|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online May 5, 2004
doi: 10.1242/10.1242/dev.01104

Department of Molecular, Cellular and Developmental Biology, University of Michigan, Ann Arbor, MI 48109-1048, USA
Author for correspondence (e-mail:
cadigan{at}umich.edu)
Accepted 29 January 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila, Eye, Apoptosis, Wnt, head involution defective, reaper, grim
| Introduction |
|---|
|
|
|---|
Elimination of excess cells is essential for the formation of the compound
eye of Drosophila. The fly eye consists of approximately 750 repeated
units called ommatidia, which consist of eight photoreceptor neurons (R
cells), four cone cells (which secrete the lens) and two primary pigment cells
(Wolff and Ready, 1993
).
Differentiation of these cells is triggered by the passage of the
morphogenetic furrow (MF). During late larval/early pupal stages, as R cells
differentiate in regularly spaced clusters behind the MF, undifferentiated
cells furthest from these clusters undergo PCD
(Baker and Yu, 2001
). One day
after the start of pupation, after all the cells of each ommatidium have been
specified and organized into an ordered array, an additional round of
apoptosis reduces the number of interommatidial cells. The survivors of this
trimming become secondary and tertiary pigment cells
(Brachmann and Cagan, 2003
). In
both these cases, the epidermal growth factor receptor (EGFR)/Ras signaling
pathway is thought to provide a survival signal
(Baker and Yu, 2001
;
Miller and Cagan, 1998
;
Yu et al., 2002
). The primary
target of this survival signal is the proapoptotic factor Head involution
defective (Hid) (Yu et al.,
2002
). Ras signaling inhibits Hid activity post-translationally
(Bergmann et al., 1998
) and
downregulates hid transcript levels
(Kurada and White, 1998
).
Hid belongs to a group of proteins that promote PCD by inhibiting the
activity and/or stability of inhibitor of apoptosis proteins (IAPs)
(Martin, 2002
;
Shi, 2002
). These IAP
inhibitors share limited sequence similarity, most notably a short RHG domain
at their N-termini that binds to IAPs
(Shi, 2002
). In flies, the
founding members of this group were hid, reaper (rpr) and
grim (Chen et al.,
1996
; Grether et al.,
1995
; White et al.,
1994
). More recently, an additional family member called
sickle was identified in flies
(Christich et al., 2002
;
Srinivasula et al., 2002
;
Wing et al., 2002
), and
SMAC/Diablo (Du et al., 2000
;
Verhagen et al., 2000
) and
HtrA2/Omi (Suzuki et al.,
2001
) have been identified in mammals.
In addition to the apoptotic events mentioned above, there is a later
occurrence of PCD in the fly eye that is less well understood. A ring of
apoptotic cells is found at the periphery of the eye at mid-pupation
(Wolff and Ready, 1991
). These
dying cells at the edge of the ommatidial field contain photoreceptors, cone
cells and primary pigment cells (Hay et
al., 1994
; Wolff and Ready,
1991
).
We have found that Wg expression coincides with the mid-pupal ring of apoptosis. Wg signaling at the eye's perimeter activates Wg expression in peripheral ommatidia. Wg signaling also induces the expression of hid, rpr and grim, and these genes are required for the elimination of approximately 80-100 perimeter ommatidia/eye. The ommatidia destined for PCD are often incomplete, probably resulting from an insufficient number of precursor cells at the edge of the eye for recruitment into clusters.
Under normal conditions, Wg signaling is tightly correlated with the
stability of cytosolic Armadillo (Arm), the fly ß-catenin homolog
(Peifer et al., 1994
;
van Leeuwen et al., 1994
).
apc1 is a fly homolog of the adenomatous polyposis coli (APC) tumor
suppressor gene, which encodes a negative regulator of Arm/ß-catenin
stability (Polakis, 2000
).
Mutation of apc1 results in arm-dependent mid-pupal
apoptosis of all photoreceptors (Ahmed et
al., 1998
). We found that this PCD occurred at the same time as
the peripheral ommatidial cell death and that it is also dependent on hid,
rpr and grim. Mutations in the APC gene in humans cause retinal
lesions in which photoreceptor neurons degenerate
(Traboulsi et al., 1990
). This
and other results will be discussed in regard to the possible role Wnt
induction of apoptosis may play in vertebrate eye development and disease.
| Materials and methods |
|---|
|
|
|---|
Histology and scanning electron microscopy
Immunostainings were performed as described
(Cadigan and Nusse, 1996
). Rat
anti-Elav (1:100) and mouse anti-Cut (1:75) were from the University of Iowa
Hybridoma Bank. Affinity purified mouse anti-Pros (1:5000) was from Richard
Carthew. Affinity purified rabbit anti-Wg (1:50) was prepared as described
(Bhanot et al., 1996
). Guinea
pig anti-Sens (1:500) was kindly provided by Hugo Bellen and rabbit anti-Bar
(1:50) by K. Saigo. Mouse anti-lacZ was purchased from Sigma (St Louis, MO).
