|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 13 May 2004
doi: 10.1242/dev.01159
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Genetics, Campus Box 7614, North Carolina State University, Raleigh NC, 27695-7614, USA
* Author for correspondence (email: jim_mahaffey{at}ncsu.edu)
Accepted 9 March 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Hox, Homeotic, Zinc finger, Drosophila, Segment identity, Pattern formation
| Introduction |
|---|
|
|
|---|
Previously, we provided genetic evidence that the C2H2 zinc-finger proteins
encoded by disconnected (disco) and disco-related
(disco-r) are redundant co-factors for the gnathal HOM-C proteins,
Deformed (DFD) and Sex Combs Reduced (SCR)
(Mahaffey et al., 2001
). DFD
and SCR are required during development of the Drosophila larval
gnathal (mandibular, maxillary and labial) segments. Embryos lacking
disco and disco-r develop with a phenotype similar to those
lacking these HOM-C genes, and this phenotype is due, at least in
part, to reduced expression of DFD and SCR target genes. As the gnathal HOM-C
proteins are not required for disco and disco-r activation,
and vice versa, we proposed that these redundant proteins were potential
co-factors required for DFD and SCR function.
Many questions remain concerning this proposal. For example, are disco and disco-r required for all DFD functions, and do they have patterning roles independent of the HOM-C proteins? Several studies have shown that ectopic DFD can induce maxillary structures in the trunk segments. Does this indicate that DISCO and DISCO-R are required only for DFD function in the gnathal segments? Interestingly, there are several similarities between disco and disco-r and the trunk-specification gene teashirt (tsh). Each encodes a zinc-finger transcription factor and functions as a genetic co-factor during HOM-C specification of segment identