|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 May 2004
doi: 10.1242/dev.01129
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


1 Department of Developmental and Cell Biology, University of California,
Irvine, CA 92697-2300, USA
2 Laboratory of Stem Cell Biology, Cell & Gene Therapy Research Institute,
Pochon CHA University College of Medicine, Seoul 135-081, Korea
3 Retinoid Research, Departments of Chemistry and Biology, Allergan, Irvine, CA
92623, USA
Author for correspondence (e-mail:
blumberg{at}uci.edu)
Accepted 17 February 2004
| SUMMARY |
|---|
|
|
|---|
, RALDH2 and CYP26.
Overexpression of a constitutively active RAR
2
rescues the effects of FGF blockade on the expression of XCAD3 and
HOXB9. This suggests that RAR
2 is required as a downstream
target of FGF signaling for the posterior expression of XCAD3 and
HOXB9. Surprisingly, we found that posterior expression of
FGFR1 and FGFR4 was dependent on the expression of
RAR
2. Anterior expression was also altered with
FGFR1 expression being lost, whereas FGFR4 expression was
expanded beyond its normal expression domain. RAR
2 is required for the
expression of XCAD3 and HOXB9, and for the ability of XCAD3
to induce HOXB9 expression. We conclude that RAR
2 is required
at multiple points in the posteriorization pathway, suggesting that correct AP
neural patterning depends on a series of mutually interactive feedback loops
among FGFs, RARs and HOX genes.
Key words: Retinoic acid, FGF, Xenopus, XCAD3
| Introduction |
|---|
|
|
|---|
The direct neural inducers described above generate neural tissue of
anterior character (Hawley et al.,
1995
; Hemmati-Brivanlou et
al., 1994
; Hemmati-Brivanlou
and Melton, 1994
; Holley et
al., 1995
; Lamb et al.,
1993
). These findings support the activation-transformation model
of neural patterning wherein the initial basal state of the neural ectoderm is
anterior with additional factors being required to generate the posterior
parts of the nervous system (Eyal-Giladi,
1954
; Nieuwkoop,
1952
). The major components of the activation signal are FGF and
WNT signals that act before gastrulation to induce the organizer to secrete
inhibitors of BMP and WNT signaling such as noggin, chordin, cerberus,
follistatin and dickkopf during gastrulation (reviewed by
Harland, 2000
). In turn, these
induce the neuroectoderm to adopt an anterior fate.
The transformation signal has been more elusive and is only recently
becoming better understood. It has previously been shown that basic fibroblast
growth factor (bFGF, FGF2) could posteriorize anterior neuroectoderm in vitro,
suggesting an endogenous role for FGFs in neural induction and patterning
(Cox and Hemmati-Brivanlou,
1995
; Kengaku and Okamoto,
1995
; Lamb and Harland,
1995
) (reviewed by Doniach,
1995
). eFGF (FGF4) overexpression posteriorizes
the axis via induction of downstream genes Xcad3 and Hoxa7
in vivo (Pownall et al.,
1996
); and inhibition of FGF signaling via overexpression of the
dominant-negative FGF receptor 1, XFD, reduced the expression of the
posterior markers HOXA7 and XCAD3
(Pownall et al., 1996
).
Papalopulu and colleagues have shown that FGF8 acting through FGFR4 (rather
than eFGF acting through FGFR1) is likely to be the major FGF pathway in
neural posteriorization (Hardcastle et
al., 2000
).
We and others have shown that signaling through retinoic acid receptors
(RARs) is necessary for correct AP patterning. Hindbrain and posterior
patterning is abnormal in vitamin A-deficient quail
(Maden et al., 1996
) and rats
(Dickman et al., 1997
;
White et al., 1998
), and
these defects can be reversed by appropriate temporal administration of
retinoic acid (RA). We used overexpression of a dominant-negative RAR
to show that signaling through RARs is required for the expression of the
posterior markers HOXB9, N-tubulin and XLIM1
(Blumberg et al., 1997
).
Positional changes were observed in the hindbrain along with posterior
coordinate shifts in the expression of anterior markers. By contrast, locally
increasing RAR signaling yielded the opposite result
(Blumberg et al., 1997
).
Others showed that retinoid signaling was required to specify positional
identity in the hindbrain (Kolm et al.,
1997
; van der Wees et al.,
1998
). Overexpression of the Xenopus retinoic acid
hydroxylase (CYP26), which targets RA for degradation, leads to
expansion of anterior structures (de Roos
et al., 1999
; Hollemann et
al., 1998
), whereas inhibition of CYP26 expression led to
expansion of posterior structures (Kudoh
et al., 2002
). Overexpression of the RA biosynthetic enzyme
RALDH2 led to reduction of anterior structures
(Chen et al., 2001
).
RALDH2 loss of function led to a variety of axial defects in mice,
including axial shortening, loss of posterior rhombomere identity, limb buds
and a variety of retinoic acid inducible molecular markers
(Niederreither et al., 1999
).
Lumsden and colleagues recently showed that RA is the endogenous transforming
factor active during hindbrain patterning and that it acts in a
concentration-dependent fashion to specify the identity of rhombomeres 5-8
(Dupe and Lumsden, 2001
).
Together, these results indicate that retinoid signaling through RARs is
essential for correctly restricting the expression of anterior genes, and to
enable the expression of posterior marker genes. It should also be noted that
RA could posteriorize anterior neuroectoderm injected with XFD, whereas FGF
could not (Bang et al., 1997
).
Therefore, both retinoid and FGF signaling can posteriorize anterior neural
tissue in vitro, perhaps acting synergistically, as was suggested previously
based on transplantation experiments (Cho
and De Robertis, 1990
).
A role for WNT signaling in posteriorizing the embryonic axis has been
suggested by studies showing that overexpression of XWNT3A
posteriorized anterior neuroectoderm
(McGrew et al., 1997
;
McGrew et al., 1995
). Blockade
of XWNT8 signaling caused loss of posterior fates
(Bang et al., 1999
;
Fekany-Lee et al., 2000
;
McGrew et al., 1997
), whereas
inappropriate activation of WNT target genes caused by loss of the
headless/Tcf3 gene resulted in severe anterior defects in zebrafish
(Kim et al., 2000
). The
combination of ectopic FGF or WNT signaling and suppression of RA by
overexpression of CYP26 has been shown to leave the presumptive
neuroectoderm without any AP identity
(Kudoh et al., 2002
).
Loss-of-function and genetic analysis has shown that WNT8 is an important
transforming factor in zebrafish and Xenopus, and that either WNT8,
or a factor crucially dependent on WNT8 for its expression is an endogenous
neural transforming factor (Erter et al.,
2001
; Lekven et al.,
2001
). It has recently been shown that WNT8 signaling is required,
together with BMP and nodal, for formation of the tail organizer in zebrafish
(Agathon et al., 2003
).
Krumlauf and colleagues recently showed that the WNT/ß-catenin pathway
posteriorizes Xenopus neural tissue via an indirect mechanism
requiring FGF signaling, suggesting that the posteriorization pathway might be
WNT
FGF
XCAD3
posterior HOX genes
(Domingos et al., 2001
). This
model does not account for the observation that inhibiting RAR signaling
blocks the expression of posterior neural markers, while FGF and WNT signaling
are presumably normal (Blumberg,
1997
; Blumberg et al.,
1997
). Therefore, we aimed to determine where RAR signaling fits
into the scheme of neural posteriorization.
We hypothesized that as both FGF
(Isaacs et al., 1998
;
Pownall et al., 1996
) and
retinoid signaling (Blumberg et al.,
1997
) are required for the expression of posterior markers, these
pathways might converge on one or more common target genes. XCAD3 is
a key downstream gene in the FGF-mediated posteriorization pathway
(Isaacs et al., 1998
;
Pownall et al., 1996
) and
retinoids have been shown to influence the expression of caudal family genes
in other systems (Allan et al.,
2001
; Houle et al.,
2000
; Prinos et al.,
2001
). Therefore, we tested the effects of modulating retinoid
signaling on the expression of XCAD genes. XCAD3 is upregulated by
increasing RAR signaling and downregulated by inhibiting RAR signaling or the
expression of RAR
. Morpholino antisense oligonucleotide (MO)
mediated inhibition of RAR
2 expression led to loss of
XCAD3 and HOXB9 expression, confirming that RARs are
required for posterior gene expression. Epistasis experiments showed that
FGF8 overexpression could not rescue the effects of RAR loss
of function on XCAD3 or HOXB9 expression. However,
overexpression of a constitutively active RAR (but not RA treatment)
rescued the effects of FGF gene loss of function on XCAD3 and
HOXB9. This suggests that FGF signaling is not downstream of RAR
signaling but that RAR might be downstream of FGF. FGF receptor function was
required for the expression RAR
, RALDH2 and
CYP26 in whole embryos, and FGF8 microinjection induced expression of
RAR
, CYP26 and RALDH2 in the animal cap
assay. Taken together, these results suggest that RAR is downstream of FGF
signaling. However, we also found that RAR is required for the correct
expression of FGF8, FGFR4 and FGFR1, and that RA induces
expression of FGF8, FGFR1 and FGFR4 in animal caps, arguing
against a simple linear pathway. Co-injection of XCAD3 mRNA and an MO
directed against RAR
2.2 (RAR-MO) showed that regulation of HOXB9
expression by XCAD3 requires RAR
2 function, thus placing
RAR
2 both upstream and downstream of XCAD3. Last, we
show that XCAD3 expression requires RAR function for its correct
expression at stage 16 but not at stage 26. These data suggest the existence
of a mutually reinforcing feedback loop among FGF8/FGFR4, XRAR
and
XCAD3. Thus, it appears that RAR signaling is required at multiple steps in
the embryonic posteriorization pathway, suggesting that RAR and FGF signaling
have multiple points of interaction rather than being in a simple linear
pathway.
| Materials and methods |
|---|
|
|
|---|
Microinjection
Morpholino antisense oligonucleotides (MO) used in this study were the
following: XRAR
2.1, AAC TGA CCA TAG AGT GGA ACC GAG
C; XRAR
2.2, ATC CAA AGG AAG GTG AGT GTG TGT G. In all
experiments using MO, control embryos were injected with 20 ng of standard
control MO CCT CTT ACC TCA GTT ACA ATT TAT A (GeneTools). The following
plasmids were constructed by PCR amplification of the protein-coding regions
of the indicated genes and cloning into the expression vector pCDG1 or
pCDG1-VP16: XRAR
2.2
(Sharpe, 1992
) and
XCAD3 (Northrop and Kimelman,
1994
). mRNA was prepared from these plasmids as well as pSP36T-XFD
(Amaya et al., 1993
) and
pCS2-FGF8 (Hardcastle et al.,
2000
) using mMessage Machine (Ambion).
Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed as described
(Koide et al., 2001
). Probes
used in this study were the following: HOXB9
(Sharpe et al., 1987
),
XCAD1, XCAD2 (Blumberg et al.,
1991
) XCAD3 (Northrop
and Kimelman, 1994
), RAR
(Blumberg et al., 1992
),
FGF8 (Hardcastle et al.,
2000
), FGFR4 (Hongo
et al., 1999
), FGFR1 (Amaya et
al., 1993
), XRALDH2
(Chen et al., 2001
) and
CYP26 (de Roos et al.,
1999
). Lineage analysis using 100 pg/embryo of
ß-galactosidase was performed as described
(Blumberg et al., 1997
),
except that the chromogenic substrate was 5-bromo-6-chloro-3-indolyl
ß-D-galactopyranoside (magenta-gal, Biosynth AG), which produces an
insoluble red precipitate after cleavage by ß-galactosidase
(Sambrook and Russell,
2001
).
QRT-PCR
Embryo RNA was isolated using Trizol reagent (InVitrogen Life
Technologies), DNAse treated and LiCl precipitated, then reverse transcribed
using Superscript II reverse transcriptase according to the
manufacturer-supplied protocol (InVitrogen Life Technologies). QRT-PCR was
performed as described (Tabb et al.,
2003
) using the following primer sets: FGF8, 5'
AATCCTGGCGAACAAGAAGA and 3' TAACCAGTCTCCGCACCTTT; FGFR4,
5' GCCAGCTGGTAACACAGTCA and 3' TGATGGAACCACACTCTCCA; eFGF,
5' GTTTTACCGGACGGAAGGAT and 3' TCCATACAGCTTCCCCTTTG;
FGFR1, 5' GGTGTCCAGCAAATGGAACT and 3'
ATGGGACAACGGAATCCATA; XCAD1, 5' CAGCCTTGTGTTGGGGTATT and
3' GGTTTCCTGAGCCATTCGTA; XCAD2, 5' ACCAGCGCCTTGAATTAGAA
and 3' GAGTGGTTGTTGAGGCCTGT; XCAD3, 5'
AAGGGCAGCCTATGGAGTTT and 3' GTCCCAGATGGATGAGGAGA; XRAR
,
5' ATCAAGACGGTGGAATTTGC and 3' CAGTCCGTCAGAGAACGTCA;
RALDH2, 5' GCCCTTTTGATCCCACTACA and 3'
TCTTCCCAATGCTTTTCCAC; CYP26, 5' TGTTCGTGGTGGAATTGTGT and
3' TTAGCGGGTAGGTTGTCCAC; Histone H4, 5' AACATCCAGGGCATCACCAA and
3' AGAGCGTACACCACATCCAT.
Each primer set was found to amplify only a single band as determined by gel electrophoresis and melting curve analysis.
| Results |
|---|
|
|
|---|
in early Xenopus development
is expressed as two major isoforms during early
development, XRAR
1 and XRAR
2
(Sharpe, 1992
1 and RAR
2 are expressed
maternally; however, only RAR
2 is expressed
zygotically in Xenopus (Blumberg
et al., 1992
2 is expressed as two
different forms, XRAR
2.1 and
XRAR
2.2 that are presumably the product of the
pseudotetraploid nature of the Xenopus laevis genome
(Sharpe, 1992
using whole-mount in situ hybridization. Although, the
probe used for in situ hybridization can detect all isoforms of
RAR
, its temporal expression pattern indicates that the
detected signal is derived from XRAR
2
(Koide et al., 2001
2 was detected at as early as stage
9 and by stage 10 as a faint signal in the involuting surface layer
surrounding the blastopore (Fig.
1E), and became stronger as gastrulation proceeded
(Fig. 1G,I)
(Koide et al., 2001
expression was detected
predominantly in the posterior neural tube with weaker staining throughout the
embryo (Fig. 1B,D,F,H). As
previously reported (Sharpe,
1992
2 has a
sharp anterior border (Fig.
1J). Lower level expression continues anteriorly with prominent
later expression in the developing eyes
(Fig. 1J).
|
loss-of-function causes anterior and posterior truncations
2, we used morpholino antisense
oligonucleotide-mediated loss-of-function analysis
(Heasman et al., 2000
2.1 or XRAR
2.2.
Microinjection of the XRAR
2.1 MO was nontoxic and did not elicit a
phenotype at doses up to 20 ng/embryo (data not shown). By contrast,
microinjection of the XRAR
2.2 MO (hereafter RAR-MO) affected both
anterior and posterior development in the Xenopus tadpole
(Fig. 2)
(Koide et al., 2001
2.2 function is predominantly required for
development of the dorsal parts of the Xenopus embryo, consistent
with the zygotic expression pattern of this gene
(Fig. 1)
(Koide et al., 2001
2 mRNA with RAR-MO consistently rescued the morphological
abnormalities (Fig. 2D)
(Koide et al., 2001
|
is expressed in the region surrounding the blastopore
in gastrulating embryos (Fig.
1E,G), overlapping the reported expression patterns of
XWNT8 and XBRA
(Christian and Moon, 1993
2.2 is not required for their
expression. Therefore, it is unlikely that the posterior truncations elicited
by downregulating XRAR
2.2 expression with the RAR-MO
resulted from effects on XWNT8 or XBRA expression.
We have previously shown that overexpression of a dominant negative
RAR
1 suppressed expression of the spinal cord marker,
HOXB9 and the posterior markers XLIM1 and N-tubulin
(Blumberg et al., 1997
). As
the dominant-negative RAR
used in those experiments can also inhibit
expression from RARß and RAR
target genes
(Blumberg, 1997
;
Damm et al., 1993
), we tested
whether RAR
was required for HOXB9 expression using RAR-MO
injected embryos. Five or 10 ng of RAR-MO were injected bilaterally into the
animal pole of two-cell embryos that were allowed to develop until stage 18
then fixed for whole-mount in situ hybridization. HOXB9 expression
was inhibited in a dose-dependent manner
(Fig. 2H-J) and showed a range
of phenotypes that could be classified into three groups. Class I embryos
(n=5/23 for 5 ng MO, n=0/30 for 10 ng MO) showed weaker
HOXB9 staining than controls (Fig.
2G) and the presumptive posterior neural tube region (marked by
HOXB9 expression) was wider than that of control embryos
(Fig. 2H). HOXB9
expression in class II embryos (10/23 for 5 ng MO, 5/30 for 10 ng MO) was
weaker yet and the expression boundary was shifted posteriorly
(Fig. 2I). Class III embryos
expressed HOXB9 only in the posterior terminus of the embryo (5/23
for 5 ng MO, 25/30 for 10 ng MO) (Fig.
2I). Complete suppression of HOXB9 expression by
injection of 10 ng RAR-MO was not obtained (n>100). Co-injection
of 1 ng XRAR
2 mRNA rescued HOXB9 expression
(26/32 embryos were normal, 6/32 were class I)
(Fig. 2J). Based on these
observations, we conclude that signaling through XRAR
2.2 is
indispensable for the expression of HOXB9, in accord with previous
studies using a dominant-negative Xenopus RAR
(Blumberg et al., 1997
).
RA signaling is required for XCAD3 expression
The homeobox gene XCAD3 has been implicated in the
posteriorization pathway as a downstream target of eFGF (FGF4) signaling
(Isaacs et al., 1998
;
Pownall et al., 1998
;
Pownall et al., 1996
). The
embryonic expression pattern of XCAD3 is strikingly similar to that
of HOXB9 (Northrop and Kimelman,
1994
). We identified XCAD3 in a screen to identify RAR
target genes (R. Niu and B. Blumberg, unpublished), which led us to
hypothesize that XCAD3 might be a common target for retinoid and FGF
signaling upstream of HOXB9. Two approaches were taken to investigate
this possibility. First, embryos were treated with either the synthetic
retinoid agonist TTNPB, which specifically activates all three subtypes of RAR
or the antagonist AGN193109, which specifically blocks the ability of RARs to
activate transcription (Koide et al.,
2001
). These reagents were chosen because they affect RARs but not
RXRs (Boehm et al., 1994
;
Johnson et al., 1995
). TTNPB
treatment enhanced the expression of XCAD3 in the posterior neural
tube (Fig. 3M), whereas
significant differences were not observed for XCAD1
(Fig. 3C) or XCAD2
(Fig. 3H) compared with control
embryos. Conversely, AGN193109 treatment suppressed XCAD3 expression
(Fig. 3K), but did not alter
expression of XCAD1 (Fig.
3A) or XCAD2 (Fig.
3F). QRT-PCR analysis showed that XCAD3 was slightly
upregulated by TTNPB (1.3-fold) and strongly downregulated by antagonist
(2.5-fold). XCAD1 was downregulated by both TTNPB and 193109
(indicating a non-specific effect on gene expression) and XCAD2 was
slightly downregulated by TTNPB (1.5 fold) but not affected by AGN193109 (1.07
fold up) (data not shown).
|
2.2 signaling on XCAD gene
expression using RAR-MO mediated loss-of-function. Two-cell embryos were
unilaterally injected with 5 ng RAR-MO and 100 pg ß-galactosidase mRNA,
fixed when controls reached the late neurula stage (stage 16-18), and stained
for ß-galactosidase activity. Embryos exhibiting appropriate
ß-galactosidase staining were selected for in situ hybridization.
XCAD3 expression was suppressed in 10/12 RAR-MO injected embryos
(Fig. 3N) and was rescued by
co-injection of XRAR
2 mRNA
(Fig. 3O). In agreement with
the retinoid treatments, expression of XCAD1 (n=12) and
XCAD2 (n=12) showed no significant differences between the
injected side and the uninjected contralateral control
(Fig. 3D,E,I,J). These results
indicate that only XCAD3 is regulated by RA in early Xenopus
embryos.
RA and FGF signaling converge on XCAD3
Slack, Isaacs and colleagues have shown that XCAD3 is a direct
target for FGF signaling and that an important embryonic posteriorization
pathway begins with eFGF (FGF4) activation of XCAD3, which induces
expression of HOXA7 and other posterior HOX genes
(Isaacs et al., 1998
;
Pownall et al., 1996
). They
showed that XCAD3 was necessary and sufficient to activate posterior HOX genes
(Isaacs et al., 1998
). Our
previous results (Blumberg et al.,
1997
) and those described above show that RAR signaling is also
required for the expression of posterior markers such as HOXB9 and
XCAD3. As both retinoid and FGF signaling appear to be important for
the expression of posterior genes, we carried out epistasis experiments
designed to reveal the relationship between RAR and FGF signaling.
bFGF (FGF2) treatment of neuralized Xenopus
animal cap explants induces posterior gene expression
(Bang et al., 1997
;
Papalopulu and Kintner, 1996
).
Recent publications suggested that FGF8 is likely to be the bona fide
posteriorizing FGF acting in the early embryo
(Christen and Slack, 1997
;
Hardcastle et al., 2000
;
Hongo et al., 1999
); hence, we
next tested the effects of microinjecting FGF8 mRNA, RAR-MO or both
together. Bilateral microinjection of 25 pg FGF8 mRNA into two-cell
embryos led to ectopic and enhanced expression of XCAD3 and
HOXB9 in anterior neural tissues (n=16/19;
Fig. 4C,H). The observed
anterior expansion of XCAD3 and HOXB9 was similar to that
observed for eFGF overexpression
(Pownall et al., 1996
). We
next asked whether FGF signaling is downstream of RAR signaling by testing
whether FGF8 overexpression could rescue the effects of the RAR-MO on
posterior gene expression. Injection of RAR-MO (10 ng) suppressed expression
of XCAD3 (n=8/11) and HOXB9 (n=10/11)
(Fig. 4B,G). Co-injection of as
much as 50 pg of FGF8 mRNA could not rescue expression of either gene
(n=10/11 for each gene; Fig.
4D,I). Lineage traced, unilateral microinjections confirmed this
observation (Fig. 4E,J).
Therefore, we infer that FGF8 signaling is not downstream of RAR
signaling.
|
2.2 mRNA with XFD partially rescued
HOXB9 (n=4/10) and XCAD3 (n=2/10)
expression (data not shown). Co-injection of the constitutively active
VP16-XRAR
2 (Blumberg,
1997
2.2 and the synthesis of RA are deficient in
XFD injected embryos. These results suggest that retinoid signaling
through XRAR
2.2 is required for FGF signaling to induce posterior genes
in the neural ectoderm, which may place RAR downstream of FGF signaling in
neural patterning.
|
, the RA-synthesizing enzyme RALDH2 and
the RA-degrading enzyme CYP26. Embryos were fixed at stage 11 and
those showing ß-gal expression in the region of the blastopore were
selected for in situ analysis. As previously reported, XFD blocks
XCAD3 expression at this stage
(Pownall et al., 1998
and XCAD3 are expressed in similar patterns at stage 11 and we found
that XFD also inhibits the expression of XRAR
(Fig. 6d). Strikingly, XFD also
led to the downregulation of RALDH2
(Fig. 6F) in the injected
cells. These results are consistent with the rescue experiments shown in
Fig. 5. CYP26 is
normally expressed dorsally and in the lateral mesoderm of gastrula embryos
(de Roos et al., 1999
|
2, RALDH2, CYP26 and the control
histone H4 were evaluated using QRT-PCR in untreated caps whereas XCAD3,
eFGF, FGF8, FGFR1 and histone H4 were evaluated in RA-treated caps
(Fig. 7). FGF8 upregulated the
expression of XCAD3, XRAR
2, RALDH2 and CYP26
(Fig. 7A). Taken together with
the loss-of-function experiments described above, this suggests that the
expression of components in the RAR signaling pathway, in vivo, depends on FGF
signaling.
|
regulates FGF signaling
RAR-MO was unilaterally microinjected into two-cell embryos together with
ß-galactosidase lineage tracer. Embryos were fixed when controls reached
stage 18-20, stained for ß-galactosidase activity then processed for
whole-mount in situ hybridization. The RAR-MO elicited an increase in the size
and staining intensity of the anterior lateral epidermal crescent expression
domain of FGF8 (Christen and
Slack, 1997
) (Fig.
8B), which was restored by microinjection of
XRAR
2 mRNA (Fig.
8C). Posterior expression near the blastopore was slightly
enhanced and extended anteriorly in RAR-MO injected embryos
(Fig. 8E) and rescued by
co-injection of XRAR
2 mRNA
(Fig. 8F). Overall, we observed
relatively minor, but reproducible changes in the expression of FGF8
in RAR-MO injected embryos.
|
2 mRNA, demonstrating its specificity
(Fig. 8I,L,O,R). These results
suggest that signaling through XRAR
2 is required for the correct
expression of these FGF signaling pathway components.
RA signaling is required both upstream and downstream of XCAD3
It has been suggested that posterior HOX genes are regulated by caudal
family genes based on the effects of XCAD3 loss of function
(Isaacs et al., 1998
) and the
identification of CDX-binding motifs in HOX gene promoters
(Subramanian et al., 1995
).
Knockout and transgenic mouse studies with caudal family genes showed
alterations in HOX gene expression
(Charite et al., 1998
;
Subramanian et al., 1995
).
Posterior HOX genes are also known to be sensitive to RA in cell culture
(Simeone et al., 1991
;
Simeone et al., 1990
;
Simeone et al., 1995
), and in
mouse (Gavalas and Krumlauf,
2000
; Kessel,
1992
; Kessel and Gruss,
1991
; Ogura and Evans,
1995a
; Ogura and Evans,
1995b
) and Xenopus embryos
(Durston et al., 1998
;
Godsave et al., 1998
;
van der Wees et al., 1998
).
One possible inference that can be drawn from the experiments described above
is that RAR regulates HOXB9 through the function of XCAD3, because
XCAD3 expression requires XRAR
(Figs
3,
4). However, those experiments
do not rule out the possibility that RAR signaling directly regulates the
expression of HOXB9 and perhaps other HOX genes. Several known and
putative retinoic acid response elements have been identified in HOX genes
(Dupe et al., 1997
;
Huang et al., 2002
;
Huang et al., 1998
;
Marshall et al., 1994
;
Ogura and Evans, 1995a
;
Zhang et al., 1997
)
suggesting that RAR may act in concert with XCAD3 and perhaps other factors,
instead of acting upstream of XCAD3 within a strict hierarchy. Therefore, we
examined this possibility by co-injecting the RAR-MO together with
XCAD3 mRNA. If XCAD3 is strictly downstream of XRAR
2 in the
regulation of HOXB9, microinjection of XCAD3 mRNA should
rescue the effects of RAR-MO on HOXB9. XCAD3 overexpression induced
ectopic anterior neural expression of HOXB9 (n=8/8;
Fig. 9C) as previously reported
(Isaacs et al., 1998
;
Pownall et al., 1998
).
Injection of the RAR-MO alone led to strong downregulation of HOXB9 together
with a posterior shift in its expression boundary
(Fig. 9B). Co-injection of the
RAR-MO and XCAD3 mRNA led to a substantial reduction in the intensity
of HOXB9 staining compared with XCAD3 or control embryos
(n=10/10) (Fig. 9D,E)
although HOXB9 expression was never completely eliminated. Unilateral
injections confirmed that HOXB9 expression was reduced by the RAR-MO,
even in the presence of overexpressed XCAD3
(Fig. 9F). These results
suggest that XRAR
2 is required both upstream and downstream of
XCAD3.
|
|
| Discussion |
|---|
|
|
|---|
2.2
is required for the expression of XCAD3 (Figs
3,
4) and HOXB9 (Figs
2,
4).
Overexpression of the dominant-negative FGF receptor 1 (XFD) mRNA
suppresses mesoderm formation (Amaya et
al., 1993
) and the expression of posterior neural genes
(Fig. 5)
(Pownall et al., 1998
;
Pownall et al., 1996
).
Microinjection of the constitutively active
VP16-XRAR
2 completely rescued XCAD3 and
HOXB9 expression in XFD-injected embryos, whereas
XRAR
2 led to partial rescue and RA treatment did not
rescue at all (Fig. 5).
Therefore, we infer that XFD is downregulating a crucial component of retinoid
signaling. The failure of RA to rescue the effects of XFD
overexpression suggests that expression of the receptor itself is the key
missing component, although the incomplete rescue elicited by the wild-type
receptor also implicates retinoid synthesis. The constitutively active
receptor does not require endogenous RARs or RA, and therefore would be
expected to rescue if retinoid is downstream of FGF signaling.
Inhibition of posterior gene expression by RAR-MO-mediated
XRAR
2.2 loss of function could not be overcome by
overexpressing FGF8 (Fig.
4) or XCAD3 (Fig.
9). The suppression of genes involved in RA signaling such as
XRAR
2, RALDH2 and CYP26 by XFD
injection (Fig. 6) is
consistent with a model wherein FGF signaling modulates RAR signaling by
regulating the availability of components in the RAR signaling pathway.
Zygotic expression of XRAR
, RALDH2 and CYP26
is detectable from the onset of gastrulation in the periblastoporal region
(Fig. 6) where various FGF
signaling pathway components are also expressed
(Golub et al., 2000
;
Hongo et al., 1999
;
Isaacs et al., 1995
;
Lombardo et al., 1998
;
Song and Slack, 1994
;
Song and Slack, 1996
). We
note that XRAR
, XRAR
and bioactive retinoids are all present in
the unfertilized egg (Blumberg et al.,
1992
). As RAR signaling is required for the expression of FGF
receptors in neural tissue (Fig.
9), it is possible that the maternally expressed RAR genes are
permissive for FGF signaling which is, in turn, instructive for the zygotic
expression of RAR pathway components.
FGF gene and XFD overexpression experiments using Xenopus
embryos suggested that FGF signaling is essential for neural posteriorization
(Cox and Hemmati-Brivanlou,
1995
; Kengaku and Okamoto,
1995
; Lamb and Harland,
1995
). Analysis of transgenic frogs overexpressing XFD
yielded somewhat conflicting results with one group suggesting that FGF
signaling is involved in gastrulation, but not in posteriorization
(Kroll and Amaya, 1996
), and
another demonstrating an absolute requirement for FGF signaling in neural
posteriorization (Pownall et al.,
1998
). The discrepancy between mRNA injections and the two
transgenic studies could be due to the different timing and levels of XFD
protein produced from the transgenic promoters, as opposed to the relatively
earlier expression of protein from the microinjected mRNA relative to the
transgenic promoters. XFD protein might not be produced at sufficient levels
early enough in the transgenic Xenopus embryo to completely block the
zygotic expression of the genes required for RAR signaling. Our observations
that inhibition of FGF signaling affected the expression of mRNAs encoding RA
pathway components in the early gastrula
(Fig. 6) and that RAR-MO
injection alters the expression of FGF8, FGFR1 and FGFR4
(Fig. 8) suggests that RAR and
FGF signaling crossregulate each other. The observation that RA upregulates
FGF8, FGFR1 and FGFR4 while FGF8 upregulates
RAR
, RALDH2 and CYP26 in animal cap
experiments (Fig. 7) supports
the existence of a feedback loop that allows these posteriorizing factors to
maintain each other's expression. The loss of FGF8 and FGF3
expression in Raldh2/ mice
(Niederreither et al., 1999
)
is also consistent with our findings.
RA signaling is involved in multiple steps of neural posteriorization
The alteration in the expression of FGF signaling components by the RAR-MO
(Fig. 8) together with the
requirement for FGF signaling to express RAR pathway components
(Fig. 6) supports the existence
of such a mutual feedback loop. Isaacs and colleagues showed that XCAD3
upregulates HOXB9 expression in Xenopus embryos using gain-
and loss-of-function experiments (Isaacs
et al., 1998
; Pownall et al.,
1998
; Pownall et al.,
1996
). Their model was further supported by the identification of
caudal/Cdx homeodomain-binding sites in the promoters of region of mouse and
chick HOX genes (Charite et al.,
1998
; Subramanian et al.,
1995
). We noted that ectopic expression of HOXB9 induced
by XCAD3 overexpression is restricted to the neural tube
(Fig. 9C) and next examined the
role of XRAR
in HOXB9 expression. Injection of
XCAD3 mRNA alone induced ectopic expression of HOXB9
anterior to where it is normally expressed
(Fig. 9C). Co-injection of the
RAR-MO led to severely reduced expression of HOXB9 throughout the
embryo (Fig. 9D-F), suggesting
that RAR function is required for XCAD3 to induce expression of
HOXB9. Expression of HOXB9
(Fig. 9C) is limited to neural
regions after XCAD3 overexpression, suggesting that other factors are
responsible for permitting or restricting HOXB9 expression to the
developing neural tube.
RAR signaling and regional boundaries within the developing CNS
The expression of XCAD3 and HOXB9 is reduced by RAR
antagonists and receptor loss of function. Loss of XCAD3 and
HOXB9 expression resulting from XFD-mediated blockade of FGF
signaling can be rescued by co-injection of the constitutively active
VP16-XRAR
2 (Fig. 5).
Therefore, we infer that RAR functions in the spinal cord region as a
transcriptional activator, downstream of FGF signaling. This function for RAR
is consistent with the restricted expression of the RA-synthesizing enzyme,
RALDH2, in the spinal cord and lateral mesoderm of early frog embryos
(Chen et al., 2001
) and with
RA rescue of posterior gene expression in XFD treated zebrafish embryos
(Kudoh et al., 2002
) or
Xenopus animal cap explants (Bang
et al., 1997
). Increasing RAR signaling by microinjecting
VP16-XRAR
1 (Blumberg,
1997
), treating embryos with RA or microinjecting XRALDH2
(Chen et al., 2001
) induces an
anterior shift in the expression boundaries of midbrain and hindbrain markers.
However, the position of the anterior border of HOXB9 and
XCAD3 expression is unaffected by increases in RAR signaling
(Fig. 5)
(Blumberg, 1997
;
Chen et al., 2001
) suggesting
that RAR signaling is not responsible for setting this boundary. When
expression of HOXB9 (Fig.
5C) or XCAD3 (Fig.
5F) is rescued by XRAR
2 or
VP16-XRAR
2 in XFD injected embryos, the anterior
border of the rescued expression is similar to that in the uninjected control
side of the embryo. This argues that FGF signaling is probably not involved in
regulating the anterior boundary of posterior marker expression. FGF8
and XCAD3 overexpression can elicit ectopic HOXB9 expression
in the anterior (Fig. 4). Both
are required for XRAR
expression but also need
XRAR
2.2 to exert their effects on downstream genes
such as HOXB9. The insufficiency of
VP16-XRAR
2 (which activates transcription of RAR
target genes strongly in the absence of retinoid ligands) to ectopically
induce HOXB9 or XCAD3, argues against CYP26 (which degrades
RA) being the major factor blocking the expression of posterior genes in the
head, as has been suggested for the zebrafish
(Kudoh et al., 2002
).
Inhibition of RAR signaling using an RAR antagonist or dominant-negative
RAR led to the upregulation of anterior markers
(Koide et al., 2001
) and a
caudal shift in the expression boundaries of anterior and hindbrain markers in
frog embryos (Blumberg et al.,
1997
). Similar results were obtained by overexpressing the RA
catabolizing enzyme CYP26 (de
Roos et al., 1999
; Hollemann
et al., 1998
; Maden,
1999
) in frog embryos or treating chick embryos with RAR
antagonists (Dupe and Lumsden,
2001
). Kudoh and colleagues recently showed that knockdown of
CYP26 expression led to downregulation of the anterior marker
OTX2 and anterior expansion of HOXB1B, MEIS3 and
IRO3 (Kudoh et al.,
2002
). We previously reported that unlike the hindbrain and spinal
cord, which require RAR as a transcriptional activator, RAR
is required
as a transcriptional repressor to allow anterior patterning
(Koide et al., 2001
). This
aspect of RAR function coincides with the expression of the RA degrading
enzyme CYP26 in regions anterior to the hindbrain
(de Roos et al., 1999
;
Hollemann et al., 1998
). Taken
together, these results suggest that a delicate balance exists between
RAR-mediated repression of target genes in the head that is required for
anterior patterning and the RAR-mediated activation of target genes that is
indispensable for the expression of posterior neural markers. The expression
of region-specific markers in the hindbrain is exquisitely sensitive to
alterations in RA signaling (Godsave et
al., 1998
; Kolm et al.,
1997
; van der Wees et al.,
1998
). Lumsden and colleagues showed convincingly that RA acts as
a classic morphogen in the hindbrain but that it appeared to be generated
locally at precise levels rather than forming a long-range gradient
(Dupe and Lumsden, 2001
). In
the absence of retinoid signaling the hindbrain develops as a default R4,
whereas increasing RA-signaling yields posterior rhombomeres in a
concentration-dependent fashion (Dupe and
Lumsden, 2001
).
Is there a role for retinoids and retinoid receptors other than in the hindbrain?
Although it is now well established that position in the hindbrain is set
by precisely delivered levels of RA
(Bel-Vialar et al., 2002
;
Chen et al., 2001
;
Dupe and Lumsden, 2001
;
Godsave et al., 1998
;
Hollemann et al., 1998
;
Kolm et al., 1997
;
van der Wees et al., 1998
)
the role of retinoids and retinoid receptors anterior and posterior to the
hindbrain remains controversial. For example, we showed that inhibition of RAR
function by overexpressing a dominant negative XRAR
1
led to posterior expansion of the forebrain marker OTX2, a posterior
shift in the expression of the midbrain marker EN2, a posterior shift
in the rhombomere 3 expression and loss of the rhombomere 5 expression of the
hindbrain marker KROX20 and downregulation of the posterior markers
HOXB9, XLIM1 and N-tubulin
(Blumberg et al., 1997
). By
contrast, increasing RAR function by microinjecting the constitutively active
VP16-XRAR
1 led to the opposite effect: a decreased
and anterior shift in the expression border of OTX2 and rostral
shifts in EN2 and KROX20 expression although the anterior
boundary of HOXB9 expression was unaffected
(Blumberg et al., 1997
). Thus,
we concluded that RARs were required for correct positional specification
along the entire AP axis (Blumberg,
1997
; Blumberg et al.,
1997
).
In contrast to our results, Sive and colleagues used a dominant-negative
Xenopus RAR
2.2 to show that interfering with retinoid
signaling altered hindbrain pattering in Xenopus but had no
observable effects on anterior (XCG, OTX2) or posterior
(HOXB9) gene expression (Kolm et
al., 1997
). Durston and colleagues used a dominant-negative
chicken RAR
2 and came to a similar conclusion: that inhibition of RAR
function substantially altered the expression patterns of certain genes
expressed in the hindbrain (KROX20, HOXB3) but not others (EN2,
HOXB1) although their results differed in some details from the
previously noted studies (van der Wees et
al., 1998
). No alterations were noted in the expression patterns
of OTX2, HOXB7 and HOXB9
(van der Wees et al.,
1998
).
These latter studies have led to the model that retinoids and retinoid
receptors are only required for patterning of the hindbrain
(Godsave et al., 1998
;
Niederreither et al., 2000
;
van der Wees et al., 1998
).
However, it is also plausible that the hindbrain is extremely sensitive to
levels of retinoid signalling, whereas more anterior and posterior regions
might be less sensitive. In this scenario, the efficacy of the reagents used
could play an important role in the type of outcome observed. Less potent
antagonists or dominant-negative receptors would be expected to show effects
in the hindbrain but not in the forebrain or spinal cord. In accordance with
this model and consistent with our results using a dominant-negative RAR
(Blumberg et al., 1997
),
decreasing the amount of RA by microinjecting XCYP26 mRNA into
Xenopus embryos led to posterior expansion of OTX2
expression, caudal shifts in the r3 band of KROX20 and the loss of
KROX20 in r5 (or fusion with r3)
(Hollemann et al., 1998
).
Similarly, increasing RA levels by microinjecting RALDH2 mRNA into
Xenopus embryos led to anterior shifts in the expression borders of
the midbrain band of OTX2 expression and of both r3 and r5 expression
of KROX20 (Chen et al.,
2001
) in accordance with our results using the constitutively
active VP16-XRAR
1 (Blumberg et al.,
1997
). No alteration in the expression boundary of HOXB9
was noted by microinjection of RALDH2, CYP26, DN-RAR or VP16-RAR
mRNAs (Blumberg et al., 1997
;
Chen et al., 2001
;
Hollemann et al., 1998
). Taken
together, these results show that RARs are required in the head as well as the
hindbrain, confirming a role for RARs in the anterior regions of the
embryo.
As noted above, no changes in HOXB9 expression were noted in
Xenopus embryos treated with RA, injected with dominant-negative
Xenopus RAR
2.2 or chicken
RAR
2 mRNAs
(Godsave et al., 1998
;
Kolm et al., 1997
;
van der Wees et al., 1998
).
Consistent with these observations, VAD quail embryos
(Maden et al., 1996
) and chick
embryos electroporated with a dominant-negative Xenopus
RAR
1 (Bel-Vialar et
al., 2002
) show alterations in anterior (3') HOX genes
(HOXB1, HOXB3, HOXB4, HOXB5) but not posterior (5') HOX gene
(HOXB6, HOXB9) expression. These results stand in stark contrast to
the results shown above and our previously published data showing inhibition
by posterior marker genes after downregulation of RAR function by three
different methods: microinjection of a dominant negative RAR
1
(Blumberg et al., 1997
),
morpholino oligonucleotide-mediated knockdown of
RAR
2.2 (Figs
2,
3,
4,
9) and treatment with the RAR
antagonist AGN193109 (Figs 3,
10). One possible resolution
for these discrepancies would be for the early and late expression of
posterior markers to have different regulatory mechanisms. We propose that the
early expression of posterior markers such as XCAD3 depends on
signaling through XRAR
2 as a downstream target of FGFs (Figs
5,
10). This early retinoid
dependent phase is followed by a later retinoid-independent, FGF-independent
stage wherein the expression of these genes recovers, even in the apparent
absence of retinoid (Fig.
10I,J) or FGF signaling
(Pownall et al., 1998
). This
model has the advantage of explaining all of the observed data while
simultaneously providing a potential function for the posterior expression of
genes such as XRAR
2
(Fig. 1) (Sharpe, 1992
),
XRAR
2
(Ellinger-Ziegelbauer and Dreyer,
1993
; Pfeffer and De Robertis,
1994
) and RALDH2
(Chen et al., 2001
).
Consistent with this proposal, the murine caudal gene, CDX1 is
induced by retinoic acid and downregulated in
Rara//Rarg/
embryos (Houle et al., 2000
).
Subsequent experiments showed that CDX1 expression requires RA for
expression only in early stages, later becoming dependent on WNT3A for its
continued expression (Prinos et al.,
2001
). Posterior expression of HOXA1 is lost in
Raldh2/ embryos at day 8.75
(Niederreither et al., 1999
)
but has normalized by day 9.5
(Niederreither et al., 2000
).
HOXB5A and HOXB6B expression were also shown to be
downregulated in no-fin mutant zebrafish, which are deficient in RALDH2
signaling (Grandel et al.,
2002
).
Experiments in Xenopus showed that RAR and FGF signaling patterned
largely non-overlapping regions in the embryonic hindbrain and posterior
(Kolm et al., 1997
), and that
XCAD3 is required for the expression of posterior HOX genes as a downstream
target of FGF signaling (Isaacs et al.,
1998
; Pownall et al.,
1998
; Pownall et al.,
1996
). 3' HOX genes that are expressed in the hindbrain and
midaxial regions such as HOXB1, HOXB3 and HOXB4 were shown
to be extremely sensitive to retinoid signaling whereas they are insensitive
to changes in FGF signaling in both chicken
(Bel-Vialar et al., 2002
) and
Xenopus (Epstein et al.,
1997
; Isaacs et al.,
1998
). Our data are consistent with an instructive role for RAR
signaling in the hindbrain and midaxial regions. By contrast, posterior genes
such as XCAD3 and HOXB9 require RAR signaling in a
permissive role downstream of FGF signaling but are also required for the
expression of FGF signaling pathway components. Therefore, we propose that the
developing CNS can be divided into three regions that differ with regard to
the expression of genes responsive to RAR signaling. In the first region, most
anterior neural tissue requires RAR as a transcriptional repressor, reinforced
by the action of CYP26 to degrade any RA that might be present outside the
restricted areas that require RA, such as the developing eye. The hindbrain
represents the limits of the second region, and expresses neither
CYP26 nor RALDH2. Hindbrain specification requires localized
activation of RAR to express region specific genes specifying rhombomere
identity (Dupe and Lumsden,
2001
; Maden, 1999
;
Maden, 2002
). The third
region, the spinal cord, which is represented by XCAD3 and
HOXB9 expression, requires RAR as a transcriptional activator in
frogs (Figs 5,
10) and zebrafish
(Kudoh et al., 2002
), although
RAR may be playing a permissive, rather than an instructive, role in this
process.
Left unexplained is the observation that knockout of multiple murine RARs
(e.g.
Rara//Rarb/)
is required to obtain unambiguous developmental phenotypes
(Mark et al., 1999
), whereas
our results using morpholino oligonucleotide-mediated gene knockdown presented
here (Figs 2,
3,
4,
8,
9) and elsewhere
(Koide et al., 2001
) show that
one need only inhibit expression of a single RAR isoform to generate
consistent phenotypes. This observation becomes rather more remarkable when
once considers that retinoids can activate other signaling proteins such as
NURR1 (Perlmann and Jansson,
1995
; Zetterstrom et al.,
1996
) RORß (Stehlin-Gaon
et al., 2003
) and PPARß/
(Shaw et al., 2003
). We
previously speculated that the maternal expression of Xenopus
RAR
and RAR
mRNAs
(Blumberg et al., 1992
;
Sharpe, 1992
), coupled with
the relatively late initiation of transcription in Xenopus
(mid-blastula,
4000-cell stage)
(Newport and Kirschner, 1982a
;
Newport and Kirschner, 1982b
)
compared with mouse (two-cell stage) made Xenopus more sensitive to
perturbations in RAR levels than mouse. The requirement for RAR function
relatively early in developmental patterning
(Fig. 10)
(Koide et al., 2001
) is
consistent with the possibility that RAR protein might be required too early
for loss of expression to be compensated for by upregulation of another RAR
gene.
The experiments described above reveal complex interactions among FGF,
XCAD3 and retinoid signaling (Fig.
11). Our results demonstrate that RARs act both upstream and
downstream of FGF signaling to pattern the AP axis. Xenopus
RAR
2.2 is required for the correct expression of FGF8, FGFR1
and FGFR4 (Fig. 8),
while FGF signaling is required for the zygotic expression of RAR signaling
pathway components (Fig. 6).
Embryos deficient in RAR
do not form heads
(Koide et al., 2001
) and
primary neurons do not differentiate
(Blumberg et al., 1997
;
Sharpe and Goldstone, 2000
;
Sharpe and Goldstone, 1997
).
This suggests that retinoid signaling is an essential component of the
positional patterning system operational at the very earliest stages of
embryonic development. The observations relating retinoid signaling and the
expression of neurogenic markers all clearly indicate a subsequent role for
retinoids in neuronal differentiation. Activity of the RARs is required for
the correct expression of proneural and prepatterning genes operating at the
earliest steps of neural development
(Franco et al., 1999
;
Paganelli et al., 2001
).
Considering that the timing of neuronal differentiation is coupled with that
of AP patterning (Papalopulu and Kintner,
1996
), it is plausible that retinoid signaling may play a key role
in linking these two crucial developmental processes.
|
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Department of Neuroscience, Kobe University Graduate
School of Medicine, Kobe 650-0017, Japan ![]()
| REFERENCES |
|---|
|
|
|---|
Agathon, A., Thisse, C. and Thisse, B. (2003).
The molecular nature of the zebrafish tail organizer.
Nature 434,448
-452.[CrossRef]
Allan, D., Houle, M., Bouchard, N., Meyer, B. I., Gruss, P. and
Lohnes, D. (2001). RARgamma and Cdx1 interactions in
vertebral patterning. Dev. Biol.
240, 46-60.[CrossRef][Medline]
Amaya, E., Musci, T. J. and Kirschner, M. W.
(1991). Expression of a dominant negative mutant of the FGF
receptor disrupts mesoderm formation in Xenopus embryos.
Cell 66,257
-270.[CrossRef][Medline]
Amaya, E., Stein, P. A., Musci, T. J. and Kirschner, M. W.
(1993). FGF signalling in the early specification of mesoderm in
Xenopus. Development
118,477
-487.[Abstract]
Bang, A. G., Papalopulu, N., Kintner, C. and Goulding, M. D.
(1997). Expression of Pax-3 is initiated in the early neural
plate by posteriorizing signals produced by the organizer and by posterior
nonaxial mesoderm. Development
124,2075
-2085.[Abstract]
Bang, A. G., Papalopulu, N., Goulding, M. D. and Kintner, C.
(1999). Expression of Pax-3 in the lateral neural plate is
dependent on a Wnt-mediated signal from posterior nonaxial mesoderm.
Dev. Biol. 212,366
-380.[CrossRef][Medline]
Bel-Vialar, S., Itasaki, N. and Krumlauf, R.
(2002). Initiating Hox gene expression: in the early chick neural
tube differential sensitivity to FGF and RA signaling subdivides the HoxB
genes in two distinct groups. Development
129,5103
-5115.
Blumberg, B. (1997). An essential role for
retinoid signaling in anteroposterior neural specification and neuronal
differentiation. Semin. Cell Dev. Biol.
8, 417-428.
Blumberg, B., Wright, C. V. E., de Robertis, E. M. and Cho, K.
W. Y. (1991). Organizer-specific homeobox genes in Xenopus
laevis embryos. Science
253,194
-196.
Blumberg, B., Mangelsdorf, D. J., Dyck, J., Bittner, D. A.,
Evans, R. M. and de Robertis, E. M. (1992). Multiple
retinoid-responsive receptors in a single cell: families of RXRs and RARs in
the Xenopus egg. Proc. Natl. Acad. Sci. USA
89,2321
-2325.
Blumberg, B., Bolado, J., Jr, Derguini, F., Craig, A. G.,
Moreno, T. A., Charkravarti, D., Heyman, R. A., Buck, J. and Evans, R.
M. (1996). Novel RAR ligands in Xenopus embryos.
Proc. Natl. Acad. Sci. USA
93,4873
-4878.
Blumberg, B., Bolado, J., Moreno, T. A., Kintner, C., Evans, R.
M. and Papalopulu, N. (1997). An essential role for
retinoid signaling in anteroposterior neural patterning.
Development 124,373
-379.[Abstract]
Boehm, M. F., Zhang, L., Badea, B. A., White, S. K., Mais, D.
E., Berger, E., Suto, C. M., Goldman, M. E. and Heyman, R. A.
(1994). Synthesis and structure-activity relationships of novel
retinoid X receptor-selective retinoids. J. Med. Chem.
37,2930
-2941.[CrossRef][Medline]
Chambon, P. (1996). A decade of molecular
biology of retinoic acid receptors. FASEB J.
10,940
-954.[Abstract]
Charite, J., de Graaff, W., Consten, D., Reijnen, M. J.,
Korving, J. and Deschamps, J. (1998). Transducing
positional information to the Hox genes: critical interaction of cdx gene
products with position-sensitive regulatory elements.
Development 125,4349
-4358.[Abstract]
Chen, Y., Pollet, N., Niehrs, C. and Pieler, T.
(2001). Increased XRALDH2 activity has a posteriorizing effect on
the central nervous system of Xenopus embryos. Mech.
Dev. 101,91
-103.[CrossRef][Medline]
Cho, K. W. Y. and de Robertis, E. M. (1990).
Differential activation of Xenopus homeobox genes by mesoderm inducing growth
factors and retinoic acid. Genes Dev.
4,1910
-1916.
Christen, B. and Slack, J. M. (1997). FGF-8 is
associated with anteroposterior patterning and limb regeneration in Xenopus.
Dev. Biol. 192,455
-466.[CrossRef][Medline]
Christian, J. L. and Moon, R. T. (1993).
Interactions between Xwnt-8 and Spemann organizer signaling pathways generate
dorsoventral pattern in the embryonic mesoderm of Xenopus. Genes
Dev. 7,13
-28.
Conlon, F. L., Sedgwick, S. G., Weston, K. M. and Smith, J.
C. (1996). Inhibition of Xbra transcription activation causes
defects in mesodermal patterning and reveals autoregulation of Xbra in dorsal
mesoderm. Development
122,2427
-2435.[Abstract]
Cox, W. G. and Hemmati-Brivanlou, A. (1995).
Caudalization of neural fate by tissue recombination and bFGF.
Development 121,4349
-4358.[Abstract]
Damm, K., Heyman, R. A., Umesono, K. and Evans, R. M.
(1993). Functional inhibition of retinoic acid response by
dominant negative retinoic acid receptor mutants. Proc. Natl. Acad.
Sci. USA 90,2989
-2993.
de Roos, K., Sonneveld, E., Compaan, B., ten Berge, D., Durston,
A. J. and van der Saag, P. T. (1999). Expression of retinoic
acid 4-hydroxylase (CYP26) during mouse and Xenopus laevis embryogenesis.
Mech. Dev. 82,205
-211.[CrossRef][Medline]
Dickman, E. D., Thaller, C. and Smith, S. M.
(1997). Temporally-regulated retinoic acid depletion produces
specific neural crest, ocular and nervous system defects.
Development 124,3111
-3121.[Abstract]
Domingos, P. M., Itasaki, N., Jones, S. A., Mercurio, S.,
Sargent, M. G., Smith, J. C. and Krumlauf, R. (2001).
The Wnt/b-catenin pathway posteriorizes neural tissue in Xenopus by an
indirect mechanism requiring FGF signaling. Dev. Biol.
239,148
-160.[CrossRef][Medline]
Doniach, T. (1995). Basic FGF as an inducer of
anteroposterior neural pattern. Cell
83,1067
-1070.[CrossRef][Medline]
Dupe, V., Davenne, M., Brocard, J., Dolle, P., Mark, M.,
Dierich, A., Chambon, P. and Rijli, F. M. (1997). In
vivo functional analysis of the Hoxa-1 3' retinoic acid response element
(3'RARE). Development
124,399
-410.[Abstract]
Dupe, V. and Lumsden, A. (2001). Hindbrain
patterning involves graded responses to retinoic acid signalling.
Development 128,2199
-2208.
Durston, A. J., van der Wees, J., Pijnappel, W. W. and Godsave,
S. F. (1998). Retinoids and related signals in early
development of the vertebrate central nervous system. Curr. Top.
Dev. Biol. 40,111
-175.[Medline]
Ellinger-Ziegelbauer, H. and Dreyer, C. (1993).
The pattern of retinoic acid receptor g (RARg) expression in normal
development of Xenopus laevis and after manipulation of the main body axis.
Mech. Dev. 41,33
-46.[CrossRef][Medline]
Epstein, M., Pillemer, G., Yelin, R., Yisraeli, J. K. and
Fainsod, A. (1997). Patterning of the embryo along the
anterior-posterior axis: the role of the caudal genes.
Development 124,3805
-3814.[Abstract]
Erter, C. E., Wilm, T. P., Basler, N., Wright, C. V. and
Solnica-Krezel, L. (2001). Wnt8 is required in lateral
mesendodermal precursors for neural posteriorization in vivo.
Development 128,3571
-3583.
Eyal-Giladi, H. (1954). Dynamic aspects of
neural induction. Arch. Biol.
65,180
-259.
Fainsod, A., Deissler, K., Yelin, R., Marom, K., Epstein, M.,
Pillemer, G., Steinbeisser, H. and Blum, M. (1997).
The dorsalizing and neural inducing gene follistatin is an antagonist of
BMP-4. Mech. Dev. 63,39
-50.[CrossRef][Medline]
Fekany-Lee, K., Gonzalez, E., Miller-Bertoglio, V. and
Solnica-Krezel, L. (2000). The homeobox gene bozozok promotes
anterior neuroectoderm formation in zebrafish through negative regulation of
BMP2/4 and Wnt pathways. Development
127,2333
-2345.[Abstract]
Franco, P. G., Paganelli, A. R., Lopez, S. L. and Carrasco, A.
E. (1999). Functional association of retinoic acid and
hedgehog signaling in Xenopus primary neurogenesis.
Development 126,4257
-4265.[Abstract]
Gavalas, A. and Krumlauf, R. (2000). Retinoid
signalling and hindbrain patterning. Curr. Opin. Genet.
Dev. 10,380
-386.[CrossRef][Medline]
Godsave, S. F., Koster, C. H., Getahun, A., Mathu, M., Hooiveld,
M., van der Wees, J., Hendriks, J. and Durston, A. J. (1998).
Graded retinoid responses in the developing hindbrain. Dev.
Dyn. 213,39
-49.[CrossRef][Medline]
Golub, R., Adelman, Z., Clementi, J., Weiss, R., Bonasera, J.
and Servetnick, M. (2000). Evolutionarily conserved
and divergent expression of members of the FGF receptor family among
vertebrate embryos, as revealed by FGFR expression patterns in Xenopus.
Dev. Genes Evol. 210,345
-357.[CrossRef][Medline]
Grandel, H., Lun, K., Rauch, G. J., Rhinn, M., Piotrowski, T.,
Houart, C., Sordino, P., Kuchler, A. M., Schulte-Merker, S., Geisler,
R. et al. (2002). Retinoic acid signalling in the zebrafish
embryo is necessary during pre-segmentation stages to pattern the
anterior-posterior axis of the CNS and to induce a pectoral fin bud.
Development 129,2851
-2865.
Hardcastle, Z., Chalmers, A. D. and Papalopulu, N.