Cy3- and Cy5-conjugated secondary antibodies were from Jackson Immunochemicals
(West Grove, PA) and Alexa Flour 488-conjugated secondaries were from
Molecular Probes (Eugene, OR). TUNEL staining was performed as described
(Wang et al., 1999
) using the
Cell Death Detection Kit (Fluorescein) from Roche Diagnostics (Indianapolis,
IN). All fluorescent pictures were obtained with a Zeiss Axiophot coupled to a
Zeiss LSM510 confocal apparatus.
In-situ hybridizations were performed as previously described
(Cadigan et al., 1998
). Probes
were made by PCR on genomic DNA with the following oligos:
5'CTTGCAATTTCACTGGCGGCGATGTGT3' and
5'GTAATACGACTCACTATAGGGCGGCCAAGTGAAGCTCTGTGGTTTCTTC3' for
hid, 5'CGTTCGTTTTCCCGCCAAATGAGTCAG3' and
5'GTAATACGACTCACTATAGGGCGCTCGTTCCTCCTCATGTGTCCATAC3' for
grim, 5'GACACCAGAACAAAGTGAACGAACTCG3' and
5'GTAATACGACTCACTATAGGGCGTGTTGTGGCTCTGTGTCCTTGACTGCA3' for
rpr. Oligos on the reverse strands each has a T7 RNA polymerase site.
Antisense dioxygenin probes were synthesized using the Ambion T7 Megascript
kit with the Roche DIG RNA labeling mix.
Samples for scanning electron microscopy (SEM) were prepared as previously
described (Cadigan and Nusse,
1996
). All images were processed as Adobe Photoshop files.
| Results |
|---|
|
|
|---|
|
Inside the mutant clones, extra R cell clusters were apparent
(Fig. 1S,T), while apoptotic
Elav-positive cells outside the clone were observed
(Fig. 1S). Many extra
photoreceptor clusters were also seen at the perimeter when the caspase
inhibitor p35 was expressed throughout the eye
(GMRGal4::UAS-p35) (Fig.
1K), consistent with earlier reports
(Hay et al., 1994
). Thus Wg
removed ommatidia at the edge of midpupal eyes by activation of apoptosis.
Wg induces its own expression in ommatidia destined to die
When PCD was blocked by expression of p35
(Fig. 1J), a dramatic increase
in Wg expression was observed (Fig.
1I), which corresponded to the perimeter ommatidia
(Fig. 1L). In wild-type eyes at
an earlier time (24 hours APF), Wg was expressed uniformly at the edge
(Fig. 2A). By 28 hours APF,
most of the perimeter of each eye displayed Wg expression in clusters
(Fig. 2B), which corresponded
to R cells (data not shown, but see Fig.
2F,G). This was more apparent at 32 hours APF
(Fig. 2C), and Wg expression in
the ommatidia started to fade by 36 hours APF
(Fig. 2D). At 24 and 28 hours
APF, almost all the apoptotic cells were in the interior
(Fig. 2A,B), corresponding to
the elimination of inter-ommatidial cells
(Hay et al., 1994
;
Miller and Cagan, 1998
).
TUNEL-positive nuclei at the edge of the eye were apparent at 32 hours APF,
and their number increased by 36 hours APF
(Fig. 2D), although they were
still far from the numbers seen at 42 hours APF. These data indicate that Wg
expression in the peripheral ommatidia preceded PCD. If apoptosis was blocked,
elevated Wg expression persisted in the ommatidia that were to be eliminated
(Fig. 1I).
|
An alternative explanation for the lack of Wg-positive ommatidia in the pygo clones at 30 hours APF is that these mutant cells were developmentally delayed. In such a scenario, Wg expression would occur later and eventually cause PCD. However, Wg was not found in perimeter ommatidia of pygo clones at 36 hours APF (data not shown) or 42 hours APF (Fig. 1R and data not shown). Consistent with this, no sign of apoptosis was observed in mutant clones at 48 hours APF (Fig. 2J) or 54 hours APF (data not shown), long after control ommatidia had undergone PCD. Perimeter ommatidia were still found in the pygo clones at 54 hours (Fig. 2L) and likely persisted until adulthood (data not shown and Fig. 5H). There was no detectable developmental lag in cells unresponsive to Wg. Rather, these cells were unable to initiate autoregulation of Wg expression or Wg-dependent PCD.
|
|
|
The H99 deficiency completely removes hid, grim and
rpr but not sickle
(White et al., 1994
;
Christich et al., 2002
;
Wing et al., 2002
). The
X25 deletion removes hid and grim while the
XR38 deficiency removes rpr and sickle
(Peterson et al., 2002
).
Clones of X25 showed a strong reduction of apoptosis 60% of the time
(arrowhead in Fig. 4C,D), with
the reminder having a much smaller reduction in TUNEL (arrow in
Fig. 4C,D).
H99/+ heterozygotes displayed a phenotype at the eye's
perimeter similar to that of hid mutants, while
H99/XR38 eyes displayed slightly less TUNEL signal than in
H99/+ (data not shown). In H99 homozygous clones,
there was almost no apoptosis (Fig.
4F) and extra R cell clusters were observed
(Fig. 4G; see arrows). No
evidence for a developmental lag was observed in H99 clones, with
Wg-positive ommatidia appearing at the same time as controls
(Fig. 4J) and perimeter R cells
persisting until 54 hours APF with no sign of PCD
(Fig. 4L and data not
shown).
