spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 21 April 2004
doi: 10.1242/dev.01110


Development 131, 2373-2385 (2004)
Published by The Company of Biologists 2004


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.01110v1
131/10/2373    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pocock, R.
Right arrow Articles by Woollard, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pocock, R.
Right arrow Articles by Woollard, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

A regulatory network of T-box genes and the even-skipped homologue vab-7 controls patterning and morphogenesis in C. elegans

Roger Pocock1, Julie Ahringer2, Michael Mitsch2, Sara Maxwell1 and Alison Woollard1,*

1 Genetics Unit, Department of Biochemistry, University of Oxford, South Parks Road, Oxford OX1 3QU, UK
2 Wellcome Trust/Cancer Research UK Gurdon Institute, University of Cambridge, Tennis Court Road, Cambridge CB2 1QR, UK

* Author for correspondence (e-mail: woollard{at}bioch.ox.ac.uk)

Accepted 3 February 2004


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
T-box genes form a large family of conserved transcription factors with diverse roles in animal development, but so far functions for only a few have been studied in detail. Here we show that four Caenorhabditis elegans T-box genes and the even-skipped-like homeobox gene vab-7 function within a regulatory network to control embryonic patterning and morphogenesis. tbx-8 and tbx-9 have functionally redundant roles in the intercalation of posterior dorsal hypodermal cells, in muscle cell positioning and in intestinal development. Inhibiting tbx-9 alone using RNA interference (RNAi) produces worms that have a thickened, `bobbed tail' phenotype, similar to that seen in mutants of vab-7, which itself has been shown to pattern posterior muscle and hypodermal cells. In support of the view that these genes function in the same pathway, we find that tbx-8 and tbx-9 are both necessary and sufficient for vab-7 expression. In addition, a third T-box gene, tbx-30, acts to repress vab-7 expression in the anterior of embryos. We further show that vab-7 itself represses the T-box gene mab-9 in posterior cells. Thus, during posterior patterning in C. elegans, there are multiple interactions between T-box genes and the vab-7 homeobox gene. Evolutionary parallels in other organisms suggest that regulatory interactions between T-box genes and even-skipped homologues are conserved.

Key words: Caenorhabditis elegans, T-box genes, Dorsal intercalation, evenskipped


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
T-box genes are a large family of transcriptional regulators unified by a conserved DNA binding, or T, domain that have important, yet diverse roles in patterning animal development (reviewed by Papaioannou, 2001Go). Mouse mutations in T-box genes such as Brachyury and Tbx6 are associated with notochord and mesoderm, or neural tube defects, respectively (Herrmann, 1995Go; Chapman and Papaioannou, 1998Go), and chick Tbx4 and Tbx5 have roles in limb specification (reviewed by Simon, 1999Go). In Xenopus, Brachyury (Xbra) is required for the development of mesoderm (Conlon et al., 1996Go), while VegT is required for induction of mesoderm and endoderm (Kofron et al., 1999Go; Zhang et al., 1998Go). The Drosophila Brachyury homologue brachyenteron (byn), or Trg, functions in the formation of hindgut and posterior mesoderm (Kispert et al., 1994Go; Singer et al., 1996Go; Kusch and Reuter, 1999Go), while optomotor blind (omb) is necessary for the development of anterior sensory structures such as the eye (Pflugfelder and Heisenberg, 1995Go). In addition, several T-box genes are associated with human developmental abnormalities, including Holt-Oram syndrome (Basson et al., 1999Go), Ulnar-Mammary syndrome (Bamshad et al., 1999Go) and X-linked cleft palate (Braybrook et al., 2001Go), further highlighting the critical functions of members of this gene family.

All T-box proteins tested so far appear to bind to the same consensus DNA binding site (Kispert et al., 1995Go; Muller and Herrmann, 1997Go). T-box genes can be divided into several subfamilies based on sequence comparisons, and some subfamilies are highly conserved across a wide range of phyla from Caenorhabditis elegans to humans (Papaioannou, 2001Go). The completed C. elegans genome sequence predicts 20 T-box genes in C. elegans, more than in any other species analysed so far, but functions for only two, mab-9 and mls-1, have been studied in detail (Woollard and Hodgkin, 2000Go; Kostas and Fire, 2002Go). Most of the C. elegans T-box genes appear to be highly diverged from those found in other species, with only four genes having obvious counterparts in other organisms (Papaioannou, 2001Go). mab-9 is a member of the Tbx20 subfamily (Papaioannou, 2001Go) and is required for cell fate specification in the developing hindgut and for proper motor neuron function (Woollard and Hodgkin, 2000Go; Huang et al., 2002Go). mls-1, related to the Tbx1 subfamily, is necessary for correct muscle cell fate determination (Kostas and Fire, 2002Go). Two other T-box genes with orthologues in other organisms, F21H11.3 (tbx-2), a member of the Tbx2 subfamily, and ZK328.6 (tbx-7), related to the ascidian gene T2 (Papaioannou, 2001Go), have not yet been characterised. Unlike other species tested so far, C. elegans does not have a recognisable Brachyury orthologue.

We have taken a reverse genetic approach to analysing T-box gene function in C. elegans. We used RNA interference (RNAi) to survey loss of function phenotypes for T-box genes and found that RNAi of tbx-9 resulted in a phenotype similar to that of vab-7 mutants. vab-7 is a homologue of the Drosophila homeobox gene even-skipped (eve), required for posterior patterning of muscle and hypodermal cells in C. elegans (Ahringer, 1996Go); eve homologues also have roles in posterior development in several other species (Brown et al., 1997Go; Joly et al., 1993Go). We find that tbx-9, vab-7 and three other T-box genes act within a regulatory pathway important for embryonic development, with vab-7 functioning both upstream and downstream of T-box genes to regulate posterior patterning.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Strains and C elegans maintenance
All C. elegans strains were derived from the wild-type Bristol strain N2. Routine maintenance of worms and genetic manipulations were performed as described (Sulston and Hodgkin, 1988Go).

RNAi
PCR primers, including T7 or T3 RNA polymerase promoter sites, were designed to be specific to the gene to be silenced and to amplify typically 500-900 bp of mostly exonic sequence. dsRNA was synthesised directly from gel-purified PCR product as previously described (Fire et al., 1998Go) and injected into young N2 adult hermaphrodites at a concentration of ~1 mg/ml. Injected worms were transferred to fresh plates 6 hours following injection and thereafter every 10-14 hours for 3 days.

RT-PCR
One hundred mixed-stage embryos were isolated from the progeny of wild type, tbx-8(RNAi) and tbx-9(RNAi) hermaphrodites. Total RNA was extracted using the RNeasy® RNA extraction kit (Qiagen, Crawley, UK). RT-PCR amplification of tbx-8, tbx-9 and ama-1 (control) mRNA was carried out on these total RNA samples using SuperscriptTM One-Step RT-PCR with Platinum® Taq (Invitrogen, Paisley, UK). Gene specific RT-PCR oligos (designed to anneal to either side of an intron to enable DNA and RNA amplification to be distinguished and to give RT-PCR products of around 200 bp) were as follows: tbx-8 (F cgtctt-gtcacttctgttcg, R ccctctcggaatccttggc), tbx-9 (F agtaacggcttaccagaacc, R tggggactgtgagttgctgc), ama-1 (F ttccaagcgccgctgcgcattgtctc, R cagaatttccagcactcgaggagcgga).

Transgenic worms
Plasmids were injected into the syncytial gonad of young adult hermaphrodite worms at concentrations of 1-50 ng/µl as described (Mello and Fire, 1995Go). Co-transformation markers were either rol-6 (plasmid pCes1943, gift of Diana Janke, University of British Columbia), in which case Rol progeny from N2 injected worms were picked and stable lines selected, or unc-119(+) (plasmid pDP#MM016ß), in which case non-Unc progeny from unc-119 (ed3) injected worms were selected. Where appropriate, integrated lines were generated by X-ray mutagenesis as described previously (Mello and Fire, 1995Go). Integrated lines were outcrossed several times prior to analysis.