(2000). FGF-8 stimulates neuronal differentiation through FGFR-4a
and interferes with mesoderm induction in Xenopus embryos. Curr.
Biol. 10,1511
-1514.[CrossRef][Medline]
Harland, R. (2000). Neural induction.
Curr. Opin. Genet. Dev.
10,357
-362.[CrossRef][Medline]
Hawley, S. H., Wunnenberg-Stapleton, K., Hashimoto, C., Laurent,
M. N., Watabe, T., Blumberg, B. and Cho, K. W. Y.
(1995). Disruption of BMP signals in embryonic Xenopus ectoderm
leads to direct neural induction. Genes Dev.
9,2923
-2935.
Heasman, J., Kofron, M. and Wylie, C. (2000).
Beta-catenin signaling activity dissected in the early Xenopus embryo: a novel
antisense approach. Dev. Biol.
222,124
-134.[CrossRef][Medline]
Hemmati-Brivanlou, A. and Melton, D. A. (1994).
Inhibition of activin receptor signaling promotes neuralization in Xenopus.
Cell 77,273
-281.[CrossRef][Medline]
Hemmati-Brivanlou, A., Kelly, O. G. and Melton, D. A.
(1994). Follistatin, an antagonist of activin, is expressed in
the Spemann organizer and displays direct neuralizing activity.
Cell 77,283
-295.[CrossRef][Medline]
Hollemann, T., Chen, Y., Grunz, H. and Pieler, T.
(1998). Regionalized metabolic activity establishes boundaries of
retinoic acid signalling. EMBO J.
17,7361
-7372.[CrossRef][Medline]
Holley, S. A., Jackson, P. D., Sasai, Y., Lu, B., de Robertis,
E. M., Hoffmann, F. M. and Ferguson, E. L. (1995). A
conserved system for dorsal-ventral patterning in insects and vertebrates
involving sog and chordin. Nature
376,249
-253.[CrossRef][Medline]
Hongo, I., Kengaku, M. and Okamoto, H. (1999).
FGF signaling and the anterior neural induction in Xenopus. Dev.
Biol. 216,561
-581.[CrossRef][Medline]
Hoppler, S., Brown, J. D. and Moon, R. T.
(1996). Expression of a dominant-negative Wnt blocks induction of
MyoD in Xenopus embryos. Genes Dev.
10,2805
-2817.
Houle, M., Prinos, P., Iulianella, A., Bouchard, N. and Lohnes,
D. (2000). Retinoic acid regulation of Cdx1: an indirect
mechanism for retinoids and vertebral specification. Mol. Cell
Biol. 20,6579
-6586.
Huang, D., Chen, S. W. and Gudas, L. J. (2002).
Analysis of two distinct retinoic acid response elements in the homeobox gene
Hoxb1 in transgenic mice. Dev. Dyn.
223,353
-370.[CrossRef][Medline]
Huang, D., Chen, S. W., Langston, A. W. and Gudas, L. J.
(1998). A conserved retinoic acid responsive element in the
murine Hoxb-1 gene is required for expression in the developing gut.
Development 125,3235
-3246.[Abstract]
Isaacs, H. V., Pownall, M. E. and Slack, J. M.
(1995). eFGF is expressed in the dorsal midline of Xenopus
laevis. Int. J. Dev. Biol.
39,575
-579.[Medline]
Isaacs, H. V., Pownall, M. E. and Slack, J. M.
(1998). Regulation of Hox gene expression and posterior
development by the Xenopus caudal homologue Xcad3. EMBO
J. 17,3413
-3427.[CrossRef][Medline]
Johnson, A. T., Klein, E. S., Gillett, S. J., Wang, L., Song, T.
K., Pino, M. E. and Chandraratna, R. A. (1995).
Synthesis and characterization of a highly potent and effective antagonist of
retinoic acid receptors. J. Med. Chem.
38,4764
-4767.[CrossRef][Medline]
Kengaku, M. and Okamoto, H. (1995). bFGF as a
possible morphogen for the anteroposterior axis of the central nervous system
in Xenopus. Development
121,3121
-3130.[Abstract]
Kessel, M. (1992). Respecification of vertebral
identities by retinoic acid. Development
115,487
-501.[Abstract]
Kessel, M. and Gruss, P. (1991). Homeotic
transformations of murine vertebrae and concomitant alteration of Hox codes
induced by retinoic acid. Cell
67, 89-104.[CrossRef][Medline]
Kim, C. H., Oda, T., Itoh, M., Jiang, D., Artinger, K. B.,
Chandrasekharappa, S. C., Driever, W. and Chitnis, A. B.
(2000). Repressor activity of Headless/Tcf3 is essential for
vertebrate head formation. Nature
407,913
-916.[CrossRef][Medline]
Koide, T., Downes, M., Chandraratna, R. A., Blumberg, B. and
Umesono, K. (2001). Active repression of RAR signaling
is required for head formation. Genes Dev.
15,2111
-2121.
Kolm, P. J., Apekin, V. and Sive, H. (1997).
Xenopus hindbrain patterning requires retinoid signaling. Dev.
Biol. 192,1
-16.[CrossRef][Medline]
Kroll, K. L. and Amaya, E. (1996). Transgenic
Xenopus embryos from sperm nuclear transplantations reveal FGF signaling
requirements during gastrulation. Development
122,3173
-3183.[Abstract]
Kudoh, T., Wilson, S. W. and Dawid, I. B.
(2002). Distinct roles for Fgf, Wnt and retinoic acid in
posteriorizing the neural ectoderm. Development
129,4335
-4346.
Lamb, T. M. and Harland, R. M. (1995).
Fibroblast growth factor is a direct neural inducer, which combined with
noggin generates anterior-posterior neural pattern.
Development 121,3627
-3636.[Abstract]
Lamb, T. M., Knecht, A. K., Smith, W. C., Stachel, S. E.,
Economides, A. N., Stahl, N., Yancopolous, G. D. and Harland, R. M.
(1993). Neural induction by the secreted polypeptide noggin.
Science 262,713
-718.
Lekven, A. C., Thorpe, C. P., Waxman, J. S. and Moon, R. T.
(2001). Zebrafish Wnt8 encodes two Wnt8 proteins on a bicistronic
transcript and is required for mesoderm and neuroectoderm patterning.
Dev. Cell 1,103
-114.[CrossRef][Medline]
Lombardo, A., Isaacs, H. V. and Slack, J. M.
(1998). Expression and functions of FGF-3 in Xenopus development.
Int. J. Dev. Biol. 42,1101
-1107.[Medline]
Maden, M. (1999). Heads or tails? Retinoic acid
will decide. BioEssays
21,809
-812.[CrossRef][Medline]
Maden, M. (2002). Retinoid signalling in the
development of the central nervous system. Nat. Rev.
Neurosci. 3,843
-853.[CrossRef][Medline]
Maden, M., Gale, E., Kostetskii, I. and Zile, M.
(1996). Vitamin A-deficient quail embryos have half a hindbrain
and other neural defects. Curr. Biol.
6, 417-426.[CrossRef][Medline]
Mark, M., Ghyselinck, N. B., Wendling, O., Dupe, V., Mascrez,
B., Kastner, P. and Chambon, P. (1999). A genetic
dissection of the retinoid signalling pathway in the mouse. Proc.
Nutr. Soc. 58,609
-613.[Medline]
Marshall, H., Studer, M., Popperl, H., Aparicio, S., Kuroiwa,
A., Brenner, S. and Krumlauf, R. (1994). A conserved
retinoic acid response element required for early expression of the homeobox
gene Hoxb-1. Nature 370,567
-571.[CrossRef][Medline]
McGrew, L. L., Hoppler, S. and Moon, R. T.
(1997). Wnt and FGF pathways cooperatively pattern
anteroposterior neural ectoderm in Xenopus. Mech. Dev.
69,105
-114.[CrossRef][Medline]
McGrew, L. L., Lai, C. J. and Moon, R. T.
(1995). Specification of the anteroposterior neural axis through
synergistic interaction of the Wnt signaling cascade with noggin and
follistatin. Dev. Biol.
172,337
-342.[CrossRef][Medline]
Newport, J. and Kirschner, M. (1982a). A major
developmental transition in early Xenopus embryos: II. Control of the onset of
transcription. Cell 30,687
-696.[CrossRef][Medline]
Newport, J. and Kirschner, M. (1982b). A major
developmental transition in early Xenopus embryos: I. Characterization and
timing of cellular changes at the midblastula stage.
Cell 30,675
-686.[CrossRef][Medline]
Niederreither, K., Subbarayan, V., Dolle, P. and Chambon, P.
(1999). Embryonic retinoic acid synthesis is essential for early
mouse post-implantation development. Nat. Genet.
21,444
-448.[CrossRef][Medline]
Niederreither, K., Vermot, J., Schuhbaur, B., Chambon, P. and
Dolle, P. (2000). Retinoic acid synthesis and hindbrain
patterning in the mouse embryo. Development
127, 75-85.[Abstract]
Nieuwkoop, P. D. (1952). Activation and
organization of the central nervous system in amphibians. Part III. synthesis
of a new working hypothesis. J. Exp. Zool.
120,83
-108.[CrossRef]
Nieuwkoop, P. O. and Faber, J. (1967).A Normal Table of Xenopus laevis (Daudin)
.
Amsterdam: North Holland.
Northrop, J. L. and Kimelman, D. (1994).
Dorsal-ventral differences in Xcad-3 expression in response to FGF-mediated
induction in Xenopus. Dev. Biol.
161,490
-503.[CrossRef][Medline]
Ogura, T. and Evans, R. M. (1995a). Evidence
for two distinct retinoic acid response pathways for HOXB1 gene regulation.
Proc. Natl. Acad. Sci. USA
92,392
-396.
Ogura, T. and Evans, R. M. (1995b). A retinoic
acid-triggered cascade of HOXB1 gene activation. Proc. Natl. Acad.
