|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 May 2004
doi: 10.1242/dev.01123
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Cell and Developmental Biology, University of Pennsylvania
School of Medicine, Philadelphia, PA 19104-6058, USA
2 Department of Neurobiology and Behavior, State University of New York at Stony
Brook, Stony Brook, New York, NY 11794, USA
* Author for correspondence (e-mail: granatom{at}mail.med.upenn.edu)
Accepted 11 February 2004
| SUMMARY |
|---|
|
|
|---|
-subunit, CHRNA1.
Moreover, electrophysiological analysis demonstrates that the mutant subunit
increases synaptic decay times, thereby prolonging postsynaptic activity. We
show that as the first en passant synaptic contacts form, excessive
postsynaptic activity in homozygous embryos severely impedes pre- and
postsynaptic development, leading to degenerative defects characteristic of
the human slow-channel congenital myasthenic syndrome. By contrast, in
heterozygous embryos, transient and mild increase in postsynaptic activity
does not overtly affect postsynaptic morphology but causes transient axonal
defects, suggesting bi-directional communication between motor axons and
myotomal muscle. Together, our results provide compelling evidence that during
pathfinding, myotomal muscle cells communicate extensively with extending
motor axons through en passant synaptic contacts.
Key words: Zebrafish, nic1, Motor axon, En passant terminals, Synaptogenesis, Acetylcholine receptor
-subunit, chrna1, Slow-channel congenital myasthenic syndrome, twister
| Introduction |
|---|
|
|
|---|
Intriguingly, the first synaptic contacts between muscle and nerve form
before growth cones reach their final synaptic targets. In contrast to
well-characterized terminal synapses, in which the growth cone has stopped
advancing and has transformed into a typical presynaptic terminus, en passant
synaptic contacts form while the growth cone is still advancing towards its
muscle target. In the central nervous system (CNS), en passant synaptic
contacts, there known as en passant synapses, have been well described and are
characterized by varicosities along the length of the axonal shaft
(Claiborne et al., 1986
;
Hatada et al., 1999
;
Mason and Gregory, 1984
). En
passant synaptic contacts along the path of motor axons have also been
reported in mammalian and teleost embryos
(Sheard and Duxson, 1997
;
Westerfield et al., 1990
). In
embryonic rat intercostals muscle, en passant contacts, reminiscent of
immature synapses, form transiently at non-terminal regions of the axon
(Sheard and Duxson, 1997
). To
avoid confusion with en passant synapses typical of the CNS, we refer to early
synaptic contacts emerging along the motoaxonal shaft, while the growth cone
still advances, as en passant synaptic contacts. In the zebrafish embryo,
acetylcholine receptors (AChR) cluster along the length of primary motor axons
as growth cones pioneer a path on the medial surface of the myotome
(Westerfield et al., 1990
).
Shortly after the appearance of clustered AChRs, muscle fibers start
contracting coordinately, suggesting that these AChR clusters represent
functional synapses (Liu and Westerfield,
1992
; Melançon et al.,
1997
). Moreover, several studies have shown that spontaneous
release of acetylcholine from growth cones induces a post-synaptic response
within minutes after initial contact with muscle cells
(Chow and Poo, 1985
;
Hume et al., 1983
;
Xie and Poo, 1986
). Thus, en
passant synaptic contacts probably represent active neuromuscular connections.
Their function, however, has so far been unclear.
Blocking neuromuscular transmission does not overtly affect axonal
pathfinding or target selection (Broadie
and Bate, 1993a
; Westerfield
et al., 1990
), but causes axonal defasciculation and nerve
branching, and also interferes with the normal cessation of axon growth
(Dahm and Landmesser, 1988
).
Thus, neuromuscular transmission plays a role in modulating axonal behaviors,
such as fasciculation and extension. One attractive idea is that during the
process of pathfinding, en passant synaptic contacts enable
activity-dependent, bi-directional communication between axons and muscle,
thereby coordinating pre- and post-synaptic development. Although such
activity-dependent retrograde and anterograde signaling is thought to be
important for coordinating pre- and post-synaptic development, little is known
about this process in vivo (Davis and
Goodman, 1998
; Fitzsimonds and
Poo, 1998
; Tao and Poo,
2001
; Zhao and Nonet,
2000
).
Here, we examine the effects of increased neuromuscular activity on pre-
and postsynaptic development. We show that in twister mutant embryos,
neuromuscular transmission is prolonged because of a gain-of-function mutation
in the
-subunit of the muscle-specific AChR (CHRNA1). Analysis of
twister mutant embryos reveals that the first defects become apparent
during pathfinding, when the first en passant contacts between extending motor
axons and the myotome form. In homozygous mutants, the high levels of synaptic
activity cause excitotoxity, leading to progressive disruption of pre- and
postsynaptic development. In heterozygous twister mutants, moderate
increase in neuromuscular transmission does not overtly affect muscle fiber
integrity or the formation of en passant synaptic contacts, but causes altered
growth cone morphology and axonal extension, consistent with the idea that
signals at en passant synaptic contacts modulate pre-synaptic development.
Whereas the evidence for activity-dependent retrograde signals have been
proposed in several systems in which neuromuscular activity is reduced
(Nick and Ribera, 2000
;
Zhao and Nonet, 2000
), our
results provide a clear example that increased neuromuscular transmission
affects pre- and postsynaptic development in vivo.
| Materials and methods |
|---|
|
|
|---|
Antibody staining and
-bungarotoxin (
-BTX) labeling
Embryos at 17-30 hpf were anesthetized (0.01% Tricaine), fixed in 4%
paraformaldehyde with 1% DMSO for three hours at room temperature or overnight
at 4°C, and then washed several times in 0.1 M phosphate buffer pH 7.4
(PBS). The following primary antibodies and dilutions were used: znp-1 (1:200,
Antibody Facility, University of Oregon)
(Trevarrow et al., 1990
);
anti-slow-twitch myosin F59 (1:10, kindly provided by F. Stockdale)
(Crow and Stockdale, 1986
;
Devoto et al., 1996
);
anti-fast-twitch myosin F310 (1:200, generously provided by N. Rubinstein)
(Crow and Stockdale, 1986
);
and SV2 (1:50, Developmental Studies Hybridoma Bank, University of Iowa, USA).
For znp-1 stainings detected colorimetrically with DAB (Vector Laboratories,
Burlingame, CA, USA), antibody stainings were performed as described by Zeller
and Granato (Zeller and Granato,
1999
). For labeling of myosins, fixed embryos were dehydrated
through a methanol series and stored in 100% methanol at 20°C,
until permeabilized with acetone for 10 (F59) or 45 (F310) minutes at
20°C. Embryos were washed thoroughly with incubation buffer (0.2%
BSA, 0.5% Triton-X in 0.1 M PBS, pH 7.4), and incubated with diluted primary
antibody overnight at 4°C. Stainings were detected by using AlexaFluor 488
or AlexaFluor 594 conjugated anti-mouse secondary antibodies diluted in
incubation buffer (1:500; Molecular Probes, Eugene, OR, USA).
For double labeling of neuromuscular junctions, fixed embryos were digested
with 0.1% collagenase (Sigma, St Louis, MO, USA) in PBS for 7-30 minutes at
room temperature, and then washed several times with PBS. To label AChR
clusters, embryos were incubated for 30 minutes at room temperature in
AlexaFluor 594 conjugated
-BTX (10 µg/mL, Molecular Probes) diluted
in incubation buffer with 1% normal goat serum. Axons were labeled with a 1:1
mixture of znp-1 and SV2 antibodies overnight at 4°C, followed by
incubation with secondary AlexaFluor 488-conjugated anti-mouse antibody.
Fluorescent embryos were immersed and mounted in Vectashield mounting medium
(Vector Laboratories). Embryos were viewed using Nomarski optics or
epifluorescence on a Zeiss Axioplan microscope (Zeiss, Thornwood, NY, USA) or
Leica MZFLIII stereomicroscope (Bannockburn, IL, USA). Images of
non-fluorescent stainings were captured with a Progress 3012 digital camera
(Kontron Elektronics). Fluorescent stainings were imaged using a LSM510
confocal microscope (Zeiss).
Pharmacological treatments
-Bungarotoxin (2.5 mM stock in 0.1 M phosphate buffer, pH 7.4;
Sigma) was diluted to 0.25 mM in injection buffer (0.1 M KCl: phenol red, 3:1)
and injected directly into the yolk of live 12-14 hpf embryos.