GFP reporter constructs
GFP fusions were made using pPD vectors kindly supplied by the Fire Lab (Carnegie Institute of Washington). All constructs were verified by sequencing. To make a tbx-8::GFP fusion, a PCR fragment (oligos F aaaactgcagaccggtttggcagctacac, R aaaactgcaggccattgatttc ctgctcaatatc) containing the entire coding and 5' intergenic region minus the stop codon (7.7 kb) was first inserted into pBSKS+ (Stratagene) using PstI and then sub-cloned into pPD95.77 to make an in-frame GFP translational fusion (plasmid pAW232). Several transgenic lines were generated carrying this construct using 20-50 ng/µl DNA, giving very similar expression patterns. The strain described in this report is AW27 (ouEx12[pAW232 + pCes1943]). To make a tbx-9::GFP fusion, a PCR fragment (oligos F aaaactgcaggattcaatcaaaacgggc, R aaaactgcaggcaccaacaatatcaatatcttc) was cloned directly into pPD95.75 using PstI to make an in-frame translational fusion (plasmid pJA57). Several transgenic lines were generated carrying this construct, using 1 ng/µl DNA (higher concentrations were found to be toxic). Transgenic lines gave similar expression patterns. The strain described in this report is AW22 (unc-119 (ed3); ouEx8 [pJA57 + pDP#MM016ß]). A vab-7::GFP reporter construct was made by cloning GFP in-frame into the SphI site of exon 1 of the vab-7 genomic rescuing construct pJA17 (14 kb), to generate the translational fusion construct pJA64, which was injected at a concentration of 20-50 ng/µl. This construct gave the same expression pattern in transgenic worms as the lacZ reporter and in-situ hybridisations previously described (Ahringer, 1996Go). The vab-7::GFP transgenic strain described in this report is AW23 (unc-119 (ed3); ouEx9 [pJA64 + pDP#MM016ß]). The integrated mab-9::GFP strain (eIs34) used in this study has been described previously (Woollard and Hodgkin, 2000Go). This was crossed into vab-7(e1562) to give the strain AW24. The integrated pal-1::GFP strain (ctIs33) used in this study was a gift from Lois Edgar (University of Colorado, Boulder). The elt-2::GFP reporter strain (wIs81[elt-2::GFP;pRF4(rol-6)]) was a gift from Joel Rothman (University of California, Santa Barbara).

Heat-shock constructs
Two hsp-16 driven tbx-9 constructs were made. pJA50 consists of the tbx-9 full-length cDNA (XbaI-KpnI insert from cDNA clone pYK337c3) cloned into pPD49.78 (hsp16-2 driven), and pJA52 consists of the same cDNA insert cloned into pPD49.83 (hsp16-41 driven). A transgenic line was derived containing both hsp16::tbx-9 constructs, weEx41 [pJA50 + pJA52 + pRF4 (rol-6)]. An integrated strain was subsequently derived from this, weIs8 (strain JA1286). A similar approach was taken to construct a strain (JA1284, weIs6) containing an integrated copy of an extrachromosomal array containing hsp16-2 driven (pJA49) and hsp16-41 driven (pJA51) tbx-8 cDNAs, derived from the cDNA clone pYK325e8. Integrated heat-shock driven tbx-8 and tbx-9 strains were then crossed into an unc-119 (ed3) background and injected with the vab-7::GFP construct described above (pJA64) together with unc-119(+) to give the strains AW26 (unc-119(ed3); weIs8 (hsp-16::tbx-9 + rol-6); ouEx11 [pJA64 + pDP#MM016ß]) and AW41 (unc-119(ed3); weIs6 (hsp-16::tbx-8 + rol-6); ouEx14 [pJA64 + pDP#MM016ß]). Non Unc, Rol progeny were selected in each case. Adult hermaphrodite worms were subsequently heat shocked at 33°C for 45 minutes and then incubated at 20°C for 2 hours and embryos dissected for examination.

Site-directed mutagenesis
A 4.3 kb PacI-PflMI subclone (plasmid pAW223) of the vab-7::GFP reporter pJA64 containing the putative T-box binding sites to be mutated was used for site-directed mutagenesis. Site B was mutated first (see legend to Fig. 8) to generate plasmid pAW224 using the Stratagene Quickchange kit and protocols. Mutagenesis PCR oligos were as follows: F gtacgcctcattgatgtaatgtaaaagagatgtg R catgcggagtaactacattacattttctctacac. Site A was subsequently mutated to generate pAW226, in which both putative T-box binding sites were mutated. PCR oligos were as follows: F cgagcggaaaagatgtatttgaaccttcc R gctcgccttttctaca taaacttggaagg. The mutated PacI-PflMI fragment was then re-inserted into the vab-7::GFP reporter construct pJA64 to generate the plasmid pAW231, a vab-7::GFP reporter in which both putative T-box binding sites in the vab-7 regulatory region were mutated into sites that would not be expected to permit T-box proteins to bind (Sinha et al., 2000Go). Transgenic lines were generated using this construct that gave similar expression patterns. The transgenic line described in this report is AW28 (ouEx13 [pAW231 + pCes1943]).



View larger version (82K):
[in this window]
[in a new window]
 
Fig. 8. T-box mediated anterior repression of vab-7. (A) Upper line, schematic of vab-7 5' regulatory region of vab-7::GFP construct showing putative T-box binding sites A and B. Lower line, sequence of mutated sites A and B, following site directed mutagenesis. These mutated sites would not be expected to bind T-box proteins (Sinha et al., 2000Go). (B,D,F) Expression of vab-7::GFP in transgenic animals carrying this mutated construct. The normal posterior pattern of vab-7::GFP expression can be seen, together with ectopic expression at the anterior. (B) Ectopic anterior expression can be seen at around the 100-cell stage (arrows). The inset panel in (C) shows WT vab-7::GFP expression in four posterior Cxxp cells at the same stage, for comparison. Note there is no anterior expression in this case. (D) Ectopic anterior expression around the 400-cell stage (arrows) together with the usual posterior muscle expression of vab-7::GFP seen at this stage. (F) Ectopic expression at the anterior at the 1.5-fold stage (arrows) together with the usual posterior muscle and hypodermal VAB-7::GFP observable at this stage. (C,E,G) expression of WT, non-mutated vab-7::GFP in tbx-30(RNAi) embryos. Ectopic expression of vab-7 is observable in the same anterior cells at comparable stages to the T-box binding site-mutated vab-7 reporter, suggesting that TBX-30 normally represses vab-7 expression at the anterior of embryos by binding to these sites. (C) Ectopic expression of vab-7 around the 100-cell stage in the same cells as in (B) (arrows). The inset panel shows WT vab-7::GFP expression at the same stage, for comparison. (E) Ectopic anterior expression around the 400-cell stage (arrows), comparable to that seen in (D). (G) Ectopic anterior expression at the 1.5-fold stage, comparable to that seen in (F). The usual posterior vab-7 expression pattern is seen in all cases (slightly out of focus in (G)) Posterior is to the right, dorsal is up in panels (B-G). Scale bar, 10 µm.

 
Antibody staining
To verify that the cells expressing tbx-8 and tbx-9::GFP fusions were the cell types they appeared to be by morphology and position, the following antibodies were used and co-localisation was assessed: a GFP antibody (chicken monoclonal from Chemicon, Hampshire, UK) for visualising TBX-8 and TBX-9::GFP fusions, LIN-26 antibody (gift from M. Labouesse, Strasbourg), which stains all hypodermal cells, and mouse mAb NE8/4C6.3, which stains the outlines of body wall muscle cells (Goh and Bogaert 1991Go). Secondary antibodies were FITC anti-chicken or Texas Red anti-mouse (Jackson Immunoresearch, Pennsylvania, USA). Immunostaining experiments were performed as follows: embryos were placed on poly-lysine coated slides, squashed under a coverslip and frozen on dry ice for 20 minutes. After freezing, the coverslip was flicked off and slides placed in methanol for 20 minutes at room temperature, washed with PBS for 5 minutes and PBS + Tween (0.2%) for 10 minutes. Primary antibodies were incubated overnight at 4°C in PBS+Tween. After washing, secondary antibodies were incubated for 1-2 hours at room temperature. Samples were mounted in mowiol.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
RNAi of tbx-8 and tbx-9 reveals overlapping functions in embryonic development
A phylogenetic tree of C. elegans T-box genes together with representative members of each of the defined T-box subfamilies found in other organisms (Papaioannou, 2001Go) is shown in Fig. 1A. This illustrates the high degree of divergence of most of the C. elegans T-box genes, with the exception of the four genes discussed above. There are several putative paralagous pairs of T-box genes in C. elegans, which may be the result of recent gene duplications.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. Phylogenetic analysis of T-box genes. (A) Phylogenetic tree. T-box domain amino acid sequences of all C. elegans T-box genes and representative members of the defined T-box subfamilies found in other organisms (Papaioannou, 2001Go) were aligned using ClustalW accessed via the European Bioinformatics Institute (EBI, http://www.ebi.ac.uk/). The alignment was subjected to Phylip analysis using the same EBI interface and Phylip outputs were interpreted using the tree drawing programme TreeView. Non-C. elegans genes are in red. Species abbreviations are as follows: As, ascidian; Dm, Drosophila melanogaster; Hs, Homo sapiens; Mm, Mus musculus. New C. elegans gene names (tbx-30-41) have been approved by the Caenorhabditis Genetics Centre (CGC). (B) Genomic organisation of tbx-8 and tbx-9 (and neighbouring genes) in C. elegans and C. briggsae. Ce-tbx-8 and Ce-tbx-9 are transcribed in opposing directions (arrows), whereas Cb-tbx-8 and Cb-tbx-9 are transcribed in the same direction (arrows). The thick dotted line represents the intergenic region. Ce-tbx-8 and Cb-tbx-8 are 73% identical throughout their T-box domains. Ce-tbx-9 and Cb-tbx-9 are 56% identical. There is evidence of a local chromosome inversion in C. briggsae compared with C. elegans, which extends for several genes to the right of Cb-tbx-9 (neighbouring region not drawn to scale). Red bar denotes the T-box domain of Ce-tbx-8 and Ce-tbx-9 (59% identical).