The above data suggest that all three pro-apoptotic factors in the
H99 interval are required for the wg-dependent PCD at the
edge of the eye. hid, grim and rpr transcripts were all
elevated at the periphery in GMR-Gal4::UAS-p35 eyes
(Fig. 4M-O). The expression
pattern was clustered in a similar pattern to that found for Wg expression.
The perimeter expression of all three genes was completely abolished in
GMR-Gal4::UAS-GPI-fz2 eyes (Fig.
4P-R). GPI-Fz2 is known to be an efficient inhibitor of Wg
signaling (Cadigan et al.,
1998
) and blocked peripheral apoptosis as completely as p35 (data
not shown). These results strongly suggest that hid, grim and
rpr are expressed in the Wg-positive peripheral ommatidia and that Wg
signaling is required for this expression.
Perimeter ommatidia are often incomplete
Ommatidia are formed by the sequential recruitment of cells into clusters.
The process starts with the specification of evenly spaced R8 neurons, which
then recruit four additional neurons (R2-R5). After a wave of mitosis, R1 and
R6 are added and then specification of R7 completes the eight R cell
complement. Four cone cells and two primary pigment cells are then added
(Wolff and Ready, 1993
).
Staining with the general neuronal marker Elav revealed that many ommatidia
at the edge of the eye were incomplete
(Fig. 5B,D and data not shown).
We examined the composition of the peripheral ommatidia using cell-specific
markers. Senseless (Sens) is a marker for R8
(Frankfort et al., 2001
), Bar
for R1/R6 (Higashijima et al.,
1992
), Prospero for R7
(Kauffmann et al., 1996
) and
Cut for cone cells (Blochlinger et al.,
1993
). Wild-type or GMR-Gal4::UAS-p35 eyes were stained
for these proteins at 5 or 30-32 hours APF, before perimeter apoptosis
occurred, with similar results. This indicates that PCD did not influence the
perimeter ommatidia composition before 32 hours APF. All the ommatidia
containing at least two Elav-positive cells had one R8 and almost all single
Elav-positive cells were Sens-positive (data not shown). Some peripheral
ommatidia were missing either R1 or R6
(Fig. 5A,D) and many had fewer
than four cone cells (e.g. asterisk in Fig.
5C). We conclude that many of the ommatidia destined to die are
incomplete, perhaps from lack of cells at the edge of the eye field for
recruitment into the developing clusters. Interestingly, most (>80%)
perimeter ommatidia had an R7 cell, even if they had fewer than the normal
complement of R cells (arrowheads in Fig.
5B).
The incomplete ommatidia were clearly eliminated, since they were not found
at 42 hours APF (data not shown). To determine whether complete ommatidia are
also eliminated, we used Wg expression at 32 hours APF as a marker for
ommatidia that will undergo PCD. Many Wg-positive ommatidia had an R7 cell
(Fig. 5B,E) and four cone cells
(Fig. 5C,F). Occasionally,
Wg-positive ommatidia appeared to have the normal number of Elav-positive R
cells (arrow in Fig. 5B,E). The
Wg-positive cone cells clusters were often smaller than normal
(Fig. 5C,F; arrowheads),
although occasionally we observed some of near normal size (arrows in
Fig. 5C,F). These cells are
capable of secreting lens, as evidenced by the presence of surface ommatidia
of reduced size at the edge of adult eyes containing large clones of
pygo or fz, fz2 (Fig.
5H and data not shown). The clone shown is at the ventralmost
portion of the eye, where inhibition of Wg signaling did not result in
expansion of the eye field at the expense of head anlage (data not shown), as
is observed when Wg signaling is blocked dorsally
(Heslip et al., 1997
). Small
extra ommatidia are also observed at the edge of adult
GMR-Gal4::UAS-p35 eyes (data not shown)
(Hay et al., 1994
).
The R cell apoptosis seen in apc1 mutants depends on hid, grim and rpr
Mutants in the apc1 gene, which encodes a negative regulator of Wg
signaling, cause R cells to undergo PCD during mid-pupation
(Ahmed et al., 1998
). In
addition, expression of an activated form of Arm results in a similar
phenotype (Ahmed et al., 1998
;
Freeman and Bienz, 2001
). We
found that R cell apoptosis in apc1 mutants occurred at the same time
as the perimeter cell death in wild type, with TUNEL-positive cells arising
around 35 hours APF (data not shown) and peaking at 42 hours APF
(Fig. 6E). All Elav-positive
cells were eliminated by 54 hours APF (data not shown). Adult apc1
mutants survive to adulthood and have slightly smaller eyes (K. Cadigan,
unpublished observations) with no photoreceptors
(Ahmed et al., 1998
).
|
Interestingly, we found no elevation of Wg expression in the interior of apc1 mutant eyes, even when PCD was completely blocked in H99 mutant clones (data not shown). Thus, the elevated Wg signal in the absence of apc1 was not sufficient to activate the Wg autoregulatory loop.
| Discussion |
|---|
|
|
|---|
Mid-pupal apoptosis at the eye's perimeter depends on Wg signaling
During mid-pupation (36-44 hours APF), ommatidia at the edge of the eye are
eliminated through PCD that depends on Wg signaling. Our results indicate the
following order of events, summarized in
Fig. 7. The ring of Wg
expression bordering the eye anlage is initially established around 6 hours
APF (Cadigan et al., 2002
)
(data not shown). At 24 hours APF, after eversion of the pupal eye, Wg is
found in cells at the edge of the eye that are distinct from the perimeter
ommatidia (Fig. 2F-H and data
not shown). Several hours later, between 28-32 hours APF, Wg expression is
found in some of these ommatida (Fig.