-BTX-treated embryos were collected for further analyses if greater
than 70% of injected embryos remained paralyzed through 26 hpf. Embryos were
collected at 26-30 hpf, scored for trunk morphology, and then fixed and
stained with znp-1 and F59 for analyses of axonal and muscle morphology.
Injected embryos were scored as wild-type/heterozygous or as homozygous
phenotype according to the axonal and muscle morphology.
Genetic mapping and linkage analysis
A three-generation mapping cross between a Tübingen (Tü) strain
carrying the nic1twister dbn12 mutation and the
polymorphic WIK strain was established. Mapping procedure and the WIK line
were described previously (Knapik et al.,
1996
; Rauch et al.,
1997
). F2 nic1twister dbn12
embryos, heterozygous and wild-type siblings were collected separately and
stored at 20°C. For bulk segregation analysis, pools of 25 embryos
were used. Embryonic DNA extraction was performed as described in Gates et al.
(Gates et al., 1999
), and
amplified using SSLP markers z17212, z6601 and z9738 (Research Genetics,
Huntsville, AL, USA) with the following PCR conditions: 94°C for 2
minutes, then 35 cycles of 92°C for 1 minute; 55°C, 1 minute;
72°C, 1 minute, followed by 75°C, 5 minutes.
To genotype individual F2 mutant and wild-type embryos, we used the dCAPS
method to generate polymorphic markers
(Neff et al., 1998
). The
chrna1 3'UTR was amplified by PCR with primers
nic13UTR-F: CCAAAATCCCCAACCAAG and nic1BseRI-R:
GCACACGCCGTACTGGCATAAAGA with the following PCR conditions: 94°C for 2
minutes, then 30 cycles: 92°C, 30 seconds; 64°C, 1 minute; 73°C, 1
minute, followed by 75°C, 5 minutes. The PCR product was digested with
BseRI and separated on 2% Agarose: 2% MetaPhor agarose gel (Cambrex,
Rockland, ME, USA).
Cloning of chrna1 cDNA and sequence analysis
Total RNA from wild-type homozygous mutant embryos was extracted with
TRIzol Reagent (Life Technologies, Carlsbad, CA, USA), and used as a template
for first-strand cDNA using the Superscript Preamplification System (Life
Technologies). The chrna1 cDNA sequence of wild-type and mutant
embryos was determined by amplifying two overlapping fragments with the
following primers: chrna1-#1-F: CGTTCAGTCAGCTATAAGGAC with
chrna1-#1-R: GCATGTATTTGCCGATGAGTG; chrna1-#2-F:
CTGCATGCTGTTCTCCTTCC with chrna1-#2-R: GGCTTGGTTGGGGATTTTGG. The
following PCR conditions were used: 94°C for 2 minutes, then 35 cycles:
92°C, 1 minute; 58°C, 1 minute; 73°C, 1.5 minutes, followed by
75°C, 5 minutes. PCR products were subcloned into the pGEM-T Easy Vector
System (Promega, Madison, WI, USA). Two to three independent clones from two
independent PCR reactions were sequenced (Napcore, Children's Hospital of
Philadelphia, PA, USA). Sequence was analyzed using MacVector and Blast 2
software from the National Center for Biotechnological Information
(www.ncbi.nlm.nih.gov/blast/bl2seq).
Mutant embryos were genotyped by amplifying a portion of the chrna1
M2 domain with primers chrna1-#3-F: GAGAAGATGACCCTCAGCAT and
chrna1-#3-R: TCACAGTGATTATGATGG, and digested with restriction enzyme
MspI (New England Biolabs, Beverly, MA, USA).
In vivo recordings of synaptic currents
Whole cell recordings of synaptic currents were performed on muscle of 72
hpf wild-type and twister heterozygote fish as previously described
(Ono et al., 2002
).
Spontaneous miniature end-plate currents (mEPCs) and stimulus evoked end-plate
currents (EPCs) were recorded at holding potentials of 90 mV and
50 mV, respectively. The mEPCs were filtered at 2 kHz to reduce the
noise, and data was sampled at 50 kHz. The EPCs were evoked by extracellular
stimulation of the spinal cord using 20-30 V pulses of 300 µsec duration.
In a separate set of experiments, we synthesized mRNA from clones containing
the wild-type alpha or nic-1twister dbn12 alpha subunit in
pCS2+. mRNA (2 ng) was injected into single-cell nic1b107
embryos, and injected embryos were screened between 48-hpf to 72-hpf embryos
to identify nic1b107 embryos lacking response to touch.
These homozygous larvae were then subjected to whole-cell patch clamp
recordings. Synaptic events were analyzed and fitted using the minianalysis
software (Synaptosoft).
Electron microscopy
Embryos at 26 hpf were fixed in 6% glutaraldehyde in either 0.1 M
cacodylate or phosphate buffer pH 7.2-7.4 for at least 1 hour at room
temperature, and used immediately or stored for up to several days at 4°C
in the fixative. Head, yolk sac, yolk extension and most of the tail fin were
removed within the first minutes of fixation to allow better penetration of
the fixative. Tails were post-fixed in 2% OsO4 in the same buffer,
en-bloc stained with saturated aqueous uranyl acetate overnight, and embedded
in Epon 812. To better preserve glycogen, some were post-fixed in 2% OsO4,
0.8% K3Fe(CN)6 in 0.1 M cacodylate buffer. Thin sections
were stained in 4% uranyl acetate in 50% ethanol and with a solution of lead
salts (Sato, 1968
). Sections
were examined using a Phillips 410 electron microscope.
| Results |
|---|
|
|
|---|
To determine whether the twister gene plays a similar role in
axonal pathfinding, we examined the axonal trajectories of primary motor
neurons. In 26 hpf wild-type embryos, the znp-1 antibody labels the common
axonal path of the primary motor neurons CaP, MiP and RoP, from the spinal
cord to the choice point, as well as the cell-type-specific projections of CaP
and MiP axons into ventral and dorsal somites, respectively;
(Fig. 1A,B)
(Eisen et al., 1986
;
Myers et al., 1986
). In
heterozygous twister embryos, motor axonal trajectories were only
mildly affected. In 25% of the heterozygous mutant hemisegments, motor axons
sprouted short, ectopic branches at the region of the choice point and along
the path through the ventral myotome (n=340;
Fig. 1C). Similar ectopic
branches were also present in homozygous twister embryos, although
these branches were longer and occurred at a much higher frequency (55%;
n=340; Fig. 1D).
Moreover, motor axons crossed into neighboring somites (4%), or completely
failed to extend into the ventral somite (11%;
Fig. 1D). Thus, mutations in
the twister gene give rise to aberrant motor axon trajectories,
suggesting an important role for the twister gene in motor neuron
development.
|
In 26 hpf wild-type embryos, slow muscle fibers form a monolayer on the
lateral surface of the myotome, whereas fast muscle constitutes a deeper mass
of multinucleated fibers oriented obliquely within the segment
(Devoto et al., 1996
)
(Fig. 2A,B). In heterozygous
twister mutants, slow and fast myofiber populations were only mildly
affected. Although slow and fast muscle fibers exhibited striations
indistinguishable from wild-type, we noticed that occasionally individual
fibers were thinner and varied slightly in length, distorting somite
boundaries (Fig. 2C,D).
Furthermore, some fibers were spaced irregularly, resulting in gaps between
fibers (Fig. 2C,D). In contrast
to these subtle defects, myofiber structure and organization in
twister homozygous embryos was severely affected. Fast and slow
fibers were considerably thinner and their sarcomeric organization was
strongly reduced or even absent (Fig.
2E,F). Individual myofibers appeared splayed apart and some were
detached from their substrate at the somite boundary
(Fig. 2E).
|
|
twister-related phenotypes are dependent on neuromuscular activity
Given that twister mutants display defects in muscle and
motoneuron development, we sought to determine the mechanism by which the
twister gene controls both of these processes. One possibility is
that the muscle phenotype is a consequence secondary to the axonal defect, and
that the twister gene controls one defined aspect of axonal
pathfinding, a process independent of neuromuscular activity
(Westerfield et al., 1990
).
Alternatively, the pre- and post-synaptic defects are both secondary and the
twister gene acts at the site where the muscle and nerve interact, at
the neuromuscular junction. For example, the twister gene may control
neuromuscular transmission and the twister-related phenotypes could
result from unregulated neuromuscular activity. To distinguish between these
two possibilities, we blocked neuromuscular transmission in embryos by
application of
-BTX, an inhibitor of AChR function
(Berg et al., 1972
;
Pittman and Oppenheim, 1978
).