 
A survey of C. elegans T-box gene function by RNAi has revealed obvious phenotypes in only a few cases (Maxwell, Aslam and Woollard, unpublished observations; Ahringer, unpublished observations). The tbx-9(RNAi) phenotype consists of a characteristic swelling of the hermaphrodite tail hypodermis, giving a `bobbed tail' appearance highly reminiscent of the tail phenotype seen in vab-7(e1562) animals (Fig. 2). This phenotype is not very penetrant in N2 animals (~10%). When RNAi experiments were conducted in the rrf-3 strain, which is more sensitive to RNAi (Simmer et al., 2002Go), the penetrance of tbx-9(RNAi) phenotypes was increased: 15-25% of the progeny of rrf-3 dsRNA injected hermaphrodites had a vab-7-like bobbed tail and, in addition, 10-15% of progeny had other morphological defects, including dorsal hypodermal bulges in the midbody and posterior region (data not shown).



View larger version (100K):
[in this window]
[in a new window]
 
Fig. 2. RNA interference (RNAi) phenotypes of tbx-8 and tbx-9. (A) Wild-type adult hermaphrodite tail whip. (B) Tail region of adult hermaphrodite progeny of wild-type worm injected with dsRNA corresponding to tbx-8. These worms are indistinguishable from wild type. (C) Tail region of tbx-9(RNAi) worms. The adult hermaphrodite tail is thickened (arrow) and often has a `bobbed tail' appearance. (D) Tail region of adult hermaphrodite vab-7(e1562) animal. The tail is similar in appearance to that in (C). (E) L1 larvae from hermaphrodite mother co-injected with tbx-8 and tbx-9 dsRNA. In addition to thickening of the tail, these animals display gross midbody and posterior morphological abnormalities, often with large dorsal bulges (arrow). Most die as unelongated embryos or short L1s. (F) Wild-type L1. Scale bars, 10 µm. Posterior is to the right and dorsal is up in all panels. (G) RT-PCR analysis of tbx-8 and tbx-9 transcripts in wild-type worms and those subjected to tbx-8 and tbx-9 RNAi. ama-1 was chosen as a suitable control, as mRNA would be expected to be constant throughout. For each gene, primers were chosen to specifically amplify mRNA of approximately 200 bp (see Materials and methods). Results were identical for three separate experiments.

 
The phylogenetic tree presented in Fig. 1 suggests that tbx-8 and tbx-9 may be paralogous. The two proteins are 59% identical in their T-box domains and are located only 3.75 kb apart on chromosome III (map position 2.41). They are divergently transcribed and thus may share common 5' regulatory regions (Fig. 1B). RNAi of tbx-8 revealed no obvious abnormalities, either in N2 or rrf-3 animals (Fig. 2B and data not shown). To test the efficacy of RNAi for both tbx-8 and tbx-9, we assayed tbx-8 and tbx-9 mRNA levels in embryos by RT-PCR and found that both mRNAs were undetectable following injection of the corresponding dsRNA (Fig. 2G). We also found that tbx-8 and tbx-9 RNAi abolished the GFP signals of tbx-8::GFP and tbx-9::GFP transgenic worms, respectively (data not shown).

To test whether tbx-8 and tbx-9 have overlapping functions, double RNAi experiments were performed. Silencing of both genes simultaneously in N2 animals gave rise to 100% embryonic or early larval lethality (50-60% embryonic arrest, 40-50% L1 arrest, n=130), with gross morphological defects in the midbody region and posterior (Fig. 2E, Fig. 4). There was a failure of body elongation, and hatched animals had large dorsal bulges in the hypodermis (Fig. 2E). We compared phenotypes observed in double RNAi experiments with those of a tbx-8 knockout allele (ok656, a presumed null allele available from the C. elegans Knockout Consortium, Oklahoma, USA), which had been subjected to tbx-9 RNAi and found that they were identical: tbx-8(ok656); tbx-9(RNAi) animals also arrest as embryos or early larvae in similar proportions (53% embryonic arrest, 46% L1 arrest, n=220), with identical morphological defects (data not shown). This demonstrates the efficacy of silencing tbx-8 and tbx-9 simultaneously by double RNAi. tbx-8(ok656) worms, like tbx-8(RNAi) animals, have no obvious defects on their own (data not shown).



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 4. Muscle and intestinal defects in tbx-8/tbx-9(RNAi) animals. (A-D) Transgenic embryos carrying an hlh-1::GFP body wall muscle reporter. Body wall muscle nuclei are green. (A-B) Embryos around the 400-cell stage. (A) Wild type, dorsal view. Two rows of muscle cells (one on the right and one on the left side of the embryo) are visible at this stage. (B) tbx-8/tbx-9(RNAi) embryo. Some muscle cells are not in regular rows (arrow). (C-D) Embryos at the 1.5-fold stage. (C) Wild type, left lateral view. Muscles have split into dorsal and ventral rows on each side of the embryo. One dorsal and one ventral row can be seen in this focal plane. (D) tbx-8/tbx-9(RNAi) embryo. There is no clear separation of dorsal and ventral rows, especially at the posterior (arrows). (E-F) transgenic animals carrying a myo-3::GFP body wall muscle reporter. (E) Dorsal view of wild-type L1, showing two of the four rows of muscle nuclei; two ventral rows are not visible in this focal plane. (F) Muscle nuclei in tbx-8/tbx-9(RNAi) animals. Instead of lying in straight rows, nuclei are often bunched (arrows), and there are gaps in the row (arrowheads). (G-J) Intestinal defects in tbx-8/tbx-9(RNAi) animals. (G-H) tbx-8/tbx-9(RNAi) animals that have survived to hatching. The intestine has severe morphological defects with the gut lumen being highly distended (arrows). In comparison, a wild-type gut lumen is visible in (E) (arrow). (I-J) Transgenic worms carrying an elt-2::GFP intestinal cell reporter. Intestinal nuclei are green. (I) Wild-type L1 showing the positions of 16 of the 20 intestinal nuclei (the other four are out of focus). (J) tbx-8/tbx-9(RNAi) L1 worm. The intestinal nuclei are out of position, often being bunched together at either end of the intestine (arrows) and missing from the middle (arrowheads). Counting reveals that all nuclei are usually present, however. Posterior is to the right in all panels. Scale bars, 10 µm.

 
Co-silencing of tbx-8 and tbx-9 causes defects in embryonic dorsal intercalation and in hypodermal and muscle cell positioning
The dorsal bulges displayed by tbx-8/tbx-9(RNAi) animals suggested that hypodermal morphogenesis might have been affected. In wild-type embryos, the two rows of dorsal hypodermal cells, born around 240 minutes after first cleavage, intercalate into a single dorsal row around 290-340 minutes (Fig. 3A). During dorsal intercalation, dorsal hypodermal cells become wedge-shaped, with their pointed ends oriented towards the dorsal midline. The pointed tips of these cells interdigitate contralaterally and elongate so that the advancing edges eventually contact the opposing lateral hypodermal (seam) cells, which flank the dorsal hypodermis (Fig. 3A). Migration of dorsal nuclei follows behind the extending cell tips, so that the nuclei end up close to the lateral seam cells. The hypodermis then extends ventrally, spreading to enclose the embryo, with ventral hypodermal cells eventually sealing up the ventral pocket by a `purse-string' mechanism at 310-360 minutes. Dorsal hypodermal cells subsequently undergo fusion to form a syncytium, and circumferential contraction within the hypodermis causes a fourfold elongation of the embryo (360-600 minutes). The rearrangement and movements of groups of hypodermal cells during embryonic development is instrumental in setting the shape of the worm (reviewed by Chin-Sang and Chisholm, 2000Go; Simske and Hardin, 2001Go).