2B,C). The establishment of this pattern depends on the ommatidial
cells being able to transduce the Wg signal
(Fig. 2E-G). Wg signaling then
activates the expression of hid, grim and rpr and apoptosis
ensues. Under normal conditions, Wg expression is largely faded from apoptotic
ommatidia by 36 hours APF (Fig.
2D). When apoptosis is blocked, the positive feedback loop of Wg
expression is unchecked, and Wg and the pro-apoptotic factors can accumulate
to high levels (Fig. 1I;
Fig. 4M-O).
|
Incomplete ommatidia are not found at the edge of wild-type eyes (data not
shown) (Hay et al., 1994
).
Therefore, the partial ommatidia observed during early/mid-pupation are
destined to die. These ommatidia are also marked by Wg expression at 30-32
hours APF (Fig. 2C,F). The
smallest of these clusters has just one cell, usually expressing a marker for
the R8 cell type (data not shown). All ommatidia containing more than one R
cell contain an R8, but many are missing either R1 or R6
(Fig. 5A,D). Around 20% of the
ommatidia destined to die were lacking an R7 cell (data not shown). There are
also Wg-positive clusters containing 0-3 cone cells, instead of the normal
four (Fig. 5C,F and data not
shown). We suspect that the clusters at the perimeter of the eye field simply
run out of surrounding cells to recruit.
While most of the eliminated ommatidia appear to have been incomplete, we
believe that some did possess the full complement of neurons and support
cells. Some Wg-positive ommatidia appeared to contain eight R cells
(Fig. 5B,E), and ones
containing four cones cells were not uncommon
(Fig. 5C,F). Many also
possessed two primary pigment cells (data not shown). Almost all the
Wg-positive ommatidia that possessed four cone cells appeared significantly
smaller than normal (arrowheads in Fig.
5C,F and data not shown). These correspond to the `stunted
ommatidia' previously reported (Hay et
al., 1994
; Wolff and Ready,
1991
). These ommatidia probably give rise to the smaller ommatidia
observed at the edge of adult eyes containing fz, fz2 or
pygo clones (Fig. 5H
and data not shown).
How many ommatidia are eliminated by Wg signaling during development? There are approximately 80-100 Wg-positive ommatidia in GMR-Gal4::UAS-lacZ or GMR-Gal4::UAS-p35 eyes at 32 hours APF. These estimates do not include the 1-2 cell clusters that are difficult to distinguish. Assuming an average of five R cells/Wg cluster, 400 to 500 R cells would be eliminated per eye. There are about 6000 photoreceptors in the adult eye. This calculation suggests that between 6.2 and 7.7% of the pupal photoreceptors are removed by Wg signaling during mid-pupation.
Besides the elimination of ommatidia described in this study, Wg signaling
at the perimeter of the eye has also been shown to specify the pigment rim
epithelia (Tomlinson, 2003
)
and to induce Homothorax expression, which is necessary for specification of
the dorsal rim inner photoreceptors, which are specialized for detection of
polarized light (Wernet et al.,
2003
). Thus, Wg signaling has multiple roles in refining the
perimeter of the developing eye.
The function of ommatidia removal
What purpose does the elimination of these perimeter ommatidia achieve? The
answer probably lies in the connections between the six outer R cells of each
ommatidium and their post-synaptic targets in the laminal layer of the optic
ganglia. The lamina is organized into units called cartridges, which underlie
each ommatidium and form synapses with the outer R cells. Because of the
precise arrangement of the photoreceptors in the ommatidia and the curvature
of the eye, a single line of sight is perceived by six different outer
photoreceptors (R1-R6) residing in six different ommatidia. These R cells do
not innervate the underlying cartridge; rather, each cell forms a synapse with
a distinct adjacent cartridge. In this way, visual excitation in the curved
surface of the retina is transformed into a smooth topographic map in the
optic ganglia (for reviews see
Meinertzhagen and Hanson,
1993
; Clandinin and Zipursky,
2002
).
Because there is not a one-to-one relationship between ommatidia and lamina
cartridges, a problem arises at the edge of the eye, where there are not
enough adjacent cartridges for perimeter ommatidia to form synapses with. The
development of the optic ganglia is stimulated by the projection of axons from
the overlying ommatidia during larval and early pupal development
(Meinertzhagen and Hanson,
1993
). The peripheral-most ommatidia are thought to induce
underlying cartridges before they are eliminated. Thus, there are extra
laminal targets at the eye's edge for the remaining perimeter outer R cells to
innervate (Meinertzhagen and Hanson,
1993
). Removal of ommatidia by wg-dependent PCD should
minimize the number of incorrect connections that would compromise the fly's
peripheral vision.
What is the signal triggering the Wg autoactivation circuit?
The cells at the edge of the eye express Wg from 6 hours APF
(Cadigan et al., 2002
).
However, Wg from these edge cells does not activate Wg in the adjacent
ommatidia until 26-32 hours APF. Wg signaling alone is not sufficient to
trigger Wg autoactivation, since elevated Wg expression is not observed in
apc1 mutant eyes (data not shown), even though the pathway is
activated enough to induce R cell apoptosis
(Fig. 6E)
(Ahmed et al., 1998
). There
must be some other signal(s) that triggers the wg self-activation in
the perimeter ommatidia.
The edge cells expressing Wg could also express another signal that would
allow the Wg signal to activate Wg expression in the ommatidia at the
appropriate time. This simply moves the problem back one step; i.e. what then
triggers the expression/activation of this signal? An alternative is the
presence of a signal that counteracts Wg signaling until 24-28 hours APF. One
candidate is Ras signaling, which can block the activity of Wg in the eye
(Freeman and Bienz, 2001
;
Hazelett et al., 1998
). It has
been previously suggested that elevated Ras signaling during larval and early
pupal stages prevents overexpression of a stablized form of Arm from inducing
PCD until mid-pupation (Freeman and Bienz,
2001
). However, we found that overexpression of an activated form
of ras did not block the perimeter apoptosis (H. Lin and K. Cadigan,
unpublished). Therefore, we think it unlikely that a decrease in the Ras
pathway is the signal allowing Wg to initiate the apoptotic cascade.
As discussed above, some eliminated ommatidia appear to have the full complement of cell types, so incompleteness does not appear to be the signal. However, the ommatidia destined to die are almost always smaller than normal (Fig. 5C,F and data not shown). Small size combined with Wg from the edge cells could initiate Wg expression in the ommatidia.
Another candidate for the trigger is the failure of synapse formation
between the R cell neurons and their targets in the optic ganglia. Projection
of the R cell axons into the ganglia is complete by early pupation, but the
formation of synapses between the outer R cells and the lamina neurons does
not occur until 24-38 hours APF (Clandinin
and Zipursky, 2002
). Perhaps the R cells from perimeter ommatidia
cannot find enough post-synaptic targets because they are at the edge of the
field. The absence of a retrograde signal from neurons in the optic ganglia
could lead to the accumulation of Wg in these ommatidia.
Implications for eye development in other organisms and human disease
The expression pattern of Wg in the eyes of other arthropods suggests that
it may function in a similar fashion as in Drosophila melanogaster.
The flour beetle Tribolium castaneum is a primitive holometabolous
insect species, in which the adult eye forms at the end of larval development
from lateral head ectoderm known as optic placodes. During early pupation, the
beetle ortholog of wg is expressed in a ring around the optic
placodes (Friedrich and Benzer,
2000
). In the crustacean Mysidium columbiae (mysid),
retinal morphogenesis occurs in a posterior-to-anterior direction as in
Drosophila (Duman-Scheel et al.,
2002
). As this occurs, the mysid ortholog of wg is
expressed in a half ring around the posterior of the developing eye
(Duman-Scheel et al., 2002
).
It will be interesting to determine whether this ring becomes complete as
retinal differentiation proceeds and whether apoptosis occurs at the edge of
the eye in beetles and mysids.
The finding that Pax6 orthologs in flies, mice and humans are
necessary for eye development has suggested a common origin for eyes
(Halder et al., 1995
).
However, vertebrate and insect eyes have completely different morphologies, as
well as distinct embryonic origins. This has led to the idea that a common
`primitive unit' consisting of light-sensing photoreceptors has been recruited
for organogenesis several times during animal evolution
(Gehring and Ikeo, 1999
).
However, many interesting parallels exist in the development of insect and
vertebrate eyes, perhaps because of utilization of genetic circuits that were
developed before the divergence of these species
(Pichaud et al., 2001
).
The periphery of the vertebrate eye contains the ciliary marginal zone
(CMZ), which contains undifferentiated retinal progenitor cells, which can
differentiate to add neurons and glia to the periphery of the eye
(Reh and Levine, 1998
). In the
developing chick eye, Wnt2b is expressed in the CMZ. Blocking Wnt signaling
causes premature differentiation of neuronal progenitors
(Kubo et al., 2003
). Whether
Wnt signaling acts in part through inducing apoptosis in the CMZ remains to be
examined.
A possible connection between Wnt signaling and PCD in insect and
vertebrate eyes is also suggested by similarity in APC mutations. In flies,
apc1 mutants have retinal apoptosis
(Ahmed et al., 1998
)
(Fig. 6). Some humans
heterozygous for mutations in the APC gene also display retinal
lesions, termed congenital hypertrophy of the retinal pigment epithelium
(CHRPE). While an increase in the thickness of the retinal pigment epithelium
is the most consistent feature of the condition in humans
(Buettner, 1975
;
Traboulsi et al., 1990
) and in
mice carrying a similar mutation (Marcus
et al., 2000
), photoreceptor degeneration is also observed in
several lesions. Because these lesions are probably due to somatic
inactivation of the wild-type APC allele, they are variable and
difficult to study systematically. A more direct comparison with the fly
apc1 mutants is needed, perhaps with conditional knockouts of the
mouse APC gene.