The expectation is that blocking neuromuscular activity would not affect
activity-independent defects, such as lack of muscle differentiation or
neuronal pathfinding, but would rescue activity-dependent defects caused by
increased neuromuscular transmission.
We injected
-BTX into the yolk of
13-14-hpf embryos, prior to
the formation of neuromuscular junctions and consequently the acquisition of
spontaneous movements (Liu and
Westerfield, 1992
; Saint-Amant
and Drapeau, 1998
). Nearly all injected embryos survived
(>95%), and over 70% of injected embryos remained paralyzed until they were
collected for analysis at 26 hpf. In control experiments, 25% of
buffer-injected embryos derived from a heterozygous intercross displayed
severe axonal and myofiber defects, identical to those observed in
twister homozygous mutants (Fig.
4A). Approximately 50% of buffer-injected embryos displayed axonal
and muscle defects characteristic for heterozygous embryos, and the remaining
25% embryos appeared wild-type. In contrast, when injected with
-BTX,
the percentage of embryos with wild-type and heterozygous phenotypes increased
from 75% in the control to 88.1% (Fig.
4A). Concomitant with the increase of embryos with wild-type
phenotypes,
-BTX treatment significantly reduced the proportion of
embryos with severe muscle and axonal defects from 25% (in controls) to 11.9%
(Fig. 4A). Moreover, genotyping
of individual embryos confirmed that
-BTX treatment of homozygous
twister embryos rescued axonal and muscle morphology (data not
shown). Thus, blockade of neuromuscular activity restores axonal and muscle
morphology in twister embryos, suggesting a role for the
twister gene in regulating activity-dependent processes at the
neuromuscular junction.
|
To determine whether twister mutations also prolong AChR openings in response to CNS stimulation, we recorded synaptic currents (EPCs) evoked by repeated stimulation of motor neurons. In wild-type larvae, a 50-Hz train of electric stimulation resulted in fast-activating synaptic currents that completely decayed between successive stimuli (Fig. 4F). Similarly, stimulation of heterozygous twister larvae evoked fast-activating synaptic currents. However, in heterozygous twister mutants EPCs failed to decay fully between successive stimuli, causing a summation of individual end-plate currents. (Fig. 4G). Thus, mutations in the twister gene do not overtly affect the rise times of spontaneous and evoked end-plate currents, but do extend their decay rates. We conclude that in twister mutants, synaptic activity is prolonged and that the twister gene is a central component of the machinery regulating neuromuscular activity.
The twister phenotype is caused by a gain-of-function mutation in the muscle acetylcholine receptor
-subunit (chrna1)
To identify the molecular nature of the twister gene, we combined
molecular genetic mapping with a candidate gene approach. We first mapped the
mutation to a small genetic interval, and then examined the corresponding
region on a radiation hybrid map for possible candidate genes. To map the
twister locus, we used bulk-segregation analysis of approximately 100
simple sequence length polymorphic (SSLP) markers distributed evenly
throughout the genome (Knapik et al.,
1998
). We found that the twister mutant phenotype
co-segregated with SSLP marker z6601 on linkage group 6
(Fig. 5A). Fine-resolution
mapping of more than 700 individual F2 mutant embryos positioned
the twister locus 0.77 cM centromeric to z6601
(Fig. 5B,C).
|
-subunit of the muscle nicotinic
acetylcholine receptor (nic-1/chrna1)
(Fig. 5C)
(Sepich et al., 1998
-subunit is a component of the pentameric AChR
(
2ß
), a ligand-gated ion channel
clustered at the neuromuscular junction to transmit the neural signal to the
muscle. The
-subunit is expressed exclusively in muscle, and there
functions cell autonomously (Sepich et
al., 1994To determine whether mutations in chrna1 cause the twister phenotype, we isolated cDNAs encoding the chrna1 gene from twister mutant embryos. Sequence analysis revealed that the twister cDNA coding for chrna1 has a T-to-C nucleotide transversion at the second base of codon 258, giving rise to a leucine (CTG) to proline (CCG) amino acid substitution (L258P) (Fig. 5D). Leucine 258 is located in the second transmembrane domain (M2), which is 100% conserved across all species examined (Fig. 5E,F). Moreover, sequence analysis revealed that the ENU-treated founder fish, which gave rise to the twisterdbn12 allele, contains the wild-type sequence CTG at codon 258 (data not shown). This demonstrates that the C-to-T nucleotide substitution is not a polymorphism but a mutation presumably caused by the ENU treatment.
Mutations in the zebrafish chrna1 gene have previously been
isolated (Sepich et al.,
1998
). The nic-1b107 mutation is a
-ray-induced allele that segregates in a recessive manner
(Westerfield et al., 1990
).
The nic-1b107 mutation prevents correct splicing of the
pre-mRNA, thus completely blocking protein synthesis of the
-subunit
and assembly of functional AChRs (Sepich
et al., 1998
). Consequently, no phenotypes are observed in
heterozygous nic-1b107 embryos, whereas homozygous embryos
are paralyzed but do not display any obvious defects in motor axon or muscle
fiber morphology (Westerfield et al.,
1990
). To further confirm that twister is a mutation in
the nic-1/chrna1 gene, we performed complementation analysis between
twister and nic-1b107 mutants. As shown above,
heterozygous embryos carrying one copy of the twisterdbn12
allele only display mild muscle and motoneuronal phenotypes, whereas
homozygous embryos carrying two copies of the twisterdbn12
allele exhibit strong muscle and motoneuronal phenotypes (Figs
1,
2). In approximately 20% of the
embryos derived from crosses between twisterdbn12 and
nic-1b107 heterozygous adults, we observed pathfinding and
muscle defects typically observed in homozygous mutant twister
embryos (data not shown). Such non-complementation result is expected if the
twister dbn12 and nic-1b107 mutations
affect one and the same gene. Moreover, the phenotype of
twisterdbn12/nic-1b107 embryos
carrying one gain-of-function and one loss-of function allele is identical to
embryos carrying two gain-of-function alleles. This, together with the
synaptic recordings from heterozygous twisterdbn12 embryos
strongly indicates that twisterbn12 acts as a gain-of
function allele of the nic-1/chrna1 gene. From this point on, we will
refer to the twister mutation as nic-1twister
dbn12.
To demonstrate that the L258P mutation in the chrna1 gene causes
the slowed synaptic decay, we expressed the wild-type and the L258P mutation
in embryos lacking the chrna1 gene (nic-1b107).
Recording from uninjected nic-1b107 homozygous larvae
confirmed the complete absence of mEPCs, and thus the lack of AChRs
(Westerfield et al., 1990
). We
compared mEPCs recorded between 48 and 72 hpf from
nic-1b107 homozygous larvae expressing the wild-type or
L258P mutant
-subunit. The mEPCs recorded from larvae expressing the
mutant
-subunit rose and decayed slower than those expressing the
wild-type
-subunit (Fig.
5G). Unlike heterozygous nic-1twister dbn12,
which express both the mutant and the wild-type
1-subunit and decay
with multiple exponential components, mEPCs recorded from larvae expressing
only the mutant
-subunit decayed with a single exponential time course.
By fitting mEPCs with single exponential functions, we found that synaptic
decay times produced by the mutant channels were significantly longer. The
average decay times for nic-1b107 larvae expressing the
mutant
-subunit ranged from 10.9 mseconds to 45.9 mseconds with an
overall mean of 24.3 mseconds (Fig.
5H). In contrast, the average decay times for
nic-1b107 larvae expressing the wild-type receptor ranged
from 1.4 mseconds to 10.9 mseconds with an overall mean of 6.2 mseconds
(Fig. 5H). In addition, we
determined that the L258P mutation prolongs the rate of channel opening, as
determined by measuring the 10 to 90% rise times (2.9 mseconds for the mutant
compared with 1.9 mseconds for wild-type, data not shown). Thus,
molecular-genetic mapping, sequencing and recordings from larvae expressing
the mutant
-subunit demonstrate that the L258P mutation in the
chrna1 gene gives rise to prolonged neuromuscular activity, resulting
in the dominantly transmitted pre- and postsynaptic defects observed in
twister embryos.