View larger version (76K):
[in this window]
[in a new window]
 
Fig. 3. Hypodermal defects in tbx-8/tbx-9(RNAi) animals. The arrangement of hypodermal cells in embryos and L1 larvae has been visualised using the ajm-1::GFP reporter. (A-D) Dorsal view. (A) Wild-type embryo around 300 minutes following first cleavage. The two rows of dorsal hypodermal cells born 1 hour previously have intercalated into a single row and their advancing edges have come into contact with the opposing lateral hypodermal cells (arrows). (B-D) tbx-8/tbx-9(RNAi) embryos at approximately the same stage. Dorsal hypodermal cells are clearly disorganised. In most embryos dorsal intercalation begins relatively normally at the anterior (B-D, arrow) but does not proceed normally in the midregion or posterior (B-D, arrowheads). In these embryos, dorsal intercalating cells that are not the appropriate wedge-shape can be seen (B-D, asterisks), and many cells do not extend contralaterally in the correct way. Dorsal intercalation often arrests at this point, the same misarranged cells being observable at least 1 hour later. (E-H) Arrangement of lateral hypodermal (seam) cells in tbx-8/tbx-9(RNAi) embryos and L1 larvae. (E) Wild-type embryo beginning elongation, lateral view. A linear row of seam cells can be seen. (F) tbx-8/tbx-9(RNAi) embryo, same stage and view. The lateral row of cells is interrupted, with some cells being pinched out of line (asterisks). (G) tbx-8/tbx-9(RNAi) animal that has survived to hatching; some seam cells are pinched out of line (asterisks) and are misshapen at the site of the dorsal bulge (arrow). Animals are much shorter than they should be in L1 (compare with (H) wild type, posterior half only of animal, same scale). Posterior is to the right in all panels. Scale bars, 10 µm.

 
To analyse hypodermal cell positions and migrations, we used the ajm-1::GFP (pka jam-1::GFP) reporter (strain SU93), which marks adherens junctions, allowing visualisation of the outlines of hypodermal cells (Mohler et al., 1998Go). In tbx-8/tbx-9(RNAi) embryos, dorsal intercalation is defective (Fig. 3). In these embryos, dorsal intercalation is relatively normal at the anterior end of the embryo but fails to complete towards the posterior (Fig. 3B-D). Some of the cells appear square, or even rounded, rather than wedge-shaped, and intercalation appears to arrest at this point (Fig. 3B-D). Observation of the same embryos 90 minutes later showed that dorsal intercalation does not proceed beyond this stage (data not shown). No obvious defects in ventral enclosure were evident (data not shown); however, defects in the arrangement of lateral hypodermal (seam) cells could be seen. In wild-type embryos, lateral hypodermal cells form two linear rows with 10 cells on each side of the embryo (Fig. 3E). In tbx-8/tbx-9(RNAi) embryos, lateral rows are interrupted, with one to four cells pinched out of line (Fig. 3F). However, seam cell number is not affected (data not shown). This misalignment of seam cells can also be seen in those RNAi worms that survive to hatching (Fig. 3G). tbx-8/tbx-9(RNAi) embryos fail to elongate properly and die either as late-stage embryos (50-60%) or misshapen, short L1 larvae (40-50%), with large bulges typically, though not exclusively, on the dorsal side (Fig. 2E).

Muscle cells are also affected in tbx-8/tbx-9(RNAi) animals. In wild-type animals, body wall muscles are present as two regular rows on the dorsal and ventral sides of the animal and can be visualised using hlh-1::GFP or myo-3::GFP transgenic markers. In tbx-8/tbx-9(RNAi) embryos and hatched larvae, these rows are not regular. Muscles are often seen out of line and rows are sometimes broken down completely, with muscle cells being bunched together laterally (Fig. 4B,D,F). The overall number of muscle cells, as assessed by counting nuclei expressing the muscle marker hlh-1::GFP at the 2-fold stage, is unchanged (wild type, 58 (n=22), tbx-8/tbx-9(RNAi), 58 (n=17)), suggesting that this is a positioning, rather than a cell fate commitment, defect. The earliest observable muscle-positioning defect was seen around the 400 cell stage, as dorsal hypodermal intercalation was proceeding (Fig. 4B). We cannot exclude the possibility, therefore, that muscle-positioning defects are caused by abberant dorsal hypodermal morphogenesis, rather than being a cell autonomous defect. Likewise, it is possible that some of the hypodermal defects observed were a secondary consequence of muscle-positioning defects. However, it is known from ablation experiments that dorsal hypodermal intercalation proceeds normally in the absence of the underlying muscle tissue (Heid et al., 2001Go), consistent with our view that hypodermal defects in tbx-8/tbx-9(RNAi) embryos are unlikely to be a secondary consequence of muscle-positioning defects. Furthermore, bulges on the surface of tbx-8/tbx-9(RNAi) animals that survived to L1 were always correlated with gross disorganisation of hypodermis, while some bulges did not contain muscle cells (data not shown), suggesting that hypodermal defects were the primary cause.

Intestinal defects in tbx-8/tbx-9(RNAi) worms
tbx-8/tbx-9(RNAi) animals that survived to hatching had abnormal gut morphology (Fig. 4G,H,J). Using an elt-2::GFP intestinal cell marker, we examined the number and positions of intestinal nuclei in wild-type and tbx-8/tbx-9(RNAi) worms. We found that the number of intestinal cells was unchanged at the 1.5-fold stage (wild type, 19 (n=14), tbx-8/tbx-9(RNAi), 19 (n=22)). These cells were correctly positioned at this stage (data not shown) but in hatched tbx-8/tbx-9(RNAi) animals intestinal cells were mispositioned (Fig. 4J compared with Fig. 4I). This suggests a potential role for tbx-8 and tbx-9 in intestinal morphogenesis, although it may be that tbx-8 and tbx-9 do not have a direct role in intestinal cell positioning; positioning defects during late embryogenesis could be a consequence of aberrant morphogenesis. Likewise, it is possible that intestinal defects in tbx-8/tbx-9(RNAi) worms are a secondary consequence of defective embryonic elongation.

Domains of expression of tbx-8 and tbx-9
The expression patterns of tbx-8 and tbx-9 GFP translational fusions are shown in Fig. 5. tbx-8 and tbx-9 are both expressed in three different cell types in the embryo, gut, muscle and hypodermis, in a largely overlapping pattern. In all cases expression was found to be nuclear, as would be expected for putative transcription factors. The earliest embryonic expression of both tbx-8 and tbx-9 was detected in the E lineage gut cell precursors Ea and Ep at the beginning of gastrulation (~100 minutes after first cleavage) (Fig. 5A,B). Expression was seen in the direct descendents of Ea and Ep but was not obvious later in E lineage nuclei (data not shown). Although the expression of tbx-8 and tbx-9 in intestinal cells is consistent with a possible role for tbx-8 and tbx-9 in gut development, it is not clear how the early gut expression of tbx-8 and tbx-9 in gut cell precursors relates to the intestinal defects seen in tbx-8/tbx-9(RNAi) worms, which only become apparent later in embryogenesis, as discussed above.



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 5. Embryonic expression of tbx-8 and tbx-9 reporters. The earliest detectable tbx-8::GFP and tbx-9::GFP expression is seen in the nuclei of the gut cell precursors Ea and Ep at the onset of gastrulation, around 100 minutes following first cleavage (A-B). Ea and Ep are moving dorsally, into the interior. (A) TBX-8::GFP (Ea, arrowhead, Ep, arrow), (B) TBX-9::GFP (Ea, arrowhead, Ep, arrow). tbx-8 and tbx-9 are subsequently expressed in muscle and hypodermal cells. (C) Expression of tbx-8::GFP in dorsal muscle cells (arrows) and lateral hypodermal cells (arrowheads) at the 1.5-fold stage. To confirm these cells types, co-staining was performed with muscle and hypodermal specific markers. (D) TBX-9 stained green with a GFP antibody. The outlines of muscles cells are stained red with the muscle antibody NE8/4C6.3 and dorsal muscle cells expressing tbx-9 are indicated (arrows). Similar results were obtained for TBX-8 (data not shown). (E-I) Hypodermal expression of tbx-8::GFP and tbx-9::GFP. TBX-8::GFP (E) and TBX-9::GFP (F) can be seen in the nuclei of dorsal hypodermal cells undergoing intercalation (around 300 minutes following first cleavage). The expression is particularly strong in cells that are just starting to intercalate (E,F, arrows). Outlines of cells undergoing the early stages of intercalation are shown with a black dotted line. Weaker expression can also be seen in lateral hypodermal cells (E,F, arrowheads). (G-I) Embryo co-stained with antibodies to show TBX-9::GFP in green and LIN-26 (expressed in all hypodermal cells) in red. (G) Green channel only showing cells expressing TBX-9::GFP stained with a GFP antibody. (H) Red channel only showing cells expressing LIN-26. (I) Merged image. Yellow nuclei strongly expressing both LIN-26 and TBX-9 can be seen in dorsal hypodermal cells that are beginning to intercalate (white solid arrow). Once cells are intercalated at the anterior TBX-9 expression is weaker and nuclei appear orange-yellow (dashed arrow). Cells at the posterior that have yet to intercalate express TBX-9 very weakly in this embryo and the nuclei appear orange-red (dotted arrow). Weak TBX-9 expression can also be seen in lateral hypodermal cells, in which the nuclei appear orange (arrowhead). Ventral hypodermal cells (not visible in this focal plane), which express LIN-26 but not TBX-9, stained red (not shown). Underlying muscle cell nuclei, which express TBX-9 but not LIN-26, appear green (blue arrow). Similar results were obtained with a tbx-8::GFP reporter. Posterior is to the right in all panels. Scale bar, 10 µm.