We have shown that in the fly eye, Wg induces apoptosis by activating the
expression of hid, grim and rpr. These proteins then
inactivate the caspase inhibitor IAP through an RHG domain at their N-termini
(Shi, 2002
). hid,
grim and rpr have no obvious orthologs in vertebrates, although
Smac/Diablo and HtrA2/Omi possess an RHG at their N-termini and inhibit IAP
activity (Du et al., 2000
;
Verhagen et al., 2000
;
Suzuki et al., 2001
). If Wnt
signaling induces PCD in the vertebrate eye, does this occur through
activation of Smac and/or HtrA2 expression? A similar parallel has been found
in p53-induced apoptosis, where rpr is activated in flies
(Brodsky et al., 2000
) and
HtrA2 in human cell culture (Jin et al.,
2003
). The involvement of Wnt signaling in the human eye though
the induction of IAP inhibitors clearly deserves further consideration.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
* Present address: University of Mainz, Mainz, Germany ![]()
| REFERENCES |
|---|
|
|
|---|
Ahmed, Y., Hayashi, S., Levine, A. and Wieschaus, E. (1998). Regulation of armadillo by a Drosophila APC inhibits neuronal apoptosis during retinal development. Cell 93,1171 -1182.[CrossRef][Medline]
Baker, N. E. (1988). Embryonic and imaginal requirements for wingless, a segment-polarity gene in Drosophila. Dev. Biol. 125,96 -108.[CrossRef][Medline]
Baker, N. E. and Yu, S. Y. (2001). The EGF receptor defines domains of cell cycle progression and survival to regulate cell number in the developing Drosophila eye. Cell 104,699 -708.[CrossRef][Medline]
Belenkaya, T. Y., Han, C., Standley, H. J., Lin, X., Houston, D.
W. and Heasman, J. (2002). pygopus encodes a nuclear protein
essential for wingless/Wnt signaling. Development
129,4089
-4101.
Bergmann, A., Agapite, J., McCall, K. and Steller, H. (1998). The Drosophila gene hid is a direct molecular target of Ras-dependent survival signaling. Cell 95,331 -341.[CrossRef][Medline]
Bhanot, P., Brink, M., Samos, C. H., Hsieh, J. C., Wang, Y., Macke, J. P., Andrew, D., Nathans, J. and Nusse, R. (1996). A new member of the frizzled family from Drosophila functions as a Wingless receptor. Nature 382,225 -230.[CrossRef][Medline]
Bhanot, P., Fish, M., Jemison, J. A., Nusse, R., Nathans, J. and Cadigan, K. M. (1999). Frizzled and Dfrizzled-2 function as redundant receptors for Wingless during Drosophila embryonic development. Development 126,4175 -4186.[Abstract]
Blochlinger, K., Jan, L. Y. and Jan, Y. N. (1993). Postembryonic patterns of expression of cut, a locus regulating sensory organ identity in Drosophila. Development 117,441 -450.[Abstract]
Brachmann, C. B. and Cagan, R. L. (2003). Patterning the fly eye: the role of apoptosis. Trends Genet. 19,91 -96.[CrossRef][Medline]
Brodsky, M. H., Nordstrom, W., Tsang, G., Kwan, E., Rubin, G. M. and Abrams, J. M. (2000). Drosophila p53 binds a damage response element at the reaper locus. Cell 101,103 -113.[CrossRef][Medline]
Buettner, H. (1975). Congenital hypertrophy of the retinal pigment epithelium. Am. J. Ophthalmol. 79,177 -189.[Medline]
Cadigan, K. M., Fish, M. P., Rulifson, E. J. and Nusse, R. (1998). Wingless repression of Drosophila frizzled 2 expression shapes the Wingless morphogen gradient in the wing. Cell 93,767 -777.[CrossRef][Medline]
Cadigan, K. M., Jou, A. D. and Nusse, R. (2002). Wingless blocks bristle formation and morphogenetic furrow progression in the eye through repression of Daughterless. Development 129,3393 -3402.
Cadigan, K. M. and Nusse, R. (1996). wingless signaling in the Drosophila eye and embryonic epidermis. Development 122,2801 -2812.[Abstract]
Chen, C. M. and Struhl, G. (1999). Wingless transduction by the Frizzled and Frizzled2 proteins of Drosophila. Development 126,5441 -5452.[Abstract]
Chen, P., Nordstrom, W., Gish, B. and Abrams, J. M.
(1996). grim, a novel cell death gene in Drosophila.
Genes Dev. 10,1773
-1782.
