|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 May 2004
doi: 10.1242/dev.01127
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


1 University of Illinois at Chicago, Department of Biological Sciences, Chicago,
IL 60607, USA
2 Department of Biochemistry, Molecular Biology and Cell Biology, Northwestern
University, Evanston, IL, USA
Author for correspondence (e-mail:
torenic{at}uic.edu)
Accepted 16 February 2004
| SUMMARY |
|---|
|
|
|---|
Key words: hairy, hedgehog, decapentaplegic, brinker, Mechanosensory organs, Leg imaginal disc development, Drosophila
| Introduction |
|---|
|
|
|---|
Extensive studies on the development of sensory structures in the
Drosophila mesothorax and other tissues have shown that the redundant
proneural genes, ac and sc, function at a local level to
confer neural competence to cells destined to become sensory organs (SOs)
(Calleja et al., 2002
;
Modolell, 1997
). The bHLH
transcription factors, Ac and Sc, are expressed in proneural clusters, groups
of cells that roughly define the positions of future sensory structures in the
adult (Cubas et al., 1991
;
Romani et al., 1989
;
Skeath and Carroll, 1991
).
Then, through local regulatory events controlled by the neurogenic genes, a
cell(s) is selected from each proneural cluster to become a sensory organ
precursor, which undergoes a few differential cell divisions
(Calleja et al., 2002
;
Modolell, 1997
). The resulting
cells give rise to the components of the SO. In prepupal legs, expression of
ac and sc in a series of longitudinal proneural stripes
around the leg circumference defines the primordia of the mechanosensory
microchaetae. Expression of ac in the leg is regulated by h
(Orenic et al., 1993
), which
is itself periodically expressed in two pairs of longitudinal stripes, one
pair that traverses the dorsoventral (DV) axis (DV-h) and another
pair that runs along the anteroposterior (AP) axis (AP-h)
(Carroll and Whyte, 1989
;
Hays et al., 1999
). On either
side of each h domain, a stripe of ac expression demarcates
the position of each leg microchaete bristle row
(Orenic et al., 1993
).
h encodes a bHLH transcription factor
(Rushlow et al., 1989
) and is
a direct repressor of ac expression
(Ohsako et al., 1994
;
Van Doren et al., 1994
). In
the absence of h function, ac expression expands into the
regions normally occupied by Hairy, broadening the microchaete proneural
fields and resulting in disorganized bristle rows in the adult. Therefore,
precise position-specific expression of h in leg discs is crucial for
generation of the adult leg bristle row pattern.
We have investigated the regulation of two h stripes, the
DV-h stripes, and have found that they are established in response to
the signaling molecules that globally pattern leg imaginal discs
(Hays et al., 1999
).
Expression of the DV-h stripes is controlled by a pair of modular
enhancers that direct expression of the dorsal (D-h) and ventral
(V-h) stripes, respectively (Fig.
1). Here, we focus on the function of the D-h stripe
enhancer, which directs expression of h in a narrow dorsal domain
positioned a few cells anterior to the AP-compartment boundary and integrates
input from the Hedgehog (Hh) and Decapentaplegic (Dpp) signaling pathways.
|
Dpp acts as a long-range morphogen and regulates gene expression in
imaginal discs in a concentration-dependent manner
(Lecuit et al., 1996
;
Nellen et al., 1996
). In
response to Dpp signaling, an activated form of the Smad transcription factor,
Mothers against dpp (Mad), is generated. Mad then binds to a related protein,
Medea (Med), and this complex translocates to the nucleus to transcriptionally
regulate expression of Dpp target genes
(Raftery and Sutherland, 1999
;
Zimmerman and Padgett, 2000
).
In a number of cases, it has been observed that the Mad/Med complex binds the
enhancers of Dpp target genes and directly activates transcription
(Kim et al., 1997
;
Rushlow et al., 2001
;
Szuts et al., 1998
). However,
more recent studies indicate that Dpp also regulates its target genes by
blocking expression of a repressor. In imaginal discs, Mad/Med and the
zinc-finger protein Shn, repress expression of the brinker
(brk) gene (Marty et al.,
2000
; Muller et al.,
2003
; Torres-Vazquez et al.,
2000
), which encodes a direct repressor of Dpp target genes
(Campbell and Tomlinson, 1999
;
Jazwinska et al., 1999
;
Kirkpatrick et al., 2001
;
Minami et al., 1999
;
Rushlow et al., 2001
;
Saller and Bienz, 2001
;
Sivasankaran et al., 2000
;
Zhang et al., 2001
). The Brk
repressor is distributed in a gradient reciprocal to Dpp signaling and
functions to delimit the domains of Dpp target gene expression. It is thought
that competing interactions between Brk and Mad/Med define the expression
domains of some Dpp-target genes
(Kirkpatrick et al., 2001
;
Rushlow et al., 2001
;
Saller and Bienz, 2001
).
Our genetic studies suggest that Hh and Dpp signaling are both required to
activate D-h expression (Hays et
al., 1999
). Based on these genetic observations, we proposed that
Ci and Mad/Med act synergistically to activate h expression in the
dorsal region of the leg disc. To test this model and to investigate the
molecular mechanisms underlying integration of the Hh and Dpp signals, we have
undertaken a molecular analysis of the D-h enhancer. We show that the
D-h enhancer consists of at least two distinct sub-elements: a
Hh-responsive element (HHRE), which directs expression in a broad AP boundary
stripe, and a repression element (REPE), which refines HHRE-directed
expression along the AP and DV axes. We find that Brk acts through the REPE to
repress HHRE-directed expression, while Dpp functions to block Brk-mediated
repression in a narrow dorsal stripe. These observations suggest a novel role
for Brk in repression of a Hh-target gene and elucidate a mechanism for the
integration of the Hh and Dpp signals. Furthermore, this study establishes a
correlation between enhancer function and the formation of specific
morphological elements, the dorsal microchaete bristle rows of the adult
leg.
| Materials and methods |
|---|
|
|
|---|
smo and brk mutant clones were made in larvae of the genotypes: y hs-flp/HHRE-GFP; smoIIG26 FRT40A/hs-piMyc36F FRT40A or brk FRT18A/hs-piMyc10D FRT18A; D-h-GFP/+; hs-flp/+. Clones were generated by heat shocking larvae (48-96 hours after egg laying, AEL) for 1 hour at 37°C. Prior to dissection, third instar larvae or prepupae were heat shocked for 1 hour at 37°C to induce piMyc expression and were then allowed to recover for 1 hour.
For analysis of transgene expression in leg discs with reduced dpp function, discs were dissected from larvae or prepupae of the following genotypes: (1) D-h-GFP; dppd6/dppd12, (2) HHRE-GFP/; dppd6/dppd12 and (3) brk-lacZ; dppd6/dppd12. For ectopic expression studies, leg imaginal discs were dissected from larvae or prepupae of the following genotypes: (1) D-h-GFP;UAS-tkvQ253D/+; dpp-Gal4/+, (2) D-h-GFP; UAS-brk/+; dpp-Gal4/+, (3) HHRE-GFP; UAS-brk/+; dpp-Gal4/+, (4) D-h-CB-GFP; UAS-brk/+; dpp-Gal4 and (5) D-h-C-GFP; UAS-brk/+; dpp-Gal4.
Immunohistochemistry and microscopy
For anti-Myc (Xu and Rubin,
1993
), anti-ß-galactosidase (Promega) and anti-Engrailed
(Patel et al., 1989
) staining,
dissected imaginal discs or prepupal legs were treated as described
(Carroll and Whyte, 1989
). All
images were collected on a Zeiss Axiovert 200 M equipped with a digital
camera. Fluorescent images were collected as z-stacks and were
subjected to 3D-deconvolution.
Generation of wild-type and mutant reporter constructs and transformation
To generate the lacZ-transgenes, the corresponding wild-type and
mutant genomic DNA fragments were cloned in HSPCasper-lacZ
(Nelson and Laughon, 1990
).
GFP transgenes were generated by cloning the corresponding wild-type
and mutant genomic DNA into the pHStinger vector
(Barolo et al., 2000
). The
pHStinger vector offers the advantage that the reporter gene is flanked by
insulator sequences from the gypsy transposon. The insulator sequences reduce
position effects and thus result in less variability in expression among
different transgenic lines. Expression was assayed from at least three
independent transgenic lines for each construct; similar expression levels
were observed among all the lines. In addition, similar results were obtained
with insertions in both vectors. The D-h transgenes were generated by
cloning a 3.4 kb BamHI/EcoRI genomic fragment (see
Fig. 1B and results) into the
HSPCasper or pHStinger vectors. A 1 kb BamHI/HindIII
subfragment (Fig. 1B) from the
D-h enhancer was cloned into the corresponding vector to generate the
HHRE (Hh response element, see results) transgene.
All the site mutations were generated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) or the USE Mutagenesis Kit (Pharmacia) and are as follows (altered bases are shown in lower case).
Ci binding site mutations in the HHRE: Wild type, GACCTCCCA..............GACCACCAT; Ci1, GACCTCCCA.............. GAgttCCAT; Ci2, GACaTCCCA..............GACCACCAT; and Ci1+2, GACaTCCCA..............GACaACCAT.
CMB site mutations in the D-h enhancer: Wild type, GCGACGGCGTCATC; CRE(C), GCGACGGCGcCgTC; Mad1/CRE/-Mad2(MCM), aattCGGCGcCtTt; Mad1/Brinker/Mad2(MBM), aattCGaCGTCATt; CRE/Brinker(CB), GCGACGGCGaCtgC; Mad1/Mad2(MM), aattCGGCGTCAag; Mad2(M2), GCGACGGCGTCAag; Brinker/Mad2(BM2), GCGACGaCGTCAag.
Prior to introducing the mutated fragments into flies, all the mutagenized
regions were tested by gel mobility shift assays with Ci zinc-finger domain,
Brinker and/or N-Mad proteins. Several versions of the MM mutant were tested;
all affected Brk as well as Mad binding. The version used in this study had
the least effect on Brk binding, while still reducing Mad binding to a
significant degree. Reporter genes were introduced into flies by
P-element-mediated germline transformation
(Rubin and Spradling,
1982
).
Protein preparations and gel mobility shift assays
The Ci DNA-binding domain was prepared using the TNT Coupled Reticulocyte
System (Promega) as described (Hepker et
al., 1999
). The GST-N-Mad (Kim
et al., 1997
) was induced in E. coli BL21 with 100 mM
IPTG. The cells were harvested by centrifugation and sonicated on ice. After
incubating with Triton X-100 to 1% for 30 minutes, the lysate was pelleted by
centrifugation, and the supernatant was used to purify the proteins with the
GSTrap column (Amersham Pharmacia Biotech). Brinker protein was prepared in
the TNT Coupled Reticulocyte System, from a brk cDNA
(Minami et al., 1999
), which
was cloned into the SmaI site of pGEM4Z (Promega) as DraI
fragment.
For gel mobility shift assays, oligonucleotide probes were end-labeled with
[
-32P]dCTP (3000 Ci/mmol, ICN) and purified with a Sephadex
spin column. Prepared proteins were incubated on ice for 30 minutes with
50,000 c.p.m. of labeled probes in binding buffers as described
(Hepker et al., 1999
;
Kim et al., 1997
;
Sivasankaran et al., 2000
). In
some samples, unlabelled wild-type oligos (specific competitor) and mutant
oligos (nonspecific competitor) were included. The mixtures were separated in
5% polyacrylamide gels in 0.5xTBE.
The following oligos were used for gel mobility shift assays (top strands are shown). Ci1 wild type, CTGAATGGAGGACCACCATGTGTGT; Ci1 mutant, CTGAATGGAGGACaACCATGTGTGT; Ci2 wild type, CCAGCCATCCGACCTCCCAACCATT; Ci2 mutant, CCAGCCATCCGACaTCCCAACCATT; Mad/Brinker wild type, GCTTTTCGGCGACGGCGTCATCTTGTCATC; Mad-double mutant, GCTTTTCGagatCGGCGTCAaaTTGTCATC; Mad-single mutant, GCTTTTCGGCGACGaCGTCAaaTTGTCATC; Brinker mutant, GCTTTTCGGCGACaattaaATCTTGTCATC; CRE-mutant, GCTTTTCGGCGACGGCGcCgTCTTGTCATC; Mad2-mutant, GCTTTTCGGCGACGGCGTCAagTTGTCATC; Brk/Mad2-mutant, GCTTTTCGGCGACGaCGTCAagTTGTCATC; Mad1/Mad2-mutant, GCTTTTCGaattCGGCGTCAagTTGTCATC.
| Results |
|---|
|
|
|---|
A Hh responsive activation element is required for D-h enhancer activity
We previously showed that expression of the endogenous D-h stripe
is dependent on Hh signaling (Hays et al.,
1999
). In order to identify sequences that mediate Hh
responsiveness, we undertook a dissection of the D-h enhancer. The
D-h enhancer maps to a 3.4 kb BamHI/EcoRI fragment
located 32 kb 3' to the h structural gene
(Fig. 1B). In third instar leg
imaginal discs, this fragment directs lacZ expression in a dorsally
restricted AP boundary-adjacent stripe
(Fig. 1D). Two subfragments of
the D-h enhancer were tested for the ability to drive reporter gene
expression in leg imaginal discs. A 3' 2.4 kb
HindIII/EcoRI subfragment of the D-h enhancer (REPE
in Fig. 1B) directs no
detectable reporter gene expression in leg imaginal discs (not shown).
However, the complementary 5' 1.0 kb BamHI/HindIII
fragment of the D-h enhancer drives expression in a stripe that is
not dorsally restricted but rather traverses the entire length of the DV axis
(Fig. 1E), suggesting it
responds to Hh signaling in both dorsal and ventral leg cells. To determine
whether Hh signals through the BamHI/HindIII fragment of the
D-h enhancer, expression from a
BamHI/HindIII-GFP transgene was assayed in leg
clones lacking function of Smoothened (Smo), a transmembrane protein required
for transduction of the Hh signal (Alcedo
et al., 1996
; van den Heuvel
and Ingham, 1996
). Somatic clones lacking smo function
were generated by FLP/FRT-mediated mitotic recombination
(Xu and Rubin, 1993
). We
observed cell-autonomous loss of GFP expression in smo
clones that overlapped the GFP stripe (Fig.
2A-C). These observations imply that Hh signals through the
BamHI/HindIII fragment, and therefore, we refer to this
region as the D-h-Hh response element (HHRE).
|
|
|
|
Dpp signaling is required to block repression of D-h expression
We have previously shown that endogenous D-h expression is
compromised in somatic clones lacking function of Mad, the transcriptional
effector of Dpp signaling, and that D-h-lacZ expression is severely
decreased in leg imaginal discs with reduced dpp function
(Hays et al., 1999
).
Furthermore, D-h-lacZ expression is ventrally expanded in
wingless (wg) mutant legs, which have strong ventral
dpp expression (Brook and Cohen,
1996
; Jiang and Struhl,
1996
; Johnston and Schubiger,
1996
; Morimura et al.,
1996
; Penton and Hoffmann,
1996
; Theisen et al.,
1996
). These findings indicate a requirement for Dpp, in addition
to Hh signal, for D-h expression. The most parsimonious model to
explain how h integrates positive input from the Hh and Dpp signals,
is that Mad acts synergistically with Ci through the D-h enhancer to
activate D-h expression. However, we show here that Dpp is instead
required to block REPE-mediated repression.
As shown above, the HHRE directs expression in a broad stripe that extends into the ventral leg (Fig. 1E, Fig. 5B), where there is little or no Dpp signaling, implying that HHRE-directed expression does not require Dpp function. To determine whether HHRE-directed expression is Dpp independent, D-h-GFP and HHRE-GFP expression were examined in dppd6/dppd12 leg imaginal discs, which have reduced dpp function. In these leg discs, D-h-GFP expression is severely compromised (compare Fig. 5A with 5F), while HHRE-GFP expression is unaffected (compare Fig. 5B with 5G; note that in both dpp mutant and wild-type leg discs, the HHRE-GFP stripe is 5-6 cells wide). This result suggests that Dpp signals through the REPE. As the REPE functions as a repressive element, Dpp probably functions to block the repressive effects of this element rather than to activate D-h expression.
In leg discs, dpp is expressed in a broad AP boundary adjacent
stripe, which is stronger dorsally than it is ventrally (see dpp-lacZ
expression, Fig. 5D).
D-h-GFP expression coincides with a subset of cells expressing the
highest levels of lacZ within the dpp stripe
(Fig. 5C-E). Perhaps, then,
high-level Dpp signaling functions, by overcoming repressive effects of the
REPE, to define a narrow stripe of D-h expression within a broader
region defined by Hh. A prediction stemming from this hypothesis is that
elevation of Dpp signaling within the HHRE-response zone would expand
D-h expression. To test this premise, Dpp signaling was elevated
along the AP boundary by expression of a constitutively active form of the Dpp
receptor Thickveins (TkvQD)
(Nellen et al., 1996
). A
dpp-Gal4 transgene
(Staehling-Hampton et al.,
1994
), which drives Gal4 expression in a broad AP
boundary stripe at high levels in the dorsal leg and more weakly in the
ventral leg (Fig. 5H), was used
to express UAS-tkvQD. This results in broadening of the
D-h-GFP stripe and partial expansion into the ventral disc (compare
Fig. 5A with 5I). The insets in
Fig. 5 show D-h- and
HHRE-GFP expression in the basitarsal segment of leg discs dissected at 4
hours APF. By this time, the tarsal segments are obviously separated and
partially extended, allowing for accurate measurement of the breadth of each
GFP stripe. Note that the D-h stripe is two cells wide
(Fig. 5A), while in the leg
expressing tkvQD, D-h-GFP expression is four or
five cells wide, similar to the HHRE-GFP stripe
(Fig. 5B). Together these
studies support the hypothesis that high-level Dpp signaling defines the
position of the D-h stripe within the Hh response zone by interfering
with REPE function.
Brinker opposes Hh signaling through the D-h enhancer
Studies so far raise a question regarding the identity of the repressor(s)
that acts through the REPE to refine HHRE-directed expression. A potential
candidate, the transcriptional repressor of Dpp target genes, Brk
(Campbell and Tomlinson, 1999
;
Jazwinska et al., 1999
;
Kirkpatrick et al., 2001
;
Minami et al., 1999
;
Rushlow et al., 2001
;
Saller and Bienz, 2001
;
Sivasankaran et al., 2000
;
Zhang et al., 2001
), is
suggested by evidence indicating that Dpp is required to override REPE
function. In the wing and leg imaginal discs, brk expression is
repressed by and is roughly reciprocal to Dpp signaling. Hence, in the leg
disc, brk expression is lowest in dorsal-most leg cells
(Jazwinska et al., 1999
;
Muller et al., 2003
)
(Fig. 6B). D-h-GFP is
expressed within the region of low-level brk expression in leg discs
(Fig. 6A). Furthermore,
brk expression expands dorsally in
dppd6/dppd12 legs
(Fig. 6C), in which we showed
that D-h expression is severely reduced
(Fig. 5F).