Sci. USA 92,387
-391.
Paganelli, A. R., Ocana, O. H., Prat, M. I., Franco, P. G.,
Lopez, S. L., Morelli, L., Adamo, A. M., Riccomagno, M. M., Matsubara,
E., Shoji, M. et al. (2001). The Alzheimer-related gene
presenilin-1 facilitates sonic hedgehog expression in Xenopus primary
neurogenesis. Mech. Dev.
107,119
-131.[CrossRef][Medline]
Papalopulu, N. and Kintner, C. (1996). A
posteriorising factor, retinoic acid, reveals that anteroposterior patterning
controls the timing of neuronal differentiation in Xenopus neuroectoderm.
Development 122,3409
-3418.[Abstract]
Perlmann, T. and Jansson, L. (1995). A novel
pathway for vitamin A signaling mediated by RXR heterodimerization with NGFI-B
and NURR1. Genes Dev. 9,769
-782.
Pfeffer, P. L. and de Robertis, E. M. (1994).
Regional specificity of RAR gamma isoforms in Xenopus development.
Mech. Dev. 45,147
-153.[CrossRef][Medline]
Piccolo, S., Sasai, Y., Lu, B. and de Robertis, E. M.
(1996). Dorsoventral patterning in Xenopus: inhibition of ventral
signals by direct binding of chordin to BMP-4. Cell
86,589
-598.[CrossRef][Medline]
Pownall, M. E., Tucker, A. S., Slack, J. M. W. and Isaacs, H.
V. (1996). eFGF, Xcad3, and Hox genes form a molecular
pathway that establishes the anteroposterior axis in Xenopus.
Development 122,3881
-3892.[Abstract]
Pownall, M. E., Isaacs, H. V. and Slack, J. M.
(1998). Two phases of Hox gene regulation during early Xenopus
development. Curr. Biol.
8, 673-676.[CrossRef][Medline]
Prinos, P., Joseph, S., Oh, K., Meyer, B. I., Gruss, P. and
Lohnes, D. (2001). Multiple pathways governing Cdx1
expression during murine development. Dev. Biol.
239,257
-269.[CrossRef][Medline]
Sambrook, J. and Russell, D. W. (2001).
Molecular Cloning: A Laboratory Manual. Cold Spring
Harbor, NY: Cold Spring Harbor Laboratory Press.
Sato, S. M. and Sargent, T. D. (1989).
Development of neural inducing capacity in dissociated Xenopus embryos.
Dev. Biol. 134,263
-266.[CrossRef][Medline]
Sharpe, C. and Goldstone, K. (2000). The
control of Xenopus embryonic primary neurogenesis is mediated by retinoid
signalling in the neurectoderm. Mech. Dev.
91, 69-80.[CrossRef][Medline]
Sharpe, C. R. (1992). Two isoforms of retinoic
acid receptor alpha expressed during Xenopus development respond to retinoic
acid. Mech. Dev. 39,81
-93.[CrossRef][Medline]
Sharpe, C. R. and Goldstone, K. (1997).
Retinoid receptors promote primary neurogenesis in Xenopus.
Development 124,515
-523.[Abstract]
Sharpe, C. R., Fritz, A., de Robertis, E. M. and Gurdon, J.
B. (1987). A homeobox-containing marker of posterior neural
differentiation shows the importance of predetermination in neural induction.
Cell 50,749
-758.[CrossRef][Medline]
Shaw, N., Elholm, M. and Noy, N. (2003).
Retinoic acid is a high affinity selective ligand for the peroxisome
proliferator-activated receptor beta/delta. J. Biol.
Chem. 278,41589
-41592.
Simeone, A., Acampora, P., Arcioni, Andrews, P. W., Boncinelli,
E. and Mavilio, F. (1990). Sequential activation of
Hox 2 homeobox genes by retinoic acid in human embryonal carcinoma cells.
Nature 346,763
-766.[CrossRef][Medline]
Simeone, A., Acampora, D., Nigro, V., Faiella, A., D'Esposito,
M., Stornainolo, A., Mavillio, F. and Boncinelli, E.
(1991). Differential regulation by retinoic acid of the homeobox
genes of the four HOX loci in human embryonal carcinoma cells.
Mech. Dev. 33,215
-228.[CrossRef][Medline]
Simeone, A., Avantaggiato, V., Moroni, M. C., Mavilio, F., Arra,
C., Cotelli, F., Nigro, V. and Acampora, D. (1995).
Retinoic acid induces stage-specific antero-posterior transformation of
rostral central nervous system. Mech. Dev.
51, 83-98.[CrossRef][Medline]
Sive, H. L., Grainger, R. M. and Harland, R. M.
(2000). Early Development of Xenopus laevis:
A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press.
Smith, J. C., Price, B. M., Green, J. B., Weigel, D. and
Herrmann, B. G. (1991). Expression of a Xenopus homolog of
Brachyury (T) is an immediate-early response to mesoderm induction.
Cell 67,79
-87.[CrossRef][Medline]
Song, J. and Slack, J. M. (1994). Spatial and
temporal expression of basic fibroblast growth factor (FGF-2) mRNA and protein
in early Xenopus development. Mech Dev.
48,141
-151.[CrossRef][Medline]
Song, J. and Slack, J. M. (1996). XFGF-9: a new
fibroblast growth factor from Xenopus embryos. Dev.
Dyn. 206,427
-436.[CrossRef][Medline]
Stehlin-Gaon, C., Willmann, D., Zeyer, D., Sanglier, S., van
Dorsselaer, A., Renaud, J. P., Moras, D. and Schule, R.
(2003). All-trans retinoic acid is a ligand for the orphan
nuclear receptor ROR beta. Nat. Struct. Biol.
10,820
-825.[CrossRef][Medline]
Subramanian, V., Meyer, B. I. and Gruss, P.
(1995). Disruption of the murine homeobox gene Cdx1 affects axial
skeletal identities by altering the mesodermal expression domains of Hox
genes. Cell 83,641
-653.[CrossRef][Medline]
Tabb, M. M., Sun, A., Errandi, J. L., Zhou, C., Grün, F.,
Romero, K., Inoue, S., Mallick, S., Lin, M., Forman, B. M. et al.
(2003). Vitamin K2 regulation of bone homeostasis is mediated by
the orphan receptor, SXR. J. Biol. Chem.
278,43919
-43927.
van der Wees, J., Schilthuis, J. G., Koster, C. H.,
Diesveld-Schipper, H., Folkers, G. E., van der Saag, P. T., Dawson, M.
I., Shudo, K., van der Burg, B. and Durston, A. J. (1998).
Inhibition of retinoic acid receptor-mediated signalling alters positional
identity in the developing hindbrain. Development
125,545
-556.[Abstract]
White, J. C., Shankar, V. N., Highland, M., Epstein, M. L.,
DeLuca, H. F. and Clagett-Dame, M. (1998). Defects in
embryonic hindbrain development and fetal resorption resulting from vitamin A
deficiency in the rat are prevented by feeding pharmacological levels of
all-trans-retinoic acid. Proc. Natl. Acad. Sci. USA
95,13459
-13464.
Xu, R. H., Kim, J., Taira, M., Zhan, S., Sredni, D. and Kung, H.
F. (1995). A dominant negative bone morphogenetic protein 4
receptor causes neuralization in Xenopus ectoderm. Biochem.
Biophys. Res. Commun. 212,212
-219.[CrossRef][Medline]
Zetterstrom, R. H., Solomin, L., Mitsiadis, T., Olson, L. and
Perlmann, T. (1996). Retinoid X receptor heterodimerization
and developmental expression distinguish the orphan nuclear receptors NGFI-B,
Nurr1, and Nor1. Mol. Endocrinol.
10,1656
-1666.
Zhang, F., Popperl, H., Morrison, A., Kovacs, E. N., Prideaux,
V., Schwarz, L., Krumlauf, R., Rossant, J. and Featherstone, M. S.
(1997). Elements both 5' and 3' to the murine Hoxd4
gene establish anterior borders of expression in mesoderm and neurectoderm.
Mech. Dev. 67,49
-58.[CrossRef][Medline]
Zimmerman, L. B., de Jesus-Escobar, J. M. and Harland, R. M.
(1996). The Spemann organizer signal noggin binds and inactivates
bone morphogenetic protein 4. Cell
86,599
-606.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
I. Strate, T. H. Min, D. Iliev, and E. M. Pera Retinol dehydrogenase 10 is a feedback regulator of retinoic acid signalling during axis formation and patterning of the central nervous system Development, February 1, 2009; 136(3): 461 - 472. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Olivera-Martinez and K. G. Storey Wnt signals provide a timing mechanism for the FGF-retinoid differentiation switch during vertebrate body axis extension Development, June 1, 2007; 134(11): 2125 - 2135. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nagel, C. Burek, L. Venturini, M. Scherr, H. Quentmeier, C. Meyer, A. Rosenwald, H. G. Drexler, and R. A. F. MacLeod Comprehensive analysis of homeobox genes in Hodgkin lymphoma cell lines identifies dysregulated expression of HOXB9 mediated via ERK5 signaling and BMI1 Blood, April 1, 2007; 109(7): 3015 - 3023. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Heasman Patterning the early Xenopus embryo. Development, April 1, 2006; 133(7): 1205 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Lee, S. Grill, A. Sanchez, M. Murphy-Ryan, and K. D. Poss Fgf signaling instructs position-dependent growth rate during zebrafish fin regeneration Development, December 1, 2005; 132(23): 5173 - 5183. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lupo, Y. Liu, R. Qiu, R. A. S. Chandraratna, G. Barsacchi, R.-Q. He, and W. A. Harris Dorsoventral patterning of the Xenopus eye: a collaboration of Retinoid, Hedgehog and FGF receptor signaling Development, April 1, 2005; 132(7): 1737 - 1748. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||