 
tbx-8 and tbx-9 were subsequently expressed in muscle and hypodermal cells (Fig. 5C-I). The expression of both tbx-8 and tbx-9 was stronger in dorsal hypodermal nuclei, which were just starting to intercalate, compared with those at the anterior, which were intercalated, or those at the posterior, which had yet to intercalate (Fig. 5E-G). This is particularly evident in embryos that have been co-stained with LIN-26 and GFP antibodies (Fig. 5I) and is consistent with a role for tbx-8 and tbx-9 in the process of dorsal intercalation, as suggested by the phenotypic analysis presented above. Expression of tbx-8 and tbx-9 could also be seen in dorsal hypodermal nuclei undergoing contralateral migration following cellular intercalation (data not shown), and in lateral hypodermal cells during dorsal intercalation (Fig. 5E-G), although expression in lateral hypodermal cells at this stage was weaker. Expression in lateral hypodermal (seam) cells could also be seen later in embryogenesis until the 1.5-fold stage (Fig. 5C). No expression of either tbx-8 or tbx-9 was observed in ventral hypodermal cells. The earliest detectable muscle cell expression of tbx-8 and tbx-9 was seen around the 400-cell stage, when muscle cells were present as two rows on the left and right sides of the embryo (Fig. 6A-B). Expression of tbx-8 and tbx-9 in hypodermal and muscle cells around the time when defects in these two cell types are first observed supports the view that hypodermal and muscle defects in tbx-8/tbx-9(RNAi) animals are likely to be largely cell autonomous, rather than one being a consequence of the other.



View larger version (112K):
[in this window]
[in a new window]
 
Fig. 6. vab-7 expression in tbx-8/tbx-9(RNAi) embryos. (A-C) Similarity of expression domains of tbx-8 (A), tbx-9 (B) and vab-7 (C) GFP reporter constructs around the 400-cell stage. In all three cases, expression is seen in posterior muscle cells, although the domain of tbx-8 expression is slightly wider, with some non-vab-7-expressing nuclei showing up (A, arrowheads). (D) vab-7::GFP expressing nuclei at the 1.5-fold stage. Expression is seen in posterior muscle cells (arrowheads), the majority of which are dorsal, and in the posterior hypodermal cells hyp 8-11 (arrow, 4-5 nuclei). The vab-7::GFP construct gives a similar expression pattern to the vab-7::lacZ construct and antibody staining previously reported (Esmaeili et al., 2002Go; Ahringer, 1996Go). (E) vab-7::GFP expression in tbx-8/tbx-9(RNAi) embryos at the same stage. No muscle-specific expression of vab-7 is observed, even though the same number of muscle cells are present (see text). vab-7 expression is still seen in one or two posterior hypodermal cells (arrow), which appear to have shifted slightly anteriorly, presumably due to the general disorganisation of tbx-8/tbx-9(RNAi) embryos. Posterior is to the right. Scale bar, 10 µm.

 
tbx-8 and tbx-9 activate vab-7 expression in muscle and hypodermal cells
vab-7 is required for the correct patterning of posterior body muscles and hypodermis and is expressed in posterior body muscle precursors and in hypodermal cells (Ahringer, 1996Go). The similarity in phenotype between vab-7 mutants and tbx-9(RNAi) animals, and the overlapping expression domains of vab-7, tbx-8 and tbx-9 (Fig. 6A-C) (Ahringer, 1996Go), suggest a possible regulatory interaction. To investigate this, we asked whether RNAi silencing of tbx-8 and tbx-9 affects the expression pattern of a vab-7::GFP reporter. Muscle expression of vab-7::GFP was abolished in these embryos, indicating that tbx-8 and tbx-9 function to promote muscle expression of vab-7, either directly or indirectly (Fig. 6E, compared with Fig. 6D). At the comma stage, vab-7::GFP is normally expressed in four to five posterior hypodermal nuclei (4.7±0.1, n=18) (Fig. 6D) (Esmaeili et al., 2002Go), but in tbx-8/9(RNAi) embryos expression was seen in only one or two posterior hypodermal nuclei (1.7±0.1, n=13, Fig. 6E). Silencing either tbx-8 or tbx-9 alone did not significantly reduce vab-7 expression (data not shown), indicating that these two genes have redundant roles in vab-7 activation. It is possible, however, that the low penetrance vab-7-like bobbed-tail phenotype in tbx-9(RNAi) animals is the result of a slight reduction of vab-7 expression in posterior hypodermis not detectable with the reporter.

Overexpression of either tbx-8 or tbx-9 drives ectopic vab-7 expression
To see if tbx-8 and tbx-9 are sufficient for vab-7 expression, we generated transgenic worms in which either tbx-8 or tbx-9 expression was driven by two strong inducible heat-shock promoters hsp16-2 and hsp-16-41, in addition to carrying a vab-7::GFP reporter construct (see Materials and methods). Following heat treatment, ectopic vab-7::GFP expression driven by either TBX-8 or TBX-9 could be observed up to the 400-cell stage of embryogenesis (Fig. 7A-D). No ectopic vab-7 expression was seen as a result of heat treatment in the absence of the tbx-8 or tbx-9 heat-shock constructs (Fig. 7E-F). Therefore, tbx-8 and tbx-9 are both necessary and sufficient for vab-7 expression in embryos.



View larger version (109K):
[in this window]
[in a new window]
 
Fig. 7. Expression of vab-7 in embryos overexpressing tbx-8 or tbx-9. Expression of vab-7::GFP was monitored in worms that also carried integrated hsp16-2::tbx-8 + hsp16-41::tbx-8 or hsp16-2::tbx-9 + hsp16-41::tbx-9 constructs in which high level expression of tbx-8 or tbx-9 could be ubiquitously induced by heat treatment. (A-B) Following heat-shock induction of tbx-8 at 33°C for 45 minutes and a subsequent incubation at 20°C for 2 hours, ectopic vab-7::GFP expression can be seen up to the 400-cell stage. (A) Early embryos; (B) later embryos around the 400-cell stage. (C-D) Similar results were obtained following heat shock induction of tbx-9, using the same heat treatment conditions. (E-F) vab-7::GFP embryos that do not contain the hsp16::tbx-8 or hsp16::tbx-9 constructs, subject to the same heat treatment regime. VAB-7 is seen in very few posterior cells around the 200-cell stage (E), and in muscle cells around the 400-cell stage, as has been previously reported (Ahringer, 1996Go) (this report). Posterior is to the right in all panels. Scale bar, 10 µm.

 
Do TBX-8/TBX-9 activate vab-7 directly?
An obvious question is whether or not the activation of vab-7 expression by tbx-8/tbx-9 is direct. All T-box proteins analysed so far interact with a characteristic DNA binding site in target genes with the core consensus sequence GGTGTGAA (reviewed by Papaioannou, 2001Go; Smith, 1999Go). The vab-7 5' regulatory region contains two close-match T-box binding sites situated close together, ~2 kb from the start of transcription (Fig. 8A). As these sites are good candidates for TBX8/9 binding, we engineered a vab-7::GFP reporter construct in which both sites were mutated. We found, however, that the posterior muscle and hypodermal expression pattern of vab-7 was unchanged in transgenic embryos carrying the mutated vab-7::GFP reporter (Fig. 8B,D,F). This suggests either that TBX-8 and TBX-9 do not regulate vab-7 directly, or that TBX-8/9 do activate vab-7 directly, but bind to alternative or additional binding sites, perhaps with a more degenerate sequence. T-box proteins in other organisms have been found to exhibit complex binding interactions with in-vivo target sites, often with a high degree of redundancy (Kusch et al., 2002Go; reviewed by Papaioannou, 2001Go).