|
|
|
As shown above, mutation of the Mad2 site has no effect on D-h-GFP expression, suggesting that only the Mad1 site is required, that the Mad2 site is functionally redundant with the Mad1 site, or that neither site is required for D-h expression. To test whether the Mad-binding sites are involved in D-h expression, both CMB-Mad sites were mutated (D-h-MM) (Fig. 8A). Weak residual binding to a single Mad site is observed with the CMB-MM mutant probe (not shown; see Materials and methods) and Brk binding is also reduced (Fig. 3, lane 27). We observe that D-h-MM-GFP stripe extends into the ventral disc and is slightly expanded along the AP axis (Fig. 8D, note that the stripe is two or three cells wide in the pupal leg). A probable explanation for this result is that ectopic expression is caused by compromised Brk binding to the MM-mutant CMB. We also observe that a D-h-MBM-GFP transgene directs expression of a stripe, which is broader along the AP and DV axes of the leg disc (Fig. 8E). The finding that the MBM mutation (which completely abrogates Brk binding) causes a more severe expansion phenotype than the MM mutation (which partially reduces Brk binding) is consistent with the hypothesis that the Brk binding site contributes to repression of D-h expression.
A Brinker response site in the D-h repression element is not sufficient to mediate repression
We also asked whether the CRE is required for proper D-h
expression. To test function of this site, a mutation was introduced into the
CRE (D-h-C), such that Brk and Mad binding were not compromised (Brk
binding to the CRE mutant is shown in Fig.
3, lanes 24). Surprisingly, mutation of the CRE results in
expression very similar to that of the HHRE-GFP transgene. The
D-h-C stripe extends ventrally and is five or six cells wide, which
suggests that the CRE is required for D-h repression
(Fig. 8G). Very similar
expression is observed with D-h-CB-
(Fig. 8F) and
D-h-MCM-GFP (not shown) transgenes. Although, it appears
that Brk binds the CMB to mediate repression of HHRE-directed expression, it
is evident that an intact Brk binding site is not sufficient for D-h
repression.
Because of the extensive overlap of Mad, CRE and Brk sites in the CMB, it was necessary to alter one base pair in the CRE when the BM2 and MBM mutations were generated. Although this mutation alters the site so that it more closely resembles a canonical CRE (Fig. 8A), it is possible that it disrupts function of the CMB-CRE. This raises the possibility that Brk acts indirectly through the CRE rather than by directly binding the Brk site. To test this hypothesis, we assayed the effect of Brk overexpression on D-h-C-GFP and D-h-CB-GFP expression. Brk overexpresssion only mildly affects D-h-CB-GFP (Fig. 6F) but severely reduces D-h-C-GFP (Fig. 6G) expression, suggesting that Brk can act directly through its binding site in the CMB.
| Discussion |
|---|
|
|
|---|
Activation of D-h expression
The D-h activation element, HHRE, has two consensus Ci-binding
sites, which bind Ci in vitro, and are required for its activity. In addition,
HHRE-GFP expression is abrogated in clones lacking function of
smo, a transducer of the Hh signal
(Alcedo et al., 1996
;
van den Heuvel and Ingham,
1996
). These observations suggest that Ci acts directly through
the HHRE to activate D-h expression. h is one of a number of
genes, including dpp, patched (ptc), knot and
araucan/caup (ara/caup), that have been identified as
targets of Hh signaling in imaginal discs
(Aza-Blanc and Kornberg, 1999
;
Vervoort, 2000
). These genes
are each expressed in a stripe along the AP compartment boundary, but
curiously, stripe widths among the genes varies as does register relative to
the AP boundary. This has been explained in terms of differential response of
Hh-target genes to the repressor and activator forms of Ci (Ci-R and Ci-A,
respectively) found in anterior compartment cells
(Methot and Basler, 1999
;
Muller and Basler, 2000
;
Wang and Holmgren, 1999
).
ptc, for example, has been proposed to respond only to the maximal
levels of Ci-A found in cells nearest the AP boundary, while dpp
responds to lower levels of Ci-A and also to Ci-R. The broad AP boundary
stripe of HHRE-directed expression suggests that the HHRE is highly responsive
to Ci-A. Differential response to Ci-R and Ci-A is thought to be controlled by
cis-regulatory elements outside the local context (within 100 bp) of Ci
binding sites in Hh responsive enhancers
(Muller and Basler, 2000
).
Consistent with this hypothesis, we have identified an element, the REPE,
which appears to modulate the response of the HHRE to Ci-A.
Although Ci-A is an essential and important activator, which acts directly
through the HHRE, it is unlikely that Ci-A function is sufficient for HHRE
activity. Several studies have suggested that signal response elements in
enhancers are generally not sufficient to activate gene expression
(Barolo and Posakony, 2002
).
Rather, the transcriptional effectors of signals must act cooperatively with
other activators to direct robust expression of target genes. This phenomenon,
which has been termed `activator insufficiency'
(Barolo and Posakony, 2002
),
presumably prevents promiscuous activation of potential target genes. It is
likely then, that other sites in the HHRE are required in addition to the Ci
sites for expression directed by this element. For example, as the HHRE drives
reporter gene expression in the wing and antennal discs (not shown) as well as
the leg, we might expect a common factor expressed in all three discs to act
through the HHRE in combination with Ci. Alternatively, the enhancer might
harbor sites that respond to factors specific to each disc type.
Dpp signals through the D-h repression element to block Brk-mediated repression
We have identified a short sequence in the REPE, the CMB, which functions
to restrict HHRE expression to a narrow dorsal domain. In this study, we
provide strong evidence for the hypothesis that the transcriptional repressor
Brk acts through the CMB to repress D-h expression. Although previous
studies have shown that brk expression is very low or undetectable in
cells near the Dpp source, we observe a genetic requirement for brk
in repression of D-h in this region. In addition, overexpression of
brk results in a dramatic reduction of D-h-GFP
expression, but only mildly affects expression from a
D-h-GFP transgene with a compromised Brk binding site.
We also found that Dpp acts through the REPE to block Brk-mediated
repression. We propose that high-level Dpp signaling defines the domain of
D-h expression within the HHRE-response zone. This idea is supported
by the observations that D-h-GFP but not HHRE-GFP
expression is dependent on Dpp, indicating that Dpp signals through the REPE,
and that elevation of Dpp signaling results in expansion of D-h
expression along the AP and DV axes, within the domain of HHRE activity. Our
current studies suggest that the function of Dpp in regulation of D-h
expression may be limited to repression of brk. Yet, the presence of
Mad-binding sites in the CMB suggests a potentially more direct role for
activated Mad (act-Mad), the transcriptional mediator of Dpp signaling. Brk
has been shown to be a potent competitor of Mad in vitro for binding to
overlapping binding sites in Dpp target enhancers
(Saller and Bienz, 2001
).
Hence, a potential role for Mad would be to prevent Brk from binding the CMB,
thereby blocking Brk repression in cells receiving high-level Dpp signaling.
If this model is correct, we might have expected the MM mutation to compromise
D-h expression, which was not the case. However, the destabilization
of Brk binding to the MM mutant might have masked a requirement for the Mad
sites in blocking Brk repression.
It has recently been shown that an act-Mad/Shn complex represses
brk expression by binding a silencer element
(Muller et al., 2003
).
Therefore, as mutation of the Mad sites expands D-h expression, it is
possible that Mad acts in concert with Brk through the CMB to repress
D-h expression. This notion is not inconsistent with genetic
evidence, indicating a requirement for Mad in D-h
expression, as loss of Mad function elevates Brk levels, which (as
discussed below) can overcome the requirement for CMB-sequences other than the
Brk site. However, if this were the case, we might have expected a more severe
expansion phenotype with the MM mutant, in which both Brk and Mad binding are
compromised. Further analysis is required to determine the role, if any, of
the CMB-Mad-binding sites in D-h expression.
A CRE in the D-h repression element is required for repression
Given the genetic evidence that Brk represses D-h expression and
that Brk binds the CMB element in vitro, the most straightforward hypothesis
is that Brk acts directly through the CMB in vivo to repress D-h
expression. However, as mutation of the CRE also causes loss of repression, it
is formally possible that the CRE rather than the Brk site is important for
repression. A potential explanation for this observation is that mutation of
the CRE lowers the affinity of this element for binding to Brk, even though
the Brk binding site is intact in the CMB-C mutant. Because the levels of Brk
in the dorsal leg are limiting, altered affinity could have a significant
effect on the level of Brk occupancy of the CMB. However, we observe through
EMSA analysis that the CRE mutant CMB binds Brk with an affinity greater than
that of the wild-type element (Fig.
3, lanes 23,24).
As it was not possible to mutate the Brk site without affecting the CRE, the CRE was altered in the BM2 and MBM mutants such that it more closely resembles a canonical CRE. Nevertheless, this change in the CRE may have affected its function. If so, this would be consistent with a model in which the CRE mediates repression of D-h expression, and Brk acts indirectly through the CRE rather than the Brk site. However, the finding that Brk overexpression drastically reduces D-h-C-GFP but not D-h-CB-GFP expression suggests that Brk can act directly through the Brk site, independent of the CRE.
The requirement for CMB-sequences outside the Brk binding site suggests
that the context of the Brk site within the CMB is important for repression. A
plausible explanation for the requirement of the CRE is that it is bound by a
factor, X, which functions to facilitate recruitment of Brk under conditions
where Brk levels are limiting, such as in the dorsal leg. Consistent with this
hypothesis is the observation that overexpression of Brk greatly reduces
D-h-C-GFP expression, suggesting that the requirement for
the CRE can be bypassed if the levels of Brk are high enough. However, when
Brk levels are limiting, the CRE might contribute more to D-h
repression than the Brk site. For example, in the dorsal leg, Factor X might
bind the CMB and then form a complex with Brk, relieving the necessity for Brk
to bind the CMB directly. This model could explain why D-h expression
appears to be significantly more sensitive to Brk-mediated repression than
other Brk targets in imaginal discs, such as vestigial (vg)
and opotomotor-blind (omb). vg and omb are
each expressed in broad domains across the center of the wing disc and are
repressed by higher levels of Brk than is D-h
(Campbell and Tomlinson, 1999
;
Jazwinska et al., 1999
;
Minami et al., 1999
). Perhaps,
the CRE and/or other sequences in the REPE mediate heightened response to Brk.
It will be of interest to determine whether other Brk-target genes, such as
spalt, which are also repressed by very low levels of Brk, are
similarly regulated.
A second potential function for a CRE-binding factor X is to act in concert
with Brk to mediate D-h repression. Several lines of evidence suggest
that Brk is a versatile repressor, which can inhibit transcription by
competing with activators for binding to a common site or by active
repression. Active repressors can act either at short range, by inhibiting
activity of activators bound to nearby elements (150 bp away or less), or at
long range by interfering with activators bound at a greater distances
(Cai et al., 1996
). Brk can
mediate active repression (Kirkpatrick et
al., 2001
), and binds the co-repressors dCtBP and Groucho (Gro),
which mediate short- and long-range repression, respectively
(Saller et al., 2002
;
Zhang et al., 2001
). Brk
requires Gro and/or dCtBP function for repression of a subset of its target
genes, whereas neither is required for repression of others
(Hasson et al., 2001
). In the
D-h enhancer, the CMB is positioned about 1 kb from the HHRE,
suggesting that CMB-binding repressor(s) act at long range to repress
HHRE-directed expression. Although Brk directly binds Gro, factor X could
facilitate recruitment of Gro or other co-factors required for long-range
repression.
Integration of Dpp and other signals
In this study, we identify a novel function for Brk as repressor of
Hh-target gene expression. Brk was originally identified as a repressor of
Dpp-target genes (Campbell and Tomlinson,
1999
; Jazwinska et al.,
1999
; Minami et al.,
1999
) and a recent study indicates that Brk can block Wg-mediated
transcription as well (Saller et al.,
2002
). Brk was shown to antagonize function of a Wg-responsive
element in the midgut enhancer of the Ultrabithorax (Ubx). The Ubx midgut
enhancer drives Ubx expression in parasegment (ps) 7 of the embryonic midgut
(Thuringer et al., 1993
). Two
elements, one which is Wg responsive (the WRS) and another Dpp responsive (the
DRS) function synergistically to activate Ubx expression in ps 7 expression
(Yu et al., 1998
). In the
adjacent ps8, however, Brk binds to the DRS and blocks the activity of the WRS
(Saller et al., 2002
).
Curiously, the D-h-CMB and the Ubx-DRS are similarly organized in
that each consists of overlapping CRE/Mad and Brk sites. The Ubx-DRS appears
to mediate two modes of signal integration which involve: (1) synergistic
activation, in which Mad/Med and dTCF act together to activate expression; and
(2) activation and refinement, in which there is Wg mediated activation
combined with Brk repression, which is blocked by Dpp. In the D-h
enhancer, however, the CMB appears to be a component of a dedicated repression
element, which appears to mediate only the second mode of signal integration:
activation and refinement. The similar organization of the CMB and DRS
suggests that it may be possible to predict the structure of enhancers known
to be Brk responsive and which integrate Dpp and a second signal.
Despite the similarities, there are important distinctions between the
D-h and Ubx-midgut enhancers, suggesting that the mechanisms of
Brk-mediated repression might differ in each case. In the Ubx-midgut enhancer,
the DRS and WRS are separated by 10 bp, suggesting that Brk acts at short
range to inhibit WRS activity. In the D-h enhancer, however, the CMB
is positioned at least 1 kb from the HHRE, implying a long-range effect for
this element. Furthermore, Brk repression of the WRS depends on Teashirt
(Tsh), which binds Brk and acts as a co-repressor
(Saller et al., 2002
). Tsh is
unlikely to be required for D-h repression because it is only
expressed in proximal leg segments (Erkner
et al., 1999
). Our studies suggest the requirement for a second
DNA-bound factor, which binds the CRE, in addition to Brk for repression. The
DRS-CRE, however, is required in addition to the Mad-binding sites for
activation of Ubx in ps 7 (Eresh et al.,
1997
; Szuts et al.,
1998
).
Competing inputs by Ci and Brk define a stripe of hairy expression
Together, our observations are consistent with a model
(Fig. 9) in which Ci, acting
through the HHRE, activates D-h expression. The domain of HHRE
activity can be divided into two zones, 1 and 2
(Fig. 9). The HHRE has the
potential to direct expression in both zones 1 and 2, but its activity is
restricted to zone 1 by Brk and perhaps a second factor, X, which binds the
CRE. In zone 2 cells, Brk would bind to the CMB and repress HHRE-directed
expression. We propose that zone 1 is defined by the overlap of Hh and
high-level Dpp signaling. Dpp promotes D-h expression by repressing
brk expression in zone 1. However, the presence of Mad-binding sites
in the CMB suggests the potential for a more direct role for Mad in
D-h regulation, perhaps in competing with Brk for binding to the CMB,
as shown, or in directly mediating repression. Confirmation of a role for the
Mad sites awaits further analysis of the D-h enhancer.
|
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Washington University in St Louis, Department of Biology
and Biomedical Sciences, St Louis, MO 63130, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Alcedo, J., Ayzenzon, M., Von Ohlen, T., Noll, M. and Hooper, J.
E. (1996). The Drosophila smoothened gene encodes a
seven-pass membrane protein, a putative receptor for the hedgehog signal.
Cell 86,221
-232.[CrossRef][Medline]
Alexandre, C., Jacinto, A. and Ingham, P. W.
(1996). Transcriptional activation of hedgehog target genes in
Drosophila is mediated directly by the cubitus interruptus protein, a member
of the GLI family of zinc finger DNA-binding proteins. Genes
Dev. 10,2003
-2013.
Aza-Blanc, P. and Kornberg, T. B. (1999). Ci: a
complex transducer of the hedgehog signal. Trends
Genet. 15,458
-462.[CrossRef][Medline]
Aza-Blanc, P., Ramirez-Weber, F. A., Laget, M. P., Schwartz, C.
and Kornberg, T. B. (1997). Proteolysis that is
inhibited by hedgehog targets Cubitus interruptus protein to the nucleus and
converts it to a repressor. Cell
89,1043
-1053.[CrossRef][Medline]
Barolo, S. and Posakony, J. W. (2002). Three
habits of highly effective signaling pathways: principles of transcriptional
control by developmental cell signaling. Genes Dev.
16,1167
-1181.
Barolo, S., Carver, L. A. and Posakony, J. W.
(2000). GFP and beta-galactosidase transformation vectors for
promoter/enhancer analysis in Drosophila.
Biotechniques 29,726
, 728, 730, 732.[Medline]
Blair, S. S. (1992). Engrailed expression in
the anterior lineage compartment of the developing wing blade of Drosophila.
Development 115,21
-33.[Abstract]
Blair, S. S. and Ralston, A. (1997).
Smoothened-mediated Hedgehog signalling is required for the maintenance of the
anterior-posterior lineage restriction in the developing wing of Drosophila.
Development 124,4053
-4063.[Abstract]
Brook, W. J. and Cohen, S. M. (1996).
Antagonistic interactions between wingless and decapentaplegic responsible for
dorsal-ventral pattern in the Drosophila Leg. Science
273,1373
-1377.[Abstract]
Cai, H. N., Arnosti, D. N. and Levine, M.
(1996). Long-range repression in the Drosophila embryo.
Proc. Natl. Acad. Sci. USA
93,9309
-9314.
Calleja, M., Renaud, O., Usui, K., Pistillo, D., Morata, G. and
Simpson, P. (2002). How to pattern an epithelium:
lessons from achaete-scute regulation on the notum of Drosophila.
Gene 292,1
-12.[CrossRef][Medline]
Campbell, G. and Tomlinson, A. (1999).
Transducing the Dpp morphogen gradient in the wing of Drosophila: regulation
of Dpp targets by brinker. Cell
96,553
-562.[CrossRef][Medline]
Carroll, S. B. and Whyte, J. S. (1989). The
role of the hairy gene during Drosophila morphogenesis: stripes in imaginal
discs. Genes Dev. 3,905
-916.
Chen, C. H., von Kessler, D. P., Park, W., Wang, B., Ma, Y. and
Beachy, P. A. (1999). Nuclear trafficking of Cubitus
interruptus in the transcriptional regulation of Hedgehog target gene
expression. Cell 98,305
-316.[CrossRef][Medline]
Cubas, P., de Celis, J. F., Campuzano, S. and Modolell, J.
(1991). Proneural clusters of achaete-scute expression and the
generation of sensory organs in the Drosophila imaginal wing disc.
Genes Dev. 5,996
-1008.
Diaz-Benjumea, F. J., Cohen, B. and Cohen, S. M.
(1994). Cell interaction between compartments establishes the
proximal-distal axis of Drosophila legs. Nature
372,175
-179.[CrossRef][Medline]
Dominguez, M., Brunner, M., Hafen, E. and Basler, K.
(1996). Sending and receiving the hedgehog signal: control by the
Drosophila Gli protein Cubitus interruptus. Science
272,1621
-1625.[Abstract]
Eresh, S., Riese, J., Jackson, D. B., Bohmann, D. and Bienz,
M. (1997). A CREB-binding site as a target for
decapentaplegic signalling during Drosophila endoderm induction.
EMBO J. 16,2014
-2022.[CrossRef][Medline]
Erkner, A., Gallet, A., Angelats, C., Fasano, L. and Kerridge,
S. (1999). The role of Teashirt in proximal leg development
in Drosophila: ectopic Teashirt expression reveals different cell behaviours
in ventral and dorsal domains. Dev. Biol.
215,221
-232.[CrossRef][Medline]
Gurdon, J. B. and Bourillot, P. Y. (2001).
Morphogen gradient interpretation. Nature
413,797
-803.[CrossRef][Medline]
Hasson, P., Muller, B., Basler, K. and Paroush, Z.
(2001). Brinker requires two corepressors for maximal and
versatile repression in Dpp signalling. EMBO J.
20,5725
-5736.[CrossRef][Medline]
Hays, R., Buchanan, K. T., Neff, C. and Orenic, T. V.
(1999). Patterning of Drosophila leg sensory organs through
combinatorial signaling by hedgehog, decapentaplegic and wingless.
Development 126,2891
-2899.[Abstract]
Hepker, J., Blackman, R. K. and Holmgren, R.
(1999). Cubitus interruptus is necessary but not sufficient for
direct activation of a wing-specific decapentaplegic enhancer.
Development 126,3669
-3677.[Abstract]
Hepker, J., Wang, Q. T., Motzny, C. K., Holmgren, R. and Orenic,
T. V. (1997). Drosophila cubitus interruptus forms a negative
feedback loop with patched and regulates expression of Hedgehog target genes.
Development 124,549
-558.[Abstract]
Inaki, M., Kojima, T., Ueda, R. and Saigo, K.
(2002). Requirements of high levels of Hedgehog signaling
activity for medial-region cell fate determination in Drosophila legs:
identification of pxb, a putative Hedgehog signaling attenuator gene repressed
along the anterior-posterior compartment boundary. Mech.
Dev. 116,3
-18.[CrossRef][Medline]
Jazwinska, A., Kirov, N., Wieschaus, E., Roth, S. and Rushlow,
C. (1999). The Drosophila gene brinker reveals a novel
mechanism of Dpp target gene regulation. Cell
96,563
-573.[CrossRef][Medline]
Jiang, J. and Struhl, G. (1996). Complementary
and mutually exclusive activities of decapentaplegic and wingless organize
axial patterning during Drosophila leg development.
Cell 86,401
-409.[CrossRef][Medline]
Johnston, L. A. and Schubiger, G. (1996).
Ectopic expression of wingless in imaginal discs interferes with
decapentaplegic expression and alters cell determination.
Development 122,3519
-3529.[Abstract]
Kim, J., Johnson, K., Chen, H. J., Carroll, S. and Laughon,
A. (1997). Drosophila Mad binds to DNA and directly mediates
activation of vestigial by Decapentaplegic. Nature
388,304
-358.[CrossRef][Medline]
Kirkpatrick, H., Johnson, K. and Laughon, A.
(2001). Repression of dpp targets by binding of brinker to mad
sites. J. Biol. Chem.
276,18216
-18222.
Lecuit, T., Brook, W. J., Ng, M., Calleja, M., Sun, H. and
Cohen, S. M. (1996). Two distinct mechanisms for long-range
patterning by Decapentaplegic in the Drosophila wing.
Nature 381,387
-393.[CrossRef][Medline]
Lunde, K., Trimble, J. L., Guichard, A., Guss, K. A., Nauber, U.
and Bier, E. (2003). Activation of the knirps locus
links patterning to morphogenesis of the second wing vein in Drosophila.
Development 130,235
-248.
Marty, T., Muller, B., Basler, K. and Affolter, M.
(2000). Schnurri mediates Dpp-dependent repression of brinker
transcription. Nat. Cell Biol.
2, 745-749.[CrossRef][Medline]
Methot, N. and Basler, K. (1999). Hedgehog
controls limb development by regulating the activities of distinct
transcriptional activator and repressor forms of Cubitus interruptus.
Cell 96,819
-831.[CrossRef][Medline]
Methot, N. and Basler, K. (2000). Suppressor of
fused opposes hedgehog signal transduction by impeding nuclear accumulation of
the activator form of Cubitus interruptus. Development
127,4001
-4010.[Abstract]
Minami, M., Kinoshita, N., Kamoshida, Y., Tanimoto, H. and
Tabata, T. (1999). brinker is a target of Dpp in Drosophila
that negatively regulates Dpp-dependent genes. Nature
398,242
-246.[CrossRef][Medline]
Modolell, J. (1997). Patterning of the adult
peripheral nervous system of Drosophila. Perspect. Dev.
Neurobiol. 4,285
-296.[Medline]
Montminy, M. R., Sevarino, K. A., Wagner, J. A., Mandel, G.
and Goodman, R. H. (1986). Identification of a
cyclic-AMP-responsive element within the rat somatostatin gene.
Proc. Natl. Acad. Sci. USA
83,6682
-6686.
Morimura, S., Maves, L., Chen, Y. and Hoffmann, F. M.
(1996). decapentaplegic overexpression affects Drosophila wing
and leg imaginal disc development and wingless expression. Dev.
Biol. 177,136
-151.[CrossRef][Medline]
Muller, B. and Basler, K. (2000). The repressor
and activator forms of Cubitus interruptus control Hedgehog target genes
through common generic gli-binding sites. Development
127,2999
-3007.[Abstract]
Muller, B., Hartmann, B., Pyrowolakis, G., Affolter, M. and
Basler, K. (2003). Conversion of an Extracellular Dpp/BMP
Morphogen Gradient into an Inverse Transcriptional Gradient.
Cell 113,221
-233.[CrossRef][Medline]
Nellen, D., Burke, R., Struhl, G. and Basler, K.
(1996). Direct and long-range action of a DPP morphogen gradient.
Cell 85,357
-368.[CrossRef][Medline]
Nelson, H. B. and Laughon, A. (1990). The DNA
binding specificity of the Drosophila fushi tarazu protein: a possible role
for DNA bending in homeodomain recognition. New Biol.
2, 171-178.[Medline]
Ohsako, S., Hyer, J., Panganiban, G., Oliver, I. and Caudy,
M. (1994). Hairy function as a DNA-binding helix-loop-helix
repressor of Drosophila sensory organ formation. Genes
Dev. 8,2743
-2755.
Orenic, T. V., Held, L. I., Jr, Paddock, S. W. and Carroll, S.
B. (1993). The spatial organization of epidermal structures:
hairy establishes the geometrical pattern of Drosophila leg bristles by
delimiting the domains of achaete expression.
Development 118,9
-20.[Abstract]
Patel, N. H., Martin-Blanco, E., Coleman, K. G., Poole, S. J.,
Ellis, M. C., Kornberg, T. B. and Goodman, C. S.