Excessive neuromuscular activity disrupts early aspects pre- and post-synaptic development
By 26 hpf, slow and fast muscle fibers have differentiated and primary
motor neurons have already extended their projections far into the periphery,
thereby constituting a simple motor system mediating touch-inducible reflex
behaviors. At this stage, homozygous nic-1twister dbn12
mutant embryos display severe pre- and postsynaptic defects (Figs
1,2,3).
However, wild-type zebrafish embryos display spontaneous movements as early as
16 hpf, when muscle cells are still maturing and primary motor axons are
migrating into the somites (Liu and
Westerfield, 1992
; Myers et
al., 1986
). This suggests that as early as 16 hpf, functional
neuromuscular connections are present. To determine whether excess
neuromuscular activity impairs these early steps of neuromuscular development,
we examined motor axon pathfinding, formation of clustered AChRs and muscle
differentiation at 17hpf, when motor axons pioneer into the periphery and
establish the first neuromuscular synapses.
At 17 hpf, wild-type muscle fibers expressed cell-type-specific myosins,
but fibers were thin and only some exhibited their characteristic
cross-striations (Fig. 6A, fast
muscle data not shown). Although their muscle fibers are not yet fully
differentiated, 17 hpf wild-type embryos display well-characterized
spontaneous movements (Saint-Amant and
Drapeau, 1998
). At this stage, muscle fibers in heterozygous
nic-1twister dbn12 embryos appeared
indistinguishable from those in wild-types
(Fig. 6B). In contrast,
homozygous nic-1twister dbn12 mutant embryos did not move
spontaneously but appeared in a state of muscle hypercontraction. In these
embryos, the somites were markedly compressed along the anterior-posterior
axis and expanded along the dorso-ventral axis
(Fig. 6C). Although expression
levels and cellular localization of slow muscle myosin was comparable to
wild-type embryos, fibers were shorter and less fasciculated. Over the next 4
hours, homozygous mutant muscle fibers became progressively splayed and
detached from the somite boundary, similar to what we had observed at later
stages (26 hpf, Fig. 3). Thus,
excess postsynaptic activity in twister homozygous mutants interferes
with muscle fiber maturation already at a stage when the first neuromuscular
synapses form.
|
In 25% of heterozygous nic-1twister dbn12
mutant hemisegments, we observed that motor axons failed to extend as far as
wild-type axons, possibly because of stalling and/or retraction
(n=32; Fig. 6G).
Interestingly, in such affected hemisegments, AChR clusters were present
extra-synaptically, as we observed
-BTX-positive clusters distal to the
presumptive growth cone (Fig.
6H,I). This is significant because in wild-type embryos, clustered
AChRs were always apposed to motor axons and behind the presumptive growth
cone (Fig. 6D-F). Moreover,
these nerve-free AChR clusters were indistinguishable from those in wild-type
embryos. By 21 hpf, axonal extension defects were only detectable in 7% of
heterozygous nic-1twister dbn12 hemisegments, and by 26
hpf, axonal stalling had given way to excessive axonal branches decorated by
ectopic AChR clusters (Fig. 6N
and data not shown). Thus, moderately increased neuromuscular transmission
present in heterozygous mutants appears to influence motor axons in two
different ways. Initially, increased activity transiently delays axonal
growth, but then promotes aberrant axonal branching and formation of ectopic
neuromuscular connections.
Similar to pioneering motor axons of heterozygous mutants, homozygous nic-1twister dbn12 growth cones displayed axonal stalling/retraction. However, these pre-synaptic defects were more severe, more persistent, and always associated with the failure to form and/or maintain clusters of AChRs. At 17 hpf, within hours of the onset of primary motor axon extension, most homozygous mutant growth cones stalled at the spinal cord exit point or at the choice point (Fig. 6J). Rather than displaying their typical fan-shaped morphology, presumptive growth cones appeared collapsed (double arrowhead in Fig. 6J). Only few and small AChR clusters were detectable, many of which were not associated with motor axons but were instead dispersed throughout the myotome (Fig. 6K,L). By 26 hpf, most homozygous mutant motor axons had projected further, although often along aberrant paths (Fig. 6O). Mutant motor axons formed long ectopic branches, along which AChR clusters occasionally co-localized (Fig. 6O, see also Fig. 1D). Thus, analyses of heterozygous and homozygous mutants show that increased neuromuscular transmission results in two temporally distinct effects on pathfinding motor axons. Increased activity first transiently delays axonal growth, but then promotes aberrant axonal branching. Both of these effects appear to be dose-dependent, as the severity of axonal stalling and branching increased with the number of hyperactive receptors present in the embryos. Interestingly, in heterozygous mutants presynaptic defects occurred in the absence of overt morphological postsynaptic defects. Together, these results suggest that during pathfinding, axons and muscle communicate extensively through en passant synaptic contacts and that postsynaptic activity can modulate presynaptic growth.
| Discussion |
|---|
|
|
|---|
The nic-1twister dbn12 L258P substitution in
the AChR
-subunit alters neurotransmission at neuromuscular junctions.
The embryonic muscle AChR channel is a pentameric membrane protein
(
2ß
). Each subunit contains four
membrane-spanning segments (M1-M4), of which the M2 segments together form
five rods that twist upon activation to allow flow of cations
(Miyazawa et al., 1999
;
Unwin, 1995
). Labeling and
mutagenesis studies have shown that amino acid residues of the M2 domains line
the channel lumen and contribute to the channel's gate and ion selectivity
filter (Akabas et al., 1994
;
Karlin, 2002
;
Leonard et al., 1988
;
Wilson and Karlin, 1998
).
Indeed, our recordings demonstrate that the L258P mutation in the M2 domain
prolongs channel openings, thereby resulting in increased end-plate currents.
Such prolonged end-plate currents are characteristic of an inherited human
condition, slow-channel congenital myasthenic syndrome (SCCMS)
(Engel et al., 2003
). Fifteen
slow-channel mutations have been reported, all of which are caused by
dominant, gain-of-function mutations in various AChR subunits
(Engel et al., 2003
).
In neuromuscular preparations from SCCMS patients, end-plate currents are 4
to 10-fold prolonged (Engel et al.,
2003
). Furthermore, several SCCMS mutations in the M2 segment have
been shown to result in the normal expression and assembly of AChRs, but
generate prolonged channel openings by stabilizing the open state and
decreasing the rate of channel closure
(Croxen et al., 1997
;
Engel et al., 1996
;
Milone et al., 1997
;
Ohno et al., 1995
). These
observations support our interpretation that the
nic-1twister dbn12 L258P substitution functions
as a gain-of-function kinetic mutation. However, to evaluate the full extent
of kinetic abnormalities of the nic-1twister dbn12
channel, including its ACh binding affinity, single channel recordings and
ligand binding measurements will be required. Consistent with studies on SCCMS
and AChR structure-function, our analyses of the nic-1twister
dbn12 mutant reveal a point mutation that alters the kinetic profile of
the AChR channel.
Analysis of nic-1twister dbn12 mutants reveals novel aspects of SCCMS-associated myopathy
The end-plate degeneration and myopathy observed in SCCMS is caused by
excitoxicity resulting from prolonged neuromuscular activity. Studies in the
adult rodent muscle have shown that chronic stimulation with AChR agonists or
acetylcholinesterase inhibitors induces muscle degeneration, including the
breakdown of sarcomeres and sarcoplasmic reticulum, the appearance of large
vacuoles, and cell death (Fenichel et al.,
1972
; Laskowski et al.,
1975
; Leonard and Salpeter,
1979
). These features are consistent with excitoxicity, in which
calcium overload induces proteolytic cleavage and degeneration of end-plate
and intracellular organelles, and in some cases, cell death
(Gomez et al., 2002
;
Leonard and Salpeter, 1979
;
Wood and Slater, 2001
).
Defects in homozygous nic-1twister dbn12 mutant embryos
parallel many of the symptoms characteristic of myasthenic syndrome. In SCCMS
patients and in transgenic mice overexpressing mutant AChR channels, prolonged
activation of the AChR channel results in increased Ca2+ influx and
accumulation at the end-plate, thereby inducing post-synaptic degeneration
(Engel et al., 1982
;
Engel et al., 2003
;
Gomez et al., 2002
). As most
of these studies have been performed on juvenile or adult tissue, in which
neuromuscular junctions are mature and myasthenic symptoms have already
developed, little is known about the effects of increased neuromuscular
activity during synaptogenesis. The accessibility and transparency of the
zebrafish embryo endowed us with the unique opportunity to examine the
consequences of elevated neuromuscular transmission as the first neuromuscular
synapses are forming.
At 17 hpf, wild-type motor axons pioneer into the periphery, and establish
the first synaptic contacts with muscle fibers
(Liu and Westerfield, 1992
).
At this stage, homozygous nic-1twister dbn12 embryos
display muscle fiber defects, axonal stalling and presumptive growth cone
collapse, as well as small and dispersed AChR clusters
(Fig. 6J-L). These defects
become more pronounced as development proceeds. By 26 hpf, homozygous
nic-1twister dbn12 mutant embryos have developed many
defects characteristic of progressive end-plate and muscle fiber myopathy
(Fig. 2E,F,
Fig. 3E,F, Fig. 6O). Destabilization of
synapses and degeneration of myofibers will probably cause the aberrant axonal
branching prominent in 26-hpf homozygous mutants
(Brown et al., 1981
;
Huang and Keynes, 1983
). Over
the next few days, almost the entire axial musculature degenerates, and by 6
dpf, mutant larvae die. Therefore, our analysis of homozygous mutants reveals
that kinetic mutations resulting in a mild dominant phenotype in heterozygous
mutants, can lead to massive and global degeneration of skeletal muscle in a
homozygous situation. Recently, mutations in the zebrafish
acetylcholinesterase gene (ache) have been reported
(Behra et al., 2002
;
Downes and Granato, 2004
). In
contrast to nic-1twister dbn12 mutant embryos,
ache-deficient embryos initially do not display presynaptic defects.
Our analysis of embryos lacking ache revealed a role for
acetylcholinesterase in maintaining integrity of the neuromuscular junction,
consistent with the notion that increased synaptic transmission exacerbates
pre- and postsynaptic defects over time
(Downes and Granato,
2004
).
In the zebrafish embryo (Liu and
Westerfield, 1992
), as in other systems
(Broadie and Bate, 1993b
;
Evers et al., 1989
;
Harris, 1981
), synaptic
transmission begins within minutes of contact between growth cones and muscle
targets. It is therefore possible that upon the formation of the very first
clustered AChRs, prolonged synaptic currents immediately produce deleterious
effects on postsynaptic structures. For example, prolonged AChR activity
through the first synapses might cause extensive muscle defects by propagating
neural excitation throughout the myotome via electrically coupled muscle
fibers (Nguyen et al., 1999
).
Alternatively, postsynaptic defects might occur even before the first growth
cones arrive, as the mutant AChR channel may open for extended periods in the
absence of ACh ligand. In fact, mutations in the M2 segment of the human
, ß and
subunits have been shown to cause unusually high
rates of spontaneous channel openings
(Engel et al., 1996
;
Milone et al., 1997
;
Ohno et al., 1995
). Although
we have not determined whether the
L258P mutation renders the AChR
channel leaky, the severe myofibril and AChR cluster defects observed in
17-hpf homozygous mutants, despite the presence of only few synaptic contacts,
are consistent with the possibility that nic-1twister
dbn12 channel opens extensively in a ligand-independent manner.
Regardless of the precise mechanism, our results demonstrate that the onset of
progressive end-plate and myopathy can occur during embryogenesis, much
earlier than previously reported in SCCMS patients or SCCMS mouse models
(Engel et al., 1982
;
Engel et al., 2003
;
Gomez et al., 1997
). Thus, as
growth cones make their first contacts with the muscle, increased channel
activity impacts ongoing pre- and post-synaptic development.
Unlike the characterized mutations giving rise to progressive symptoms in
heterozygous SCCMS patients, the
L258P substitution causes a dominant
phenotype only transiently in heterozygous nic-1twister
dbn12 mutants. Although heterozygous mutant AChR channels significantly
prolong synaptic decay, they do not elicit postsynaptic degeneration observed
in homozygous mutants and SCCMS patients. Instead, heterozygous embryos
transiently exhibit an `accordion' motility resulting from simultaneous
contraction of left and right axial muscles, a behavior presumably caused by
the prolonged activation of AChRs and summation of synaptic currents.
Interestingly, heterozygous mutants recover within 6 dpf and growth up to
viable adults. Although we have not examined end-plate structure and
physiology in these adults, they do not display any of the motor impairments
observed prior to 6 dpf. Therefore, heterozygous mutant AChRs cause mild but
transient pre- and post-synaptic defects. One possible explanation is that the
developmental switch from the fetal
- to the postnatal
-subunit
reconstitutes an AChR channel less sensitive to the
-L258P substitution
(Mishina et al., 1986
).
Alternatively, recovery might be because of other adaptive changes at the
neuromuscular junction. For example, adaptation could be achieved by adjusting
the levels of presynaptic transmitter release. Such homeostatic regulation of
synaptic efficacy has been proposed in the Drosophila and
Xenopus neuromuscular junction, as well as in human myasthenic muscle
(Cull-Candy et al., 1980
;
Nick and Ribera, 2000
;
Paradis et al., 2001
).
Neural activity modulates motor axon behaviors through en passant synaptic contacts
Neurotransmission has been shown to play an important role in synapse
maturation and refinement (Sanes and Lichtman, 1999b;
Zhang and Poo, 2001
). Loss of
postsynaptic activity causes presynaptic defects but does not affect the
ability of motor axons to grow towards their muscle targets
(Broadie and Bate, 1993a
;
Misgeld et al., 2002
;
Westerfield et al., 1990
).
Most studies, however, have focused on terminal synapses, at sites where
motile growth cones have transformed into non-motile synaptic termini.
Although loss-of-activity experiments show that in the absence of postsynaptic
activity axonal growth and presynaptic vesicle release occur correctly
(Li et al., 2003
;
Westerfield et al., 1990
),
these experiments do not address the possible effects elevated postsynaptic
activity might have on growth cone behaviors. Heterozygous
nic-1twister dbn12 embryos provide a unique system in
which to examine how increased levels of postsynaptic activity affect
extending growth cones.
During the migration of wild-type motor axons to their target areas,
clustered AChRs emerge along the length of the axon, proximal to the growth
cone (Liu and Westerfield,
1992
). Shortly after the first AChR clusters appear, muscle fibers
start contracting, suggesting that these AChR clusters represent functional
synapses on extending motor axons (Liu and
Westerfield, 1992
;
Melançon et al., 1997
).
This is reminiscent of en passant synapses, characteristic of synapses between
neurons (e.g. C. elegans, mammalian hippocampal neurons), but has
also been reported between embryonic rat motoneurons and skeletal muscle
(Dailey and Smith, 1993
;
Sheard and Duxson, 1997
;
White et al., 1983
). Soon
after the first en passant synaptic contacts form in heterozygous
nic-1twister dbn12 embryos, motor axons appear stalled
and/or retracted with a collapsed presumptive growth cone. In some cases, AChR
clusters were present past the distal tip of these collapsed growth cones, a
situation never observed in wild-type embryos
(Liu and Westerfield, 1992
).
These aneural clusters probably result from appropriate clustering of AChRs
below the growth cones, which subsequently retracted. Time-lapse analysis is
required to distinguish between axon stalling and retraction and to describe
in detail the effects of excess neuromuscular transmission on axon growth
dynamics. Nevertheless, these results make the suggestion that excessive
postsynaptic activity influences axonal growth by causing stalling and/or
retraction of presynaptic growth cones.
One possible explanation for the presynaptic defect is that increased postsynaptic activity damages muscle fibers such that motor axons fail to grow on their surface, a situation clearly illustrated in homozygous mutants. However, several lines of evidence suggest that heterozygous muscle fibers are not overtly compromised in their ability to serve as a substrate for motor axons. First, at 17 hpf, muscle fiber morphology and expression of cell-type-specific myosin are indistinguishable from wild-type. Second, AChR clusters appeared indistinguishable in surface localization, position and size from those in wild-type segments, suggesting that the muscle fibers are suitable substrates for synaptic formation and maintenance. Finally, motor axons eventually resume their migration, and by 26 hpf display excessive rather than reduced growth. Thus, in heterozygous embryos, increased postsynaptic activity affects axonal extension without obviously disrupting muscle fiber integrity.
We cannot completely exclude the possibility that presynaptic defects are a
consequence of subtle muscle cell damage or of impaired activity-independent
processes such as interactions between axons with postsynaptic filapodial
projections (Ritzenthaler et al.,
2000
; Uhm et al.,
2001
). Interestingly, dynamic behaviors of such myopodia have been
proposed to be regulated by neuromuscular transmission
(Misgeld et al., 2002
).
However, we favor a model that considers retrograde signaling from the muscle
to modulate axonal extension. Postsynaptic cells do not only receive
information, but they also provide retrograde signals to the presynaptic
neuron (reviewed by Fitzsimonds and Poo,
1998
; Tao and Poo,
2001
). Such reciprocal interaction is important for development
and maintenance of the presynaptic cell. Although the existence of
activity-dependent retrograde signals has been suggested from studies in which
neuromuscular activity was reduced (Loeb
et al., 2002
; Nick and Ribera,
2000
; Zhao and Nonet,
2000
), our studies provide compelling evidence that increased
post-synaptic activity influences presynaptic development in vivo. We propose
that wild-type muscle fibers produce retrograde signals triggered by synaptic
activity at en passant synaptic contacts, and that such signals modulate the
rate of axonal extension. Thus, the en passant configuration of the earliest
neuromuscular synapses may play a vital role in enabling the first reciprocal
interactions between pre- and postsynaptic cells.
| ACKNOWLEDGMENTS |
|---|
-BTX, and Rita
Balice-Gordon (University of Pennsylvania) for advice on staining embryos with
-BTX. We would like to thank Monte Westerfield (University of Oregon)
for sending the b107 strain, Robert Geisler (MPI Germany) for sending Go bn12
DNA, Frank Stockdale for providing us with F59 antibody and Neal Rubinstein
for the F310 antibody. Thanks to Matthew Dalva and members of the Granato lab
for critical comments on the manuscript. This work was supported by a Henry V.
Viets Fellowship from the Myasthenia Gravis Foundation to J.L.L. and grants
from the Muscular Dystrophy Association and the National Institutes of Health
to M.G. | REFERENCES |
|---|
|
|
|---|
Akabas, M. H., Kaufmann, C., Archdeacon, P. and Karlin, A. (1994). Identification of acetylcholine receptor channel-lining residues in the entire M2 segment of the alpha subunit. Neuron 13,919 -927.[CrossRef][Medline]
Behra, M., Cousin, X., Bertrand, C., Vonesch, J. L., Biellmann, D., Chatonnet, A. and Strahle, U. (2002). Acetylcholinesterase is required for neuronal and muscular development in the zebrafish embryo. Nat. Neurosci. 5, 111-118.[CrossRef][Medline]
Berg, D. K., Kelly, R. B., Sargent, P. B., Williamson, P. and
Hall, Z. W. (1972). Binding of
-bungarotoxin to
acetylcholine receptors in mammalian muscle (snake venom-denervated
muscle-neonatal muscle-rat diaphragm-SDS-polyacrylamide gel electrophoresis).
Proc. Natl. Acad. Sci. USA
69,147
-151.
Bernhardt, R. R., Goerlinger, S., Roos, M. and Schachner, M. (1998). Anterior-posterior subdivision of the somite in embryonic zebrafish: implications for motor axon guidance. Dev. Dyn. 213,334 -347.[CrossRef][Medline]
Broadie, K. and Bate, M. (1993a). Activity-dependent development of the neuromuscular synapse during Drosophila embryogenesis. Neuron 11,607 -619.[CrossRef][Medline]
Broadie, K. S. and Bate, M. (1993b). Development of larval muscle properties in the embryonic myotubes of Drosophila melanogaster. J. Neurosci. 13,167 -180.[Abstract]
Brown, M. C., Holland, R. L. and Hopkins, W. G. (1981). Motor nerve sprouting. Annu. Rev. Neurosci. 4,17 -42.[CrossRef][Medline]
Chow, I. and Poo, M. M. (1985). Release of acetylcholine from embryonic neurons upon contact with muscle cell. J. Neurosci. 5,1076 -1082.[Abstract]
Claiborne, B. J., Amaral, D. G. and Cowan, W. M. (1986). A light and electron microscopic analysis of the mossy fibers of the rat dentate gyrus. J. Comp. Neurol. 246,435 -458.[CrossRef][Medline]
Crow, M. T. and Stockdale, F. E. (1986). Myosin expression and specialization among the earliest muscle fibers of the developing avian limb. Dev. Biol. 113,238 -254.[CrossRef][Medline]
Croxen, R., Newland, C., Beeson, D., Oosterhuis, H.,
Chauplannaz, G., Vincent, A. and Newsom-Davis, J.
(1997). Mutations in different functional domains of the human
muscle acetylcholine receptor alpha subunit in patients with the slow-channel
congenital myasthenic syndrome. Hum. Mol. Genet.
6, 767-774.
Cull-Candy, S. G., Miledi, R., Trautmann, A. and Uchitel, O.
D. (1980). On the release of transmitter at normal,
myasthenia gravis and myasthenic syndrome affected human end-plates.
J. Physiol. 299,621
-638.
Dahm, L. M. and Landmesser, L. T. (1988). The regulation of intramuscular nerve branching during normal development and following activity blockade. Dev. Biol. 130,621 -644.[CrossRef][Medline]
Dailey, M. E. and Smith, S. J. (1993). Confocal imaging of mossy fiber growth in live hippocampal slices. Jpn. J. Physiol. Suppl. 43,S183 -S192.
Davis, G. W. and Goodman, C. S. (1998). Genetic analysis of synaptic development and plasticity: homeostatic regulation of synaptic efficacy. Curr. Opin. Neurobiol. 8, 149-156.[CrossRef][Medline]
Devoto, S. H., Melancon, E., Eisen, J. S. and Westerfield, M. (1996). Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation. Development 122,3371 -3380.[Abstract]
Downes, G. B. and Granato, M. (2004). Acetylcholinesterase function is dispensable for sensory neurite growth but is critical for neuromuscular synapse stability. Dev. Biol. (in press).
Duxson, M. J. (1982). The effect of postsynaptic block on development of the neuromuscular junction in postnatal rats. J. Neurocytol. 11,395 -408.[CrossRef][Medline]
Eisen, J. S., Myers, P. Z. and Westerfield, M. (1986). Pathway selection by growth-cones of identified motoneurons in live zebra fish embryos. Nature 320,269 -271.[CrossRef][Medline]
Engel, A. G., Lambert, E. H., Mulder, D. M., Torres, C. F., Sahashi, K., Bertorini, T. E. and Whitaker, J. N. (1982). A newly recognized congenital myasthenic syndrome attributed to a prolonged open time of the acetylcholine-induced ion channel. Ann. Neurol. 11,553 -569.[CrossRef][Medline]
Engel, A. G., Ohno, K. and Sine, S. M. (2003). Congenital myasthenic syndromes: progress over the past decade. Muscle Nerve 27,4 -25.[CrossRef][Medline]
Engel, A. G., Ohno, K., Milone, M., Wang, H. L., Nakano, S.,
Bouzat, C., Pruitt, J. N., II, Hutchinson, D. O., Brengman, J. M.,
Bren, N. et al. (1996). New mutations in acetylcholine
receptor subunit genes reveal heterogeneity in the slow-channel congenital
myasthenic syndrome. Hum. Mol. Genet.
5,1217
-1227.
Evers, J., Laser, M., Sun, Y. A., Xie, Z. P. and Poo, M. M. (1989). Studies of nerve-muscle interactions in Xenopus cell culture: analysis of early synaptic currents. J. Neurosci. 9,1523 -1539.[Abstract]
Fenichel, G. M., Kibler, W. B., Olson, W. H. and Dettbarn, W.
D. (1972). Chronic inhibition of cholinesterase as a cause of
myopathy. Neurology 22,1026
-1033.
Fitzsimonds, R. M. and Poo, M. M. (1998).
Retrograde signaling in the development and modification of synapses.
Physiol. Rev. 78,143
-170.
Fredette, B. J. and Landmesser, L. T. (1991). A reevaluation of the role of innervation in primary and secondary myogenesis in developing chick muscle. Dev. Biol. 143, 19-35.[CrossRef][Medline]
Gates, M. A., Kim, L., Egan, E. S., Cardozo, T., Sirotkin, H.
I., Dougan, S. T., Lashkari, D., Abagyan, R., Schier, A. F. and Talbot,
W. S. (1999). A genetic linkage map for zebrafish:
comparative analysis and localization of genes and expressed sequences.
Genome Res. 9,334
-347.
Gomez, C. M., Maselli, R., Gundeck, J. E., Chao, M., Day, J.
W., Tamamizu, S., Lasalde, J. A., McNamee, M. and Wollmann, R. L.
(1997). Slow-channel transgenic mice: a model of postsynaptic
organellar degeneration at the neuromuscular junction. J.
Neurosci. 17,4170
-4179.
Gomez, C. M., Maselli, R. A., Groshong, J., Zayas, R., Wollmann,
R. L., Cens, T. and Charnet, P. (2002). Active calcium
accumulation underlies severe weakness in a panel of mice with slow-channel
syndrome. J. Neurosci.
22,6447
-6457.
Granato, M., van Eeden, F. J. M., Schach, U., Trowe, T., Brand, M., Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C.-P., Jiang, Y.-J. et al. (1996). Genes controlling and mediating locomotion behaviour of the zebrafish embryo and larva. Development 123,399 -413.[Abstract]
Harris, A. J. (1981). Embryonic growth and innervation of rat skeletal muscles. I. Neural regulation of muscle fibre numbers. Philos. Trans. R. Soc. London B Biol. Sci. 293,257 -277.[Medline]
Hatada, Y., Wu, F., Silverman, R., Schacher, S. and Goldberg, D. J. (1999). En passant synaptic varicosities form directly from growth cones by transient cessation of growth cone advance but not of actin-based motility. J. Neurobiol. 41,242 -251.[CrossRef][Medline]
Houenou, L. J., Pincon-Raymond, M., Garcia, L., Harris, A. J. and Rieger, F. (1990). Neuromuscular development following tetrodotoxin-induced inactivity in mouse embryos. J. Neurobiol. 21,1249 -1261.[CrossRef][Medline]
Huang, C. L. and Keynes, R. J. (1983). Terminal sprouting of mouse motor nerves when the post-synaptic membrane degenerates. Brain Res. 274,225 -229.[CrossRef][Medline]
Hume, R. I., Role, L. W. and Fischbach, G. D. (1983). Acetylcholine release from growth cones detected with patches of acetylcholine receptor-rich membranes. Nature 305,632 -634.[CrossRef][Medline]
Jarecki, J. and Keshishian, H. (1995). Role of neural activity during synaptogenesis in Drosophila. J. Neurosci. 15,8177 -8190.[Abstract]
Karlin, A. (2002). Emerging structure of the nicotinic acetylcholine receptors. Nat. Rev. Neurosci. 3, 102-114.[CrossRef][Medline]
Knapik, E. W., Goodman, A., Atkinson, O. S., Roberts, C. T., Shiozawa, M., Sim, C. U., Weksler-Zangen, S., Trolliet, M. R., Futrell, C., Innes, B. A. et al. (1996). A reference cross DNA panel for zebrafish (Danio rerio) anchored with simple sequence length polymorphisms. Development 123,451 -460.[Abstract]
Knapik, E. W., Goodman, A., Ekker, M., Chevrette, M., Delgado, J., Neuhauss, S., Shimoda, N., Driever, W., Fishman, M. C. and Jacob, H. J. (1998). A microsatellite genetic linkage map for zebrafish (Danio rerio). Nat. Genet. 18,338 -343.[CrossRef][Medline]
Laskowski, M. B., Olson, W. H. and Dettbarn, W. D. (1975). Ultrastructural changes at the motor end-plant produced by an irreversible cholinesterase inhibitor. Exp. Neurol. 47,290 -306.[CrossRef][Medline]
Leonard, J. P. and Salpeter, M. M. (1979).
Agonist-induced myopathy at the neuromuscular junction is mediated by calcium.
J. Cell Biol. 82,811
-819.
Leonard, R. J., Labarca, C. G., Charnet, P., Davidson, N. and
Lester, H. A. (1988). Evidence that the M2
membrane-spanning region lines the ion channel pore of the nicotinic receptor.
Science 242,1578
-1581.
Li, W., Ono, F. and Brehm, P. (2003). Optical
measurements of presynaptic release in mutant zebrafish lacking postsynaptic
receptors. J. Neurosci.
23,10467
-10474.
Liu, D. W. and Westerfield, M. (1990). The formation of terminal fields in the absence of competitive interactions among primary motoneurons in the zebrafish. J. Neurosci. 10,3947 -3959.[Abstract]
Liu, D. W. C. and Westerfield, M. (1992). Clustering of muscle acetylcholine receptors requires motoneurons in live embryos, but not in cell culture. J. Neurosci. 12,1859 -1866.[Abstract]
Loeb, J. A., Hmadcha, A., Fischbach, G. D., Land, S. J. and
Zakarian, V. L. (2002). Neuregulin expression at
neuromuscular synapses is modulated by synaptic activity and neurotrophic
factors. J. Neurosci.
22,2206
-2214.
Mason, C. A. and Gregory, E. (1984). Postnatal maturation of cerebellar mossy and climbing fibers: transient expression of dual features on single axons. J. Neurosci. 4,1715 -1735.[Abstract]
Melançon, E., Liu, D. W. C., Westerfield, M. and Eisen,
J. S. (1997). Pathfinding by identified zebrafish
motorneurons in the absence of muscle pioneers. J.
Neurosci. 17,7796
-7804.
Milone, M., Wang, H. L., Ohno, K., Fukudome, T., Pruitt, J. N.,
Bren, N., Sine, S. M. and Engel, A. G. (1997).
Slow-channel myasthenic syndrome caused by enhanced activation,
desensitization, and agonist binding affinity attributable to mutation in the
M2 domain of the acetylcholine receptor alpha subunit. J.
Neurosci. 17,5651
-5665.
Misgeld, T., Burgess, R. W., Lewis, R. M., Cunningham, J. M., Lichtman, J. W. and Sanes, J. R. (2002). Roles of neurotransmitter in synapse formation: development of neuromuscular junctions lacking choline acetyltransferase. Neuron 36,635 -648.[CrossRef][Medline]
Mishina, M., Takai, T., Imoto, K., Noda, M., Takahashi, T., Numa, S., Methfessel, C. and Sakmann, B. (1986). Molecular distinction between fetal and adult forms of muscle acetylcholine receptor. Nature 321,406 -411.[CrossRef][Medline]
Miyazawa, A., Fujiyoshi, Y., Stowell, M. and Unwin, N. (1999). Nicotinic acetylcholine receptor at 4.6 A resolution: transverse tunnels in the channel wall. J. Mol. Biol. 288,765 -786.[CrossRef][Medline]
Mullins, M. C., Hammerschmidt, M., Haffter, P. and Nüsslein-Volhard, C. (1994). Large-scale mutagenesis in the zebrafish: in search of genes controlling development in a vertebrate. Curr. Biol. 4,189 -202.[CrossRef][Medline]
Myers, P. Z., Eisen, J. S. and Westerfield, M. (1986). Development and axonal outgrowth of identified motoneurons in the zebrafish. J. Neurosci. 6,2278 -2289.[Abstract]
Neff, M. M., Neff, J. D., Chory, J. and Pepper, A. E. (1998). dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: experimental applications in Arabidopsis thaliana genetics. Plant J. 14,387 -392.[CrossRef][Medline]
Nguyen, P. V., Aniksztejn, L., Catarsi, S. and Drapeau, P.
(1999). Maturation of neuromuscular transmission during early
development in zebrafish. J. Neurophysiol.
81,2852
-2861.
Nick, T. A. and Ribera, A. B. (2000). Synaptic activity modulates presynaptic excitability. Nat. Neurosci. 3,142 -149.[CrossRef][Medline]
Ohno, K., Hutchinson, D. O., Milone, M., Brengman, J. M.,
Bouzat, C., Sine, S. M. and Engel, A. G. (1995).
Congenital myasthenic syndrome caused by prolonged acetylcholine receptor
channel openings due to a mutation in the M2 domain of the epsilon subunit.
Proc. Natl. Acad. Sci. USA
92,758
-762.
Ono, F., Shcherbatko, A., Higashijima, S., Mandel, G. and Brehm,
P. (2002). The Zebrafish motility mutant twitch once reveals
new roles for rapsyn in synaptic function. J.
Neurosci. 22,6491
-6498.
Paradis, S., Sweeney, S. T. and Davis, G. W. (2001). Homeostatic control of presynaptic release is triggered by postsynaptic membrane depolarization. Neuron 30,737 -749.[CrossRef][Medline]
Pittman, R. H. and Oppenheim, R. W. (1978). Neuromuscular blockade increases motoneurone survival during normal cell death in the chick embryo. Nature 271,364 -366.[CrossRef][Medline]
Rauch, G. J., Granato, M. and Haffter, P. (1997). A polymorphic zebrafish line for genetic mapping using SSLPs on high-percentage agarose gels. Trends Genet. Tech. Tips Online 13,461 .
Ritzenthaler, S., Suzuki, E. and Chiba, A. (2000). Postsynaptic filopodia in muscle cells interact with innervating motoneuron axons. Nat. Neurosci. 3,1012 -1017.[CrossRef][Medline]
Saint-Amant, L. and Drapeau, P. (1998). Time course of the development of motor behaviors in the zebrafish embryo. J. Neurobiol. 37,622 -632.[CrossRef][Medline]
Sanes, J. R. and Lichtman, J. W. (1999a). Development of the vertebrate neuromuscular junction. Annu. Rev. Neurosci. 22,389 -442.[CrossRef][Medline]
Sato, T. (1968). A modified method for lead staining of thin sections. J. Electron Microsc. Tech. (Tokyo) 17,158 -159.
Sepich, D. S., Ho, R. K. and Westerfield, M. (1994). Autonomous expression of the nic1 acetylcholine receptor mutation in zebrafish muscle cells. Dev. Biol. 161, 84-90.[CrossRef][Medline]
Sepich, D. S., Wegner, J., O'Shea, S. and Westerfield, M.
(1998). An altered intron inhibits synthesis of the acetylcholine
receptor alpha-subunit in the paralyzed zebrafish mutant nic1.
Genetics 148,361
-372.
Sheard, P. W. and Duxson, M. J. (1997). The transient existence of `en passant' nerve terminals in normal embryonic rat skeletal muscle. Dev. Brain Res. 98,259 -264.[CrossRef][Medline]
Tao, H. W. and Poo, M. (2001). Retrograde
signaling at central synapses. Proc. Natl. Acad. Sci.
USA 98,11009
-11015.
Trevarrow, B., Marks, D. L. and Kimmel, C. B. (1990). Organization of hindbrain segments in the zebrafish embryo. Neuron 4,669 -679.[CrossRef][Medline]
Uhm, C. S., Neuhuber, B., Lowe, B., Crocker, V. and Daniels, M.
P. (2001). Synapse-forming axons and recombinant agrin induce
microprocess formation on myotubes. J. Neurosci.
21,9678
-9689.
Unwin, N. (1995). Acetylcholine receptor channel imaged in the open state. Nature 373, 37-43.[CrossRef][Medline]
van Eeden, F. J., Granato, M., Odenthal, J. and Haffter, P. (1999). Developmental mutant screens in the zebrafish. Methods Cell Biol. 60,21 -41.[Medline]
Van Raamsdonk, W., Pool, C. W. and Kronnie, G. T. (1978). Differentiation of the muscle fiber types in the teleost Brachydanio rerio. Anat. Embryol. 153,137 -155.[CrossRef][Medline]
Van Raamsdonk, W., Van Veer, L., Veeken, K., Heyting, C. and Pool, C. W. (1982). Differentiation of muscle fiber types in the teleost, Brachydanio rerio, the zebrafish. Anat. Embryol. 164,51 -62.[CrossRef][Medline]
Westerfield, M., Liu, D. W., Kimmel, C. B. and Walker, C. (1990). Pathfinding and synapse formation in a zebrafish mutant lacking functional acetylcholine receptors. Neuron 4, 867-874.[CrossRef][Medline]
Westerfield, M., McMurray, J. V. and Eisen, J. S. (1986). Identified motoneurons and their innervation of axial muscles in the zebrafish. J. Neurosci. 6,2267 -2277.[Abstract]
White, J. G., Southgate, E., Thomson, J. N. and Brenner, S. (1983). Factors that determine connectivity in the nervous system of Caenorhabditis elegans. Cold Spring Harbor Symp. Quant. Biol. 48,633 -640.
Wilson, G. G. and Karlin, A. (1998). The location of the gate in the acetylcholine receptor channel. Neuron 20,1269 -1281.[CrossRef][Medline]
Wood, S. J. and Slater, C. R. (2001). Safety factor at the neuromuscular junction. Prog. Neurobiol. 64,393 -429.[CrossRef][Medline]
Xie, Z. P. and Poo, M. M. (1986). Initial
events in the formation of neuromuscular synapse: rapid induction of
acetylcholine release from embryonic neuron. Proc. Natl. Acad. Sci.
USA 83,7069
-7073.
Zeller, J. and Granato, M. (1999). The zebrafish diwanka gene controls an early step of motor growth cone migration. Development 126,3461 -3472.[Abstract]
Zhang, J. and Granato, M. (2000). The zebrafish unplugged gene controls motor axon pathway selection. Development 127,2099 -2111.[Abstract]
Zhang, L. I. and Poo, M. M. (2001). Electrical activity and development of neural circuits. Nat. Neurosci. Suppl 4,1207 -1214.
Zhao, H. and Nonet, M. L. (2000). A retrograde signal is involved in activity-dependent remodeling at a C. elegans neuromuscular junction. Development 127,1253 -1266.[Abstract]
This article has been cited by other articles:
![]() |
C. A. McMullen and F. H. Andrade Functional and Morphological Evidence of Age-Related Denervation in Rat Laryngeal Muscles J Gerontol A Biol Sci Med Sci, April 1, 2009; 64A(4): 435 - 442. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. Burgess and M. Granato The neurogenetic frontier--lessons from misbehaving zebrafish Brief Funct Genomic Proteomic, November 1, 2008; 7(6): 474 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. C Spitzer and L. N Borodinsky Implications of activity-dependent neurotransmitter-receptor matching Phil Trans R Soc B, April 12, 2008; 363(1495): 1393 - 1399. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Lefebvre, L. Jing, S. Becaficco, C. Franzini-Armstrong, and M. Granato Differential requirement for MuSK and dystroglycan in generating patterns of neuromuscular innervation PNAS, February 13, 2007; 104(7): 2483 - 2488. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. N. Borodinsky and N. C. Spitzer Activity-dependent neurotransmitter-receptor matching at the neuromuscular junction PNAS, January 2, 2007; 104(1): 335 - 340. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Pineda, K. R. Svoboda, M. A. Wright, A. D. Taylor, A. E. Novak, J. T. Gamse, J. S. Eisen, and A. B. Ribera Knockdown of Nav 1.6a Na+ channels affects zebrafish motoneuron development Development, October 1, 2006; 133(19): 3827 - 3836. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Panzer, Y. Song, and R. J. Balice-Gordon In Vivo Imaging of Preferential Motor Axon Outgrowth to and Synaptogenesis at Prepatterned Acetylcholine Receptor Clusters in Embryonic Zebrafish Skeletal Muscle J. Neurosci., January 18, 2006; 26(3): 934 - 947. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Matthews, N. Plumb-Rudewiez, K. Lorent, P. Gissen, C. A. Johnson, F. Lemaigre, and M. Pack Zebrafish vps33b, an ortholog of the gene responsible for human arthrogryposis-renal dysfunction-cholestasis syndrome, regulates biliary development downstream of the onecut transcription factor hnf6 Development, December 1, 2005; 132(23): 5295 - 5306. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Brennan, M. Mangoli, C. E. F. Dyer, and R. Ashworth Acetylcholine and calcium signalling regulates muscle fibre formation in the zebrafish embryo J. Cell Sci., November 15, 2005; 118(22): 5181 - 5190. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. van der Meulen, H. Schipper, J. L. van Leeuwen, and S. Kranenbarg Effects of decreased muscle activity on developing axial musculature in nicb107 mutant zebrafish (Danio rerio) J. Exp. Biol., October 1, 2005; 208(19): 3675 - 3687. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hirata, L. Saint-Amant, G. B. Downes, W. W. Cui, W. Zhou, M. Granato, and J. Y. Kuwada Zebrafish bandoneon mutants display behavioral defects due to a mutation in the glycine receptor {beta}-subunit PNAS, June 7, 2005; 102(23): 8345 - 8350. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hirata, L. Saint-Amant, J. Waterbury, W. Cui, W. Zhou, Q. Li, D. Goldman, M. Granato, and J. Y. Kuwada accordion, a zebrafish behavioral mutant, has a muscle relaxation defect due to a mutation in the ATPase Ca2+ pump SERCA1 Development, November 1, 2004; 131(21): 5457 - 5468. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Luna, M. Wang, F. Ono, M. R. Gleason, J. E. Dallman, G. Mandel, and P. Brehm Persistent Electrical Coupling and Locomotory Dysfunction in the Zebrafish Mutant shocked J Neurophysiol, October 1, 2004; 92(4): 2003 - 2009. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||