)-C locus, including the corepressor groucho (gro) [Df(3R)E(spl)]; and embryos carrying a deficiency that removes the entire E(spl)-C but carries a transgene that restores wild-type gro function {Df(3R)E(spl), P[gro+]}. These embryos were compared to ascertain the contribution of the entire E(spl)-C with and without groucho.
At stage 10, Df(3R)E(spl) mutant embryos maintained uniform high Twist expression throughout the mesoderm (Fig. 5A,B). Like Nnull mutants, Df(3R)E(spl) mutant embryos did not modulate Twist into low and high domains. In a similar, albeit less severe, manner, Df(3R)E(spl), P[gro+] mutants ectopically expressed high levels of Twist (Fig. 5C,D). Cells, located in what should be the low Twist domain, expressed higher amounts of Twist than wild type.
|
- repress Twist at stage 10. Since removing zygotic
groucho expression exacerbates the Twist phenotype, our findings also
demonstrate that Groucho-mediated repression is critical for Twist modulation
into low and high domains.
To ascertain the effect that individual E(spl)-C genes and bHLH
versus non-bHLH E(spl) proteins have on Twist, we conducted gain-of-function
analysis. Panmesodermal expression of UAS-m2, UAS-m3,
UAS-m4, UAS-m5, UAS-m7, UAS-m8 or
UAS-m
did not affect Twist expression; all embryos exhibited a
wild-type-like Twist pattern (data not shown, see Materials and methods).
These results revealed that overexpression of individual mesodermal
E(spl)-C genes is not sufficient to repress Twist. Perhaps, in the
embryo, a combination of several E(spl)-C proteins, bHLH and/or nonbHLH, are
required to repress Twist. It is also possible that E(spl)-C proteins work in
concert with another factor, a non-E(spl) protein, to repress Twist.
In conclusion, published work from several labs has demonstrated that Notch signaling transcriptionally regulates E(spl)-C genes. Based on our loss-of-function data, we suggest that one aspect of the mechanism employed by Notch to indirectly repress twist involves direct Notch regulation of E(spl)-C genes.
twist regulation by Extra machrochaetae (Emc) and Daughterless (Da) activity
In the Drosophila wing and eye, Notch signaling regulates
emc transcription (Baonza et al.,
2000
; Baonza and Freeman,
2001
). In the embryonic mesoderm, Emc is expressed uniformly
during gastrulation until stage 10. Embryos carrying strong hypomorphic
emc alleles showed a variety of mesodermal phenotypes, including
muscle losses and aberrant muscle attachments, as well as misregulation of
Twist expression (Cubas et al.,
1994
). Emc contains an HLH domain but not a basic domain
(Garrell and Modolell, 1990
).
Thus, while it can dimerize with bHLH proteins, Emc cannot bind DNA.
Consequently, Emc acts as a dominant negative; the formation of inactive
Emc/bHLH heterodimers inhibits bHLH transcriptional activity.
Emc genetically interacts with the bHLH protein Daughterless, Da
(Ellis et al., 1990
). In-vitro
gel shift experiments demonstrated that Emc heterodimerizes with Da with high
affinity; this interaction prevents Da from binding canonical CANNTG E boxes,
such as the one found on 1428twist, and activating transcription
(Van Doren et al., 1991
). Emc
does not form dimers with Twist nor any of the seven E(spl) bHLH transcription
factors; the proteins have poor affinity for one another
(Alifragis et al., 1997
) (Kass
and Baylies, unpublished). Thus in-vitro and in-vivo data suggest that Emc
exerts its effects in vivo by inhibiting Da dimerization
(Ellis et al., 1990
;
Van Doren et al., 1991
).
Da is ubiquitously expressed throughout development
(Cronmiller and Cummings,
1993
) and required to maintain uniform high Twist expression
throughout the mesoderm during gastrulation
(Castanon et al., 2001
). While
Notch signaling components genetically interact with da
(Cummings and Cronmiller,
1994
; Smith et al.,
2002
), they have not been reported to transcriptionally regulate
Da (Smith and Cronmiller,
2001
). N and Su(H) mutant embryos show no
discernible effect on Da expression through mid-embryogenesis (data not
shown). Based on these Emc and Da data, we investigated whether Emc is also a
Notch-regulated `repressor of twist', acting via Da to control Twist
levels. We first examined the effect of Da and, particularly, the effect of Da
dimerization on Twist regulation in the early embryo.