T-box mediated anterior repression of vab-7
Although posterior expression of vab-7 was unchanged by mutating the two putative T-box binding sites, we did detect a marked difference in vab-7 expression at the anterior of embryos carrying the mutated reporter. Normally, no vab-7 expression is observable in the anterior of embryos at any stage of development (Ahringer, 1996Go) (this report). In transgenic lines carrying the mutated vab-7 reporter, however, significant anterior vab-7 expression is reproducibly seen (77% of embryos, n=48), at several different embryonic stages (Fig. 8B,D,F). This raises the possibility that there is a T-box factor in C. elegans that represses vab-7 expression in the anterior of embryos and that this factor normally binds directly to the T-box sites we have mutated. In order to investigate this, we silenced each of the remaining 18 T-box genes singly by RNAi and monitored the effect on wild-type vab-7 expression. We found that silencing tbx-30 (Y59E9AR.3) resulted in comparable ectopic anterior expression of vab-7::GFP (Fig. 8C,E,G), thereby phenocopying the effect of mutating the T-box binding sites in the vab-7 reporter. There were no obvious morphological phenotypes associated with silencing tbx-30. Silencing the other 17 C. elegans T-box genes had no effect on vab-7::GFP expression (data not shown). Thus, tbx-30 encodes a novel, anterior repressor of vab-7. Examination of the amino acid sequences of TBX-8, TBX-9 and TBX-30 revealed that there are highly acidic domains at the C-termini of TBX-8 and TBX-9 (data not shown), consistent with a role for these two genes in transcriptional activation. No such activation domain is present in TBX-30, however, as we would expect for a transcriptional repressor.

VAB-7 represses mab-9 expression in posterior cells
In a separate screen for genes that regulate the expression of the T-box gene mab-9 (Pocock and Woollard, unpublished observations), we found that mab-9 expression was altered in a vab-7 mutant background. mab-9 is normally first expressed in embryos at the 1.5-fold stage in the nuclei of three cells around the presumptive rectum, B, F and one hyp 7 nucleus (Fig. 9B) (Woollard and Hodgkin, 2000Go). In a vab-7(e1562) mutant background, however, the domain of mab-9 expression was more extensive, with three to four extra mab-9 expressing nuclei appearing more posterior to the usual mab-9 expressing nuclei (Fig. 9D). It is difficult to unambiguously assign these nuclei in a vab-7 background, because of the disruption in normal cell positioning in this mutant, but they appear to be muscle nuclei, and would normally be expected to express vab-7. We examined mab-9 expression in tbx-8/tbx-9(RNAi) embryos and found similar ectopic posterior expression (data not shown). This is consistent with the notion that TBX-8 and TBX-9 are required for the expression of vab-7 in posterior muscle cells, and that VAB-7 is required, in turn, to repress mab-9 expression in these cells.



View larger version (97K):
[in this window]
[in a new window]
 
Fig. 9. MAB-9 localisation in vab-7 mutants. (A,B) Embryo at the 1.5-fold stage carrying an integrated mab-9::GFP translational reporter construct (nomarski image on the left, (A), corresponding fluorescence image on the right, (B)). MAB-9 can be seen in three nuclei at this stage around the presumptive rectum, B, F and hyp 7, as has been previously reported (Woollard and Hodgkin, 2000Go). (C,D) vab-7(e1562) embryo also carrying an integrated mab-9::GFP reporter at the same stage (nomarski image on the left, (C), fluorescence image on the right, (D)). Ectopic MAB-9 can be seen in more posterior nuclei (arrows). Posterior is to the right in all panels. Scale bar, 10 µm.

 

    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Our data suggest that tbx-8 and tbx-9 have crucial, overlapping roles in controlling several aspects of embryonic morphogenesis and patterning. These two genes are required for the correct arrangement of dorsal and lateral hypodermal cells during intercalation and elongation and also form part of a regulatory network that includes two other T-box genes, tbx-30 and mab-9, and the homeobox gene vab-7. This network of T-box genes and vab-7 is important for the correct patterning of posterior cells.

Role of tbx-8 and tbx-9 in embryonic hypodermal morphogenesis
Embryos lacking both tbx-8 and tbx-9 fail to complete dorsal hypodermal intercalation, arresting as late embryos or short L1 larvae with gross morphological defects. Consistent with this phenotype, we found that tbx-8 and tbx-9 were both expressed at high levels in dorsal hypodermal cells undergoing intercalation, suggesting that tbx-8/tbx-9 are likely to be acting cell autonomously within the dorsal hypodermis to control these rearrangements. Although no obvious defect was seen on the ventral side of embryos during enclosure, the lateral hypodermal (seam) cells were often mispositioned, or pinched out of line. This may be a consequence of the dorsal intercalation defect, with the seam cells not being held in line properly by the dorsal syncytium.

There are some known mutants in C. elegans with similar dorsal hypodermal phenotypes, which might point to biochemical pathways in which tbx-8 and tbx-9 are acting. For instance, die-1 (dorsal intercalation and elongation defective) mutants also initiate, but fail to complete, dorsal intercalation (Heid et al., 2001Go). tbx-8, tbx-9 and die-1 are all expressed within dorsal hypodermal cells undergoing intercalation (Heid et al., 2001Go and this report). die-1 encodes a zinc finger protein thought to act as a transcriptional regulator, although it is not known at present what the transcriptional targets of die-1 might be, or how this gene might be regulated. It is also noteworthy that tbx-8/tbx-9(RNAi) animals display other phenotypes in common with die-1 mutants. These include lateral hypodermal cells being pinched out of line, body wall muscle cell positioning defects and abnormalities in gut morphogenesis (Heid et al., 2001Go) (this report). This would support the idea that tbx-8/tbx-9 and die-1 may act in the same pathway to regulate several aspects of embryonic morphogenesis.

Dorsal hypodermal intercalation in C. elegans has been likened to the process of convergent extension (directed intercalation of cells towards an axis of extension) in vertebrates (Chin-Sang and Chisholm, 2000Go). Intriguingly, it has been reported that the T-box gene spadetail is required in zebrafish embryos for lateral mesoderm cells to undergo the convergent extension movements of gastrulation (Griffin et al., 1998Go; Ho and Kane, 1990Go). Furthermore, Brachyury in Xenopus has also been shown to be required for convergent extension movements (Conlon et al., 1996Go; Conlon and Smith, 1999Go). Therefore, it seems that regulation of cell intercalation movements during embryonic morphogenesis is a conserved T-box gene function. Since spadetail and Brachyury have no obvious counterparts in C. elegans, and tbx-8 and tbx-9 have no obvious counterparts in vertebrates, we suggest that this may be an ancient role, with its origin in a common ancestral gene.

TBX-8/TBX-9 mediated activation of vab-7
We have shown that: (1) tbx-8, tbx-9 and vab-7 have overlapping expression domains in embryos in posterior muscle and hypodermal cells; (2) vab-7 expression in embryos requires tbx-8/tbx-9 activity; and (3) overexpression of tbx-8 or tbx-9 is sufficient to drive ectopic vab-7 expression throughout the embryo. This suggests that tbx-8, tbx-9 and vab-7 function in a common genetic pathway to control embryonic patterning events, with tbx-8 and tbx-9 acting as upstream activators of vab-7.

Posterior muscles (those derived from the C blastomere) in vab-7 mutants are disorganised. Muscle cells are often bunched together laterally or even form rings with neighbouring rows (Ahringer, 1996Go). We found similar defects in tbx-8/tbx-9(RNAi) animals, with muscle cells being present in the correct number, but severely misplaced, consistent with the notion that tbx-8 and tbx-9 are required for vab-7 expression and subsequent patterning activity in C blastomere-derived muscle cells. The muscle defects seen in tbx-8/tbx-9(RNAi) animals were not confined to the posterior, however, so it is likely that there are other muscle-specific targets of tbx-8/tbx-9 besides vab-7. It is also possible that some of the muscle defects seen in tbx-8/tbx-9(RNAi) animals are a secondary consequence of the other morphogenetic abnormalities. The bobbed tail appearance of tbx-9(RNAi) and vab-7(e1562) animals is likely to be the outcome of a hypodermal defect that is common to both situations. However, tbx-8/tbx-9(RNAi) worms also have more severe hypodermal defects during dorsal intercalation that are not seen in vab-7 mutants, suggesting that TBX-8 and TBX-9 are likely to influence the expression of multiple target genes involved in hypodermal cell rearrangements as embryogenesis proceeds.