Christich, A., Kauppila, S., Chen, P., Sogame, N., Ho, S. I. and Abrams, J. M. (2002). The damage-responsive Drosophila gene sickle encodes a novel IAP binding protein similar to but distinct from reaper, grim, and hid. Curr. Biol. 12,137 -140.[CrossRef][Medline]
Clandinin, T. R. and Zipursky, S. L. (2002). Making connections in the fly visual system. Neuron 35,827 -841.[CrossRef][Medline]
Davis, I., Girdham, C. H. and O'Farrell, P. H. (1995). A nuclear GFP that marks nuclei in living Drosophila embryos; maternal supply overcomes a delay in the appearance of zygotic fluorescence. Dev. Biol. 170,726 -729.[CrossRef][Medline]
Du, C., Fang, M., Li, Y., Li, L. and Wang, X. (2000). Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 102,33 -42.[CrossRef][Medline]
Duman-Scheel, M., Pirkl, N. and Patel, N. H. (2002). Analysis of the expression pattern of Mysidium columbiae wingless provides evidence for conserved mesodermal and retinal patterning processes among insects and crustaceans. Dev. Genes Evol. 212,114 -123.[CrossRef][Medline]
Frankfort, B. J., Nolo, R., Zhang, Z., Bellen, H. and Mardon, G. (2001). senseless repression of rough is required for R8 photoreceptor differentiation in the developing Drosophila eye. Neuron 32,403 -414.[CrossRef][Medline]
Freeman, M. and Bienz, M. (2001). EGF receptor/Rolled MAP kinase signalling protects cells against activated Armadillo in the Drosophila eye. EMBO Rep. 2, 157-162.[CrossRef][Medline]
Friedrich, M. and Benzer, S. (2000). Divergent decapentaplegic expression patterns in compound eye development and the evolution of insect metamorphosis. J. Exp. Zool. 288, 39-55.[CrossRef][Medline]
Gehring, W. J. and Ikeo, K. (1999). Pax 6: mastering eye morphogenesis and eye evolution. Trends Genet. 15,371 -377.[CrossRef][Medline]
Grether, M. E., Abrams, J. M., Agapite, J., White, K. and
Steller, H. (1995). The head involution defective gene of
Drosophila melanogaster functions in programmed cell death. Genes
Dev. 9,1694
-1708.
Halder, G., Callaerts, P. and Gehring, W. J. (1995). New perspectives on eye evolution. Curr. Opin. Genet. Dev. 5,602 -609.[CrossRef][Medline]
Hay, B. A., Wolff, T. and Rubin, G. M. (1994). Expression of baculovirus P35 prevents cell death in Drosophila. Development 120,2121 -2129.[Abstract]
Hazelett, D. J., Bourouis, M., Walldorf, U. and Treisman, J. E. (1998). decapentaplegic and wingless are regulated by eyes absent and eyegone and interact to direct the pattern of retinal differentiation in the eye disc. Development 125,3741 -3751.[Abstract]
Heslip, T. R., Theisen, H., Walker, H. and Marsh, J. L. (1997). SHAGGY and DISHEVELED exert opposite effects on wingless and decapentapleigic expression and on positional identity in imaginal discs. Development 124,1069 -1078.[Abstract]
Higashijima, S., Kojima, T., Michiue, T., Ishimaru, S., Emori,
Y. and Saigo, K. (1992). Dual Bar homeo box genes of
Drosophila required in two photoreceptor cells, R1 and R6, and primary pigment
cells for normal eye development. Genes Dev.
6, 50-60.
Jin, S., Kalkum, M., Overholtzer, M., Stoffel, A., Chait, B. T.
and Levine, A. J. (2003). CIAP1 and the serine protease HTRA2
are involved in a novel p53-dependent apoptosis pathway in mammals.
Genes Dev. 17,359
-367.
Kauffmann, R. C., Li, S., Gallagher, P. A., Zhang, J. and
Carthew, R. W. (1996). Ras1 signaling and transcriptional
competence in the R7 cell of Drosophila. Genes Dev.
10,2167
-2178.
Kramps, T., Peter, O., Brunner, E., Nellen, D., Froesch, B., Chatterjee, S., Murone, M., Zullig, S. and Basler, K. (2002). Wnt/wingless signaling requires BCL9/legless-mediated recruitment of pygopus to the nuclear beta-catenin-TCF complex. Cell 109, 47-60.[CrossRef][Medline]
Kubo, F., Takeichi, M. and Nakagawa, S. (2003).
Wnt2b controls retinal cell differentiation at the ciliary marginal zone.
Development 130,587
-598.
Kurada, P. and White, K. (1998). Ras promotes cell survival in Drosophila by downregulating hid expression. Cell 95,319 -329.[CrossRef][Medline]
Marcus, D. M., Rustgi, A. K., Defoe, D., Kucherlapati, R., Edelmann, W., Hamasaki, D., Liou, G. I. and Smith, S. B. (2000). Ultrastructural and ERG findings in mice with adenomatous polyposis coli gene disruption. Mol. Vis. 6, 169-177.[Medline]
Martin, S. J. (2002). Destabilizing influences in apoptosis: sowing the seeds of IAP destruction. Cell 109,793 -796.[CrossRef][Medline]
Meinertzhagen, I. A. and Hanson, T. E. (1993). The development of the optic lobe. In The Development of Drosophila melanogaster. Vol. 2 (ed. A. Bate M. and A. Martinez Arias), pp. 1363-1491. New York: Cold Spring Harbor Laboratory Press.
Miller, D. T. and Cagan, R. L. (1998). Local induction of patterning and programmed cell death in the developing Drosophila retina. Development 125,2327 -2335.[Abstract]
Newsome, T. P., Schmidt, S., Dietzl, G., Keleman, K., Asling, B., Debant, A. and Dickson, B. J. (2000). Trio combines with dock to regulate Pak activity during photoreceptor axon pathfinding in Drosophila. Cell 101,283 -294.[CrossRef][Medline]
Oppenheim, R. W. (1991). Cell death during development of the nervous system. Annu. Rev. Neurosci. 14,453 -501.[CrossRef][Medline]
Parker, D. S., Jemison, J. and Cadigan, K. M.