Loss of Da in early embryos reduces Twist expression, indicating that Da is
required for high levels of Twist
(Castanon 2001
)
(Fig. 6A,B). Thus, we next
asked whether increasing Da levels ectopically activates high Twist
expression. Different amounts of Da were expressed utilizing different
conditions and panmesodermal GAL4 lines. All combinations resulted in
stage 10 embryos that ectopically expressed high levels of Twist; cells
located in presumptive low Twist domains expressed high amounts of Twist, a
phenotype resembling that of Nnull embryos
(Fig. 6C-F). However, the
strength of the GAL4 driver used to express UAS-da affected
the severity of the phenotype. For example, embryos that ectopically expressed
a lower level of Da had fewer ectopic cells that expressed high Twist levels
(Fig. 6E,F) than embryos that
ectopically expressed a higher level of Da
(Fig. 6C,D). Since Emc can
dimerize with Da and compete with other proteins for Da monomers, we asked
whether the milder da overexpression phenotype was caused by high Emc
levels in the early embryo (Cubas et al.,
1994
). We hypothesized that under milder Da overexpression
conditions, endogenous Emc interfered with Da dimerization and impaired the
ability of Da to activate twist expression.
|
Since Emc expression is upregulated by Notch in the wing and eye
(Baonza et al., 2000
;
Baonza and Freeman, 2001
), we
next analyzed the effect of Notch on mesodermal Emc expression. In wild-type
embryos, Emc is uniformly expressed throughout the mesoderm prior to stage 10;
at stage 11, Emc is strongly expressed around ectodermal tracheal pits but
absent or expressed at low levels in the mesoderm
(Fig. 7A,B). Panmesodermal
Nintra expression resulted in ectopic Emc expression. The phenotype
was especially apparent at stage 11, when UAS-Nintra
embryos displayed strong mesodermal Emc expression
(Fig. 7C,D). This suggested
that Notch positively regulates Emc expression. However, like wild-type
embryos, Nnull mutants expressed Emc at uniform levels
throughout the mesoderm prior to stage 10. Similar effects on Emc levels were
found in Su(H)null embryos (data not shown). We caution,
however, that anti-Emc staining and in-situ analysis employing a probe
complementary to emc cDNA (data not shown) may not be sensitive
enough to detect a uniform slight decrease in Emc expression during stages
9/10. Hence, while early mesodermal Emc expression does not absolutely require
Notch, our data demonstrated that Notch signaling is able to upregulate Emc
expression.
|
Lastly, we looked at Twist expression in emc loss-of-function
mutants. Emc is expressed in the ovary, maternally inherited by the embryo,
and expressed throughout the gastrulating mesoderm. Since strong emc
alleles are cell lethal (Cubas et al.,
1994
), and emc plays a role in oogenesis (J. C. Adam and
D. J. Montell, unpublished), we did not generate embryos that completely lack
emc. We attempted to reduce the effect of maternally contributed
emc by analyzing embryos obtained from females heterozygous for a
deficiency that removes the emc locus emcE12
(Cubas et al., 1994
). Embryos
were obtained from emcE12 heterozygous females that had
been crossed to males heterozygous for the following emc recessive
lethal alleles: emc1, emcip15 or
emcE12. Stage 10 Twist expression appeared wild-type-like
in all emc mutants examined (data not shown). These experiments
indicated that the reduced zygotic Emc activity and/or maternally loaded Emc
found in these embryos are sufficient for early Twist expression.
Nevertheless, these data do not rule out the hypothesis that Emc regulates
Twist modulation.
Taken together, the findings that Notch activated Emc expression and that Emc rescued Nnull embryos lead us to favor the model that Emc - transcription and/or post-transcriptional activity - is regulated by Notch signaling. We propose that Notch signaling represses Twist expression, through the E(spl)C proteins, as well as by increasing Emc activity, which inhibits Da from transcriptionally activating twist.
| Discussion |
|---|
|
|
|---|
Models of Notch target gene regulation
The distinct mesodermal phenotypes of Notch and Su(H)
mutants can be explained by Notch acting as a transcriptional switch. This
aspect of Notch signaling has been described in other systems
(Bray and Furriols, 2001
;
Hsieh et al., 1996
;
Klein et al., 2000
), and the
early Drosophila mesoderm appears no different in this regard.
However, our data suggested that there was more to the phenotypes; that is,
additional layers of Notch regulation in the transcriptional control of one
gene.
Genetic experiments, as well as promoter analysis, raised the hypothesis that Notch signaling regulates twist directly, as well as indirectly by activating expression of a `repressor of twist' (Fig. 8A). This indirect repression of twist concurred with the role of Notch in activating E(spl) transcriptional repressors. Moreover, a mechanism involving direct and indirect regulation was consistent with Su(H) mutant phenotypes. In Su(H)null embryos, neither twist nor repressor of twist (for example, emc) are repressed. The de-repression of both genes at the same time resulted in Twist expression appearing `wild-type-like'. When a constitutively activating form of Su(H) was expressed, both twist and repressor of twist were activated. In these embryos, high Twist domains were expanded, but uniform high Twist expression was not observed because repressor of twist was expressed.
|
While Notch signaling has the ability to activate twist, Notch/Su(H) signaling ultimately leads to repression of twist at stage 10. This predominance of repression can be explained in two ways: (1) direct Notch activation of the twist promoter is overpowered by Notch activated repressors of twist; and (2) a repressor of twist gene, such as E(spl), is more responsive to Notch/Su(H) activation than twist. These ideas are discussed below in light of our results.