Overexpression of tbx-8 or tbx-9 from the strong, inducible heat-shock promoter is sufficient to drive ectopic vab-7 expression throughout the embryo. The caudal orthologue pal-1 has also been shown to be capable of driving ectopic vab-7 expression, and, like tbx-8/tbx-9, is required for vab-7 expression (Ahringer, 1997Go). It is therefore of interest to consider whether tbx-8/tbx-9 act in the same pathway as pal-1 to regulate vab-7 expression. We have performed experiments, however, that show that tbx-8 and tbx-9 were still expressed in pal-1(RNAi) embryos (data not shown), albeit in a disorganised pattern, as would be expected if pal-1 expression was silenced (Hunter and Kenyon, 1996Go). Likewise, pal-1::GFP is still expressed in tbx-8/tbx-9(RNAi) embryos (data not shown); therefore we conclude that tbx-8/tbx-9 and pal-1 probably act in separate, complementary pathways to regulate vab-7 expression.

The activation of evenskipped in posterior cells by T-box genes has been reported in other systems, suggesting that this may be a conserved mechanism for controlling posterior pattern formation. For example, brachyenteron is required for eve expression in the hindgut and anal pad primordia of Drosophila (Kusch and Reuter, 1999Go; Singer et al., 1996Go), and in mouse, evx-1 expression has been shown to be dependent on Brachyury in the posterior tail bud (Rashbass et al., 1994Go). Likewise, no tail (ntl-zebrafish Brachyury) is required for the maintenance of eve1 expression during tail extension in zebrafish (Joly et al., 1993Go). Whether these examples of T-box gene mediated regulation of eve genes involve direct or indirect effects remains to be seen. It is also noteworthy that ectopic Xbra expression in Xenopus causes marked induction of the eve homologue Xhox3 (Cunliffe and Smith, 1992Go), similar to the induction of vab-7 expression caused by tbx-8 or tbx-9 overexpression reported here. Perhaps the regulation of eve has been taken over by tbx-8/tbx-9 in C. elegans in the absence of a bona fide Brachyury homologue.

TBX-30 is likely to be a direct repressor of vab-7 expression in anterior cells
If tbx-8 and tbx-9 directly activate vab-7, then this is not through the two T-box binding sites we have described, as mutating these sites did not eliminate vab-7 expression. By contrast, we found that mutating these T-box binding sites caused ectopic anterior expression of vab-7, suggesting that vab-7 may be subject to direct inhibitory regulation by another T-box gene. T-box genes have been shown to act as either activators or inhibitors of target gene expression (reviewed by Papaioannou, 2001Go). By silencing each of the C. elegans T-box genes in turn, we found that tbx-30 normally repressed vab-7 expression in anterior cells during embryogenesis. tbx-30 probably directly represses vab-7 at the anterior, through the T-box binding sites we have defined, as mutating these binding sites had exactly the same effect on vab-7 expression as silencing tbx-30.

Inhibitory effects of VAB-7 on mab-9 expression
eve orthologues are known to function as transcriptional repressors in a wide variety of situations and are thought to act by interacting with the basal transcriptional machinery at specific promoters (Han and Manley, 1993Go; Li and Manley, 1998Go). The VAB-7 protein contains two putative repressor domains that are also found in other members of the eve family. There is a polyalanine stretch near the N-terminus of VAB-7 and a region rich in proline and serine residues at the C-terminus (Ahringer, 1996Go). Alanine-rich and proline-rich regions have both been shown to function in transcriptional repression (Um et al., 1995Go). Our data suggest that VAB-7 acts to repress mab-9 expression in cells at the very posterior of embryos at the 1.5-fold stage. Ectopic expression of mab-9 is generally deleterious during development, resulting in embryonic arrest or animals with posterior deformations (Woollard and Hodgkin, 2000Go). It is possible, therefore, that inappropriate, ectopic expression of mab-9 in posterior cells contributes to the abnormal posterior phenotype of vab-7 mutant animals.

Overall, we have described a situation in which the activities of at least four different T-box genes in C. elegans (tbx-8, tbx-9, tbx-30 and mab-9) are linked by vab-7. A model for these regulatory interactions is depicted in Fig. 10. Although positive regulation of eve homeobox genes by T-box proteins has been reported in other systems, this is the first demonstration that an eve homeobox gene is also sensitive to T-box mediated repression, and that T-box genes themselves can be subject to repression by eve. The potential evolutionary association between the role of tbx-8 and tbx-9 in dorsal hypodermal intercalation in C. elegans and the role of T-box genes in convergent extension movements of cells in other organisms is a second intriguing connection. Perhaps the involvement of T-box genes in these kinds of cell rearrangements, which are an essential prelude to metazoan morphogenesis, will turn out to be widespread.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 10. Interactions between T-box genes and vab-7 in C. elegans. vab-7 expression is activated (probably indirectly) at the posterior of embryos by TBX-8 and TBX-9 working together. VAB-7, in turn, functions to repress mab-9 expression in posterior cells. Meanwhile, at the anterior of embryos, vab-7 is itself repressed by the action of TBX-30. This repression is likely to be direct, acting through T-box binding sites in the vab-7 5' regulatory region.

 

    ACKNOWLEDGMENTS
 
We would like to thank Jonathan Hodgkin and Sarah Newbury for helpful comments on the manuscript. R.P. and A.W. were funded by the UK Medical Research Council, the Biotechnology and Biological Sciences Research Council, and the Royal Society. M.M. and J.A. were funded by Wellcome Trust Fellowships (Nos 054523 and 045515). We would also like to thank Behrooz Esmaeili (University of Oxford) for making the vab-7::GFP reporter construct used in this study.