(2002). Pygopus, a nuclear PHD-finger protein required for
Wingless signaling in Drosophila. Development
129,2565
-2576.
Peifer, M., Sweeton, D., Casey, M. and Wieschaus, E. (1994). wingless signal and Zeste-white 3 kinase trigger opposing changes in the intracellular distribution of Armadillo. Development 120,369 -380.[Abstract]
Peterson, C., Carney, G. E., Taylor, B. J. and White, K. (2002). reaper is required for neuroblast apoptosis during Drosophila development. Development 129,1467 -1476.
Pichaud, F., Treisman, J. and Desplan, C. (2001). Reinventing a common strategy for patterning the eye. Cell 105,9 -12.[CrossRef][Medline]
Polakis, P. (2000). Wnt signaling and cancer.
Genes Dev. 14,1837
-1851.
Reh, T. A. and Levine, E. M. (1998). Multipotential stem cells and progenitors in the vertebrate retina. J. Neurobiol. 36,206 -220.[CrossRef][Medline]
Shi, Y. (2002). Mechanisms of caspase activation and inhibition during apoptosis. Mol. Cell 9, 459-470.[CrossRef][Medline]
Srinivasula, S. M., Datta, P., Kobayashi, M., Wu, J. W., Fujioka, M., Hegde, R., Zhang, Z., Mukattash, R., Fernandes-Alnemri, T., Shi, Y. et al. (2002). sickle, a novel Drosophila death gene in the reaper/hid/grim region, encodes an IAP-inhibitory protein. Curr. Biol. 12,125 -130.[CrossRef][Medline]
Suzuki, Y., Imai, Y., Nakayama, H., Takahashi, K., Takio, K. and Takahashi, R. (2001). A serine protease, HtrA2, is released from the mitochondria and interacts with XIAP, inducing cell death. Mol. Cell 8,613 -621.[CrossRef][Medline]
Thompson, B., Townsley, F., Rosin-Arbesfeld, R., Musisi, H. and Bienz, M. (2002). A new nuclear component of the Wnt signalling pathway. Nat. Cell Biol. 4, 367-373.[CrossRef][Medline]
Tomlinson, A. (2003). Patterning the peripheral retina of the fly: decoding a gradient. Dev. Cell 5, 665-666.[CrossRef][Medline]
Traboulsi, E. I., Murphy, S. F., de la Cruz, Z. C., Maumenee, I. H. and Green, W. R. (1990). A clinicopathologic study of the eyes in familial adenomatous polyposis with extracolonic manifestations (Gardner's syndrome). Am. J. Ophthalmol. 110,550 -561.[Medline]
van Leeuwen, F., Samos, C. H. and Nusse, R. (1994). Biological activity of soluble wingless protein in cultured Drosophila imaginal disc cells. Nature 368,342 -344.[CrossRef][Medline]
Verhagen, A. M., Ekert, P. G., Pakusch, M., Silke, J., Connolly, L. M., Reid, G. E., Moritz, R. L., Simpson, R. J. and Vaux, D. L. (2000). Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102,43 -53.[CrossRef][Medline]
Wang, S. L., Hawkins, C. J., Yoo, S. J., Muller, H. A. and Hay, B. A. (1999). The Drosophila caspase inhibitor DIAP1 is essential for cell survival and is negatively regulated by HID. Cell 98,453 -463.[CrossRef][Medline]
Wernet, M. F., Labhart, T., Baumann, F., Mazzoni, E. O., Pichaud, F. and Desplan, C. (2003). Homothorax switches function of Drosophila photoreceptors from color to polarized light sensors. Cell 115,267 -279.[CrossRef][Medline]
White, K., Grether, M. E., Abrams, J. M., Young, L., Farrell, K.
and Steller, H. (1994). Genetic control of programmed cell
death in Drosophila. Science
264,677
-683.
Wing, J. P., Karres, J. S., Ogdahl, J. L., Zhou, L., Schwartz, L. M. and Nambu, J. R. (2002). Drosophila sickle is a novel grim-reaper cell death activator. Curr. Biol. 12,131 -135.[CrossRef][Medline]
Wolff, T. and Ready, D. F. (1991). Cell death in normal and rough eye mutants of Drosophila. Development 113,825 -839.[Abstract]
Wolff, T. and Ready, D. F. (1993). Pattern Formation in the Drosophila Retina. In The Development of Drosophila melanogaster. Vol. 2 (ed. A. Bate and A. Martinez Arias), pp. 1277-1326. New York: Cold Spring Harbor Laboratory Press.
Yu, S. Y., Yoo, S. J., Yang, L., Zapata, C., Srinivasan, A.,
Hay, B. A. and Baker, N. E. (2002). A pathway of signals
regulating effector and initiator caspases in the developing Drosophila eye.
Development 129,3269
-3278.
Zuzarte-Luis, V. and Hurle, J. M. (2002). Programmed cell death in the developing limb. Int. J. Dev. Biol. 46,871 -876.[Medline]
This article has been cited by other articles:
![]() |
H. Benchabane, E. G. Hughes, C. M. Takacs, J. R. Baird, and Y. Ahmed Adenomatous polyposis coli is present near the minimal level required for accurate graded responses to the Wingless |