The first model proposes that while Notch signaling might directly promote both twist and repressor of twist activation, repressors of twist might suppress an increase in twist transcription. Our data suggested that Notch regulates multiple repressors of twist, including E(spl)-C genes and Emc. On the twist promoter, these multiple repressors could overwhelm Su(H) activation. Hence, twist would be transcriptionally repressed rather than activated. In Su(H)-VP16 embryos, the constitutive activating ability of Su(H) on the twist promoter might inhibit some of this repression. Consequently, Twist is ectopically expressed at high levels.
Our data are also consistent with the second model, which proposes that
twist and a repressor of twist gene, such as
E(spl), respond differently to Notch activation. The reason for this
differential response is provided by the concept of Notch instructive and
permissive genes (Bray and Furriols,
2001
). Transcription of Notch instructive genes requires the
intracellular domain of Notch (Nicd) first to alleviate
Su(H)-mediated repression and then to serve as a coactivator for Su(H).
Transcription of Notch permissive target genes requires Nicd to
solely de-repress Su(H); Su(H) bound to other coactivators and/or other
transcriptional activators are necessary for permissive gene activation
(Fig. 8B). Since panmesodermal
expression of Nintra does not activate twist, we conclude
that simple de-repression of Su(H) is insufficient to activate twist
expression and that other factors are required. Hence, Notch acts permissively
on the twist promoter. By contrast, panmesodermal expression of
Nintra is sufficient to activate a repressor of twist,
resulting in the strong Twist repression shown in
Fig. 1. As E(spl)-C
genes have been categorized as Notch instructive target genes
(Bray and Furriols, 2001
;
Klein et al., 2000
), we
suggest that E(spl)-C genes are the Notch instructive repressor
of twist genes depicted in Fig.
8B. Although Notch can upregulate Emc expression, the inability to
see a change in Emc expression in Nnull and
Su(H)null mutants suggests Emc is not a Notch instructive
target gene. Thus, based on all of our work, we currently favor the
instructive and permissive target gene regulation model.
Notch activation in the early mesoderm
In Drosophila, Notch signaling is activated by the Delta (Dl) and
Serrate ligands. Delta is expressed throughout the mesoderm at late stage 9
and stage 10 (Kooh et al.,
1993
), while Serrate is not embryonically expressed until stage 11
(Thomas et al., 1991
). While
the germline requirement for Delta prevents germline clone embryos from being
produced by recombination (Lopez-Schier
and St Johnston, 2001
), embryos lacking zygotically expressed
Dl exhibited a wild-type-like Twist pattern (Tapanes-Castillo and
Baylies, unpublished). In addition, expression of a full-length Notch protein
missing the two EGF repeats critical for Dl binding
(Lawrence et al., 2000
;
Lieber et al., 1992
;
Rebay et al., 1991
), EGF
repeats 11 and 12, rescued Twist modulation in Nnull
mutant embryos (Tapanes-Castillo and Baylies, unpublished). Thus Notch does
not require EGF-like repeats 10-12 to repress Twist. This preliminary data
suggested that Delta may use EGF-like repeats other than 10-12 to activate
Notch (Martinez Arias et al.,
2002
). Alternatively, Notch may not be activated by canonical
Delta signaling; a novel (non-DSL) ligand may activate Notch in the early
mesoderm. Further experiments are required to evaluate whether the maternal
component of Delta regulates Twist.
Notch's role in patterning Drosophila mesodermal segments - establishment of periodicity in Twist expression
While our work elucidates the molecular mechanism by which Notch represses
Twist, we have yet to understand how Notch signaling establishes a segmentally
repeated pattern of low and high Twist domains - that is, periodicity in Twist
expression. We propose two models, consistent with our data, to describe how
Notch signaling contributes to a modulated Twist pattern. Model I proposes
that during the transition from a uniform to a modulated Twist pattern, Notch
signaling represses twist only in presumptive low Twist domains.
Transcriptional activators, such as Da, maintain high Twist expression in
presumptive high Twist domains. While Notch signaling components such as
Notch, Su(H), and Delta are expressed throughout the mesoderm at late stage 9
and stage 10, this model predicts that Notch signaling is simply not activated
in presumptive high Twist domains. Model II proposes that during the
transition in Twist expression, Notch signaling represses twist
throughout the mesoderm, but Notch independent transcriptional activators
antagonize Notch repression in what will become high Twist domains, thereby
promoting the formation of high Twist domains. For example, transcriptional
effectors of Notch signaling [such as Su(H) and E(spl)] and an `activator'
that is only expressed in presumptive high Twist domains may converge and
compete on the twist promoter.
Con