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 


Ahringer, J. (1996). Posterior patterning by the Caenorhabditis elegans even-skipped homolog vab-7. Genes Dev. 10,1120 -1130.[Abstract/Free Full Text]
Ahringer, J. (1997). Maternal control of a zygotic patterning gene in Caenorhabditis elegans. Development 124,3865 -3869.[Abstract]
Bamshad, M., Le, T., Watkins, W. S., Dixon, M. E., Kramer, B. E., Roeder, A. D., Carey, J. C., Root, S., Schinzel, A., Van Maldergem, L. et al. (1999). The spectrum of mutations in TBX3: genotype/phenotype relationship in ulnar-mammary syndrome. Am. J. Hum. Genet. 64,1550 -1562.[CrossRef][Medline]
Basson, C. T., Huang, T., Lin, R. C., Bachinsky, D. R., Weremowicz, S., Vaglio, A., Bruzzone, R., Quadrelli, R., Lerone, M., Romeo, G. et al. (1999). Different TBX5 interactions in heart and limb defined by Holt-Oram syndrome mutations. Proc. Natl. Acad. Sci. USA 96,2919 -2924.[Abstract/Free Full Text]
Braybrook, C., Doudney, K., Marcano, A. C., Arnason, A., Bjornsson, A., Patton, M. A., Goodfellow, P. J., Moore, G. E. and Stanier, P. (2001). The T-box transcription factor gene TBX22 is mutated in X-linked cleft palate and ankyloglossia. Nat. Genet. 29,179 -183.[CrossRef][Medline]
Brown, S. J., Parrish, J. K., Beeman, R. W. and Denell, R. E. (1997). Molecular characterization and embryonic expression of the even-skipped ortholog of Tribolium castaneum. Mech. Dev. 61,165 -173.[CrossRef][Medline]
Chapman, D. L. and Papaioannou, V. E. (1998). Three neural tubes in mouse embryos with mutations in the T-box gene Tbx6. Nature 391,695 -697.[CrossRef][Medline]
Chin-Sang, I. D. and Chisholm, A. D. (2000). Form of the worm: genetics of epidermal morphogenesis in C. elegans. Trends Genet. 16,544 -551.[CrossRef][Medline]
Conlon, F. L. and Smith, J. C. (1999). Interference with brachyury function inhibits convergent extension, causes apoptosis, and reveals separate requirements in the FGF and activin signalling pathways. Dev. Biol. 213,85 -100.[CrossRef][Medline]
Conlon, F. L., Sedgwick, S. G., Weston, K. M. and Smith, J. C. (1996). Inhibition of Xbra transcription activation causes defects in mesodermal patterning and reveals autoregulation of Xbra in dorsal mesoderm. Development 122,2427 -2435.[Abstract]
Cunliffe, V. and Smith, J. C. (1992). Ectopic mesoderm formation in Xenopus embryos caused by widespread expression of a Brachyury homologue. Nature 358,427 -430.[CrossRef][Medline]
Esmaeili, B., Ross, J., Neades, C., Miller, D. M. III and Ahringer, J. (2002). The C. elegans even-skipped homologue, vab-7, specifies DB motoneurone identity and axon trajectory. Development 129,853 -862.
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391,806 -811.[CrossRef][Medline]
Goh, P.-Y. and Bogaert, T. (1991). Positioning and maintenance of embryonic body wall muscle attachments in C. elegans requires the mup-1 gene. Development 111,667 -681.[Abstract]
Griffin, K. J., Amacher, S. L., Kimmel, C. B. and Kimelman, D. (1998). Molecular identification of spadetail: regulation of zebrafish trunk and tail mesoderm formation by T-box genes. Development 125,3379 -3388.[Abstract]
Han, K. and Manley, J. L. (1993). Transcriptional repression by the Drosophila even-skipped protein: definition of a minimal repression domain. Genes Dev. 7, 491-503.[Abstract/Free Full Text]
Heid, P. J., Raich, W. B., Smith, R., Mohler, W. A., Simokat, K., Gendreau, S. B., Rothman, J. H. and Hardin, J. (2001). The zinc finger protein DIE-1 is required for late events during epithelial cell rearrangement in C. elegans. Dev. Biol. 236,165 -180.[CrossRef][Medline]
Herrmann, B. G. (1995). The mouse Brachyury (T) gene. Semin. Dev. Biol. 6, 385-394.
Ho, R. K. and Kane, D. A. (1990). Cell-autonomous action of zebrafish spt-1 mutation in specific mesodermal precursors. Nature 348,728 -730.[CrossRef][Medline]
Huang, X., Cheng, H. J., Tessier-Lavigne, M. and Jin, Y. (2002). MAX-1, a novel PH/MyTH4/FERM domain cytoplasmic protein implicated in netrin-mediated axon repulsion. Neuron 34,563 -576.[CrossRef][Medline]
Hunter, C. P. and Kenyon, C. (1996). Spatial and temporal controls target PAL-1 blastomere specification activity to a single blastomere lineage in C. elegans embryos. Cell 87,217 -226.[CrossRef][Medline]
Joly, J. S., Joly, C., Schulte-Merker, S., Boulekbache, H. and Condamine, H. (1993). The ventral and posterior expression of the zebrafish homeobox gene eve1 is perturbed in dorsalized and mutant embryos. Development 119,1261 -1275.[Abstract]
Kispert, A., Herrmann, B. G., Leptin, M. and Reuter, R. (1994). Homologs of the mouse Brachyury gene are involved in the specification of posterior terminal structures in Drosophila, Tribolium, and Locusta. Genes Dev. 8,2137 -2150.[Abstract/Free Full Text]
Kispert, A., Koschorz, B. and Herrmann, B. G. (1995). The T protein encoded by Brachyury is a tissue-specific transcription factor. EMBO J. 14,4763 -4772.[Medline]
Kofron, M., Demel, T., Xanthos, J., Lohr, J., Sun, B., Sive, H., Osada, S., Wright, C., Wylie, C. and Heasman, J. (1999). Mesoderm induction in Xenopus is a zygotic event regulated by maternal VegT via TGFbeta growth factors. Development 126,5759 -5770.[Abstract]
Kostas, S. A. and Fire, A. (2002). The T-box factor MLS-1 acts as a molecular switch during specification of nonstriated muscle in C. elegans. Genes Dev. 16,257 -269.[Abstract/Free Full Text]
Kusch, T. and Reuter, R. (1999). Functions for Drosophila brachyenteron and forkhead in mesoderm specification and cell signalling. Development 126,3991 -4003.[Abstract]
Kusch, T., Storck, T., Walldorf, U. and Reuter, R. (2002). Brachyury proteins regulate target genes through modular binding sites in a cooperative fashion. Genes Dev. 16,518 -529.[Abstract/Free Full Text]
Li, C. and Manley, J. L. (1998). Even-skipped represses transcription by binding TATA binding protein and blocking the TFIID-TATA box interaction. Mol. Cell Biol. 18,3771 -3781.[Abstract/Free Full Text]
Mello, C. and Fire, A. (1995). DNA Transformation. In Caenorhabditis elegans: Modern Biological Analysis of an Organism. Vol. 48 (ed. D. Shakes and H. Epstein), pp. 451-482. San Diego: Academic Press.
Mohler, W. A., Simske, J. S., Williams-Masson, E. M., Hardin, J. D. and White, J. G. (1998). Dynamics and ultrastructure of developmental cell fusions in the Caenorhabditis elegans hypodermis. Curr. Biol. 8,1087 -1090.[CrossRef][Medline]
Muller, C. W. and Herrmann, B. G. (1997). Crystallographic structure of the T domain-DNA complex of the Brachyury transcription factor. Nature 389,884 -888.[CrossRef][Medline]
Papaioannou, V. E. (2001). T-box genes in development: from hydra to humans. Int. Rev. Cytol. 207, 1-70.[Medline]
Pflugfelder, G. O. and Heisenberg, M. (1995). Optomotor-blind of Drosophila melanogaster: A neurogenetic approach to optic lobe development and optomotor behaviour. Comp. Biochem. Physiol. A Physiol. 110,185 -202.[Medline]
Rashbass, P., Wilson, V., Rosen, B. and Beddington, R. S. (1994). Alterations in gene expression during mesoderm formation and axial patterning in Brachyury (T) embryos. Int. J. Dev. Biol. 38,35 -44.[Medline]
Simmer, F., Tijsterman, M., Parrish, S., Koushika, S. P., Nonet, M. L., Fire, A., Ahringer, J. and Plasterk, R. H. (2002). Loss of the putative RNA-directed RNA polymerase RRF-3 makes C. elegans hypersensitive to RNAi. Curr. Biol. 12,1317 -1319.[CrossRef][Medline]
Simon, H.-G. (1999). T-box genes and the formation of vertebrate forelimb and hindlimb specific pattern. Cell Tissue Res. 296,57 -66.[CrossRef][Medline]
Simske, J. S. and Hardin, J. (2001). Getting into shape: epidermal morphogenesis in Caenorhabditis elegans embryos. Bioessays 23,12 -23.[CrossRef][Medline]
Singer, J. B., Harbecke, R., Kusch, T., Reuter, R. and Lengyel, J. A. (1996). Drosophila brachyenteron regulates gene activity and morphogenesis in the gut. Development 122,3707 -3718.[Abstract]
Sinha, S., Abraham, S., Gronostajski, R. M. and Campbell, C. E. (2000). Differential DNA binding and transcription modulation by three T-box proteins, T, TBX1 and TBX2. Gene 258,15 -29.[CrossRef][Medline]
Smith, J. (1999). T-box genes: what they do and how they do it. Trends Genet. 15,154 -158.[CrossRef][Medline]
Sulston, J. and Hodgkin, J. (1988). Methods. In The Nematode Caenorhabditis elegans (ed. W. B. Wood), pp. 587-606. New York: Cold Spring Harbor Laboratory Press.
Um, M., Li, C. and Manley, J. L. (1995). The transcriptional repressor even-skipped interacts directly with TATA-binding protein. Mol. Cell Biol. 15,5007 -5016.[Abstract]
Woollard, A. and Hodgkin, J. (2000). The Caenorhabditis elegans fate-determining gene mab-9 encodes a T-box protein required to pattern the posterior hindgut. Genes Dev. 14,596 -603.[Abstract/Free Full Text]
Zhang, J., Houston, D. W., King, M. L., Payne, C., Wylie, C. and Heasman, J. (1998). The role of maternal VegT in establishing the primary germ layers in Xenopus embryos. Cell 94,515 -524.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Brief Funct Genomic ProteomicHome page
E. M. Maine
Studying gene function in Caenorhabditis elegans using RNA-mediated interference
Brief Funct Genomic Proteomic, May 1, 2008; 7(3): 184 - 194.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. Kagoshima, R. Nimmo, N. Saad, J. Tanaka, Y. Miwa, S. Mitani, Y. Kohara, and A. Woollard
The C. elegans CBF{beta} homologue BRO-1 interacts with the Runx factor, RNT-1, to promote stem cell proliferation and self-renewal
Development, November 1, 2007; 134(21): 3905 - 3915.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
L. R. Baugh, A. A. Hill, J. M. Claggett, K. Hill-Harfe, J. C. Wen, D. K. Slonim, E. L. Brown, and C. P. Hunter
The homeodomain protein PAL-1 specifies a lineage-specific regulatory network in the C. elegans embryo
Development, April 15, 2005; 132(8): 1843 - 1854.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.01110v1
131/10/2373    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pocock, R.
Right arrow Articles by Woollard, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pocock, R.
Right arrow Articles by Woollard, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?