(1989). Expression of engrailed proteins in arthropods, annelids,
and chordates. Cell 58,955
-968.[CrossRef][Medline]
Penton, A. and Hoffmann, F. M. (1996).
Decapentaplegic restricts the domain of wingless during Drosophila limb
patterning. Nature 382,162
-164.[CrossRef][Medline]
Raftery, L. A. and Sutherland, D. J. (1999).
TGF-beta family signal transduction in Drosophila development: from Mad to
Smads. Dev. Biol. 210,251
-268.[CrossRef][Medline]
Romani, S., Campuzano, S., Macagno, E. R. and Modolell, J.
(1989). Expression of achaete and scute genes in Drosophila
imaginal discs and their function in sensory organ development.
Genes Dev. 3,997
-1007.
Rubin, G. M. and Spradling, A. C. (1982).
Genetic transformation of Drosophila with transposable element vectors.
Science 218,348
-353.
Rushlow, C. A., Hogan, A., Pinchin, S. M., Howe, K. M.,
Lardelli, M. and Ish-Horowicz, D. (1989). The
Drosophila hairy protein acts in both segmentation and bristle patterning and
shows homology to N-myc. EMBO J.
8,3095
-3103.[Medline]
Rushlow, C., Colosimo, P. F., Lin, M. C., Xu, M. and Kirov,
N. (2001). Transcriptional regulation of the Drosophila gene
zen by competing Smad and Brinker inputs. Genes Dev.
15,340
-351.
Saller, E. and Bienz, M. (2001). Direct
competition between Brinker and Drosophila Mad in Dpp target gene
transcription. EMBO Rep.
2, 298-305.[CrossRef][Medline]
Saller, E., Kelley, A. and Bienz, M. (2002).
The transcriptional repressor Brinker antagonizes Wingless signaling.
Genes Dev. 16,1828
-1838.
Sivasankaran, R., Vigano, M. A., Muller, B., Affolter, M. and
Basler, K. (2000). Direct transcriptional control of the Dpp
target omb by the DNA binding protein Brinker. EMBO J.
19,6162
-6172.[CrossRef][Medline]
Skeath, J. B. and Carroll, S. B. (1991).
Regulation of achaete-scute gene expression and sensory organ pattern
formation in the Drosophila wing. Genes Dev.
5, 984-995.
Spencer, F. A., Hoffmann, F. M. and Gelbart, W. M.
(1982). Decapentaplegic: a gene complex affecting morphogenesis
in Drosophila melanogaster. Cell
28,451
-461.[CrossRef][Medline]
Staehling-Hampton, K., Jackson, P. D., Clark, M. J., Brand, A.
H. and Hoffmann, F. M. (1994). Specificity of bone
morphogenetic protein-related factors: cell fate and gene expression changes
in Drosophila embryos induced by decapentaplegic but not 60A. Cell
Growth Differ. 5,585
-593.[Abstract]
Szuts, D., Eresh, S. and Bienz, M. (1998).
Functional intertwining of Dpp and EGFR signaling during Drosophila endoderm
induction. Genes Dev.
12,2022
-2035.
Tabata, T. (2001). Genetics of morphogen
gradients. Nat. Rev. Genet.
2, 620-630.[CrossRef][Medline]
Theisen, H., Haerry, T. E., O'Connor, M. B. and Marsh, J. L.
(1996). Developmental territories created by mutual antagonism
between Wingless and Decapentaplegic. Development
122,3939
-3948.[Abstract]
Thuringer, F., Cohen, S. M. and Bienz, M.
(1993). Dissection of an indirect autoregulatory response of a
homeotic Drosophila gene. EMBO J.
12,2419
-2430.[Medline]
Torres-Vazquez, J., Warrior, R. and Arora, K.
(2000). schnurri is required for dpp-dependent patterning of the
Drosophila wing. Dev. Biol.
227,388
-402.[CrossRef][Medline]
van den Heuvel, M. and Ingham, P. W. (1996).
smoothened encodes a receptor-like serpentine protein required for hedgehog
signalling. Nature 382,547
-551.[CrossRef][Medline]
Van Doren, M., Bailey, A. M., Esnayra, J., Ede, K. and Posakony,
J. W. (1994). Negative regulation of proneural gene activity:
hairy is a direct transcriptional repressor of achaete. Genes
Dev. 8,2729
-2742.
Vervoort, M. (2000). hedgehog and wing
development in Drosophila: a morphogen at work?
BioEssays 22,460
-468.[CrossRef][Medline]
Von Ohlen, T., Lessing, D., Nusse, R. and Hooper, J. E.
(1997). Hedgehog signaling regulates transcription through
cubitus interruptus, a sequence-specific DNA binding protein. Proc.
Natl. Acad. Sci. USA 94,2404
-2409.
Wang, Q. T. and Holmgren, R. A. (1999). The
subcellular localization and activity of Drosophila cubitus interruptus are
regulated at multiple levels. Development
126,5097
-5106.[Abstract]
Wang, Q. T. and Holmgren, R. A. (2000). Nuclear
import of cubitus interruptus is regulated by hedgehog via a mechanism
distinct from Ci stabilization and Ci activation.
Development 127,3131
-3139.[Abstract]
Xu, T. and Rubin, G. M. (1993). Analysis of
genetic mosaics in developing and adult Drosophila tissues.
Development 117,1223
-1237.[Abstract]
Yu, X., Riese, J., Eresh, S. and Bienz, M.
(1998). Transcriptional repression due to high levels of Wingless
signalling. EMBO J. 17,7021
-7032.[CrossRef][Medline]
Zarkower, D. and Hodgkin, J. (1993). Zinc
fingers in sex determination: only one of the two C. elegans Tra-1 proteins
binds DNA in vitro. Nucleic Acids Res.
21,3691
-3698.
Zhang, H., Levine, M. and Ashe, H. L. (2001).
Brinker is a sequence-specific transcriptional repressor in the Drosophila
embryo. Genes Dev. 15,261
-266.
Zimmerman, C. M. and Padgett, R. W. (2000).
Transforming growth factor beta signaling mediators and modulators.
Gene 249,17
-30.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. Gao, J. Steffen, and A. Laughon Dpp-responsive Silencers Are Bound by a Trimeric Mad-Medea Complex J. Biol. Chem., October 28, 2005; 280(43): 36158 - 36164. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-K. Bae, T. Shimizu, and M. Hibi Patterning of proneuronal and inter-proneuronal domains by hairy- and enhancer of split-related genes in zebrafish neuroectoderm Development, March 15, 2005; 132(6): 1375 - 1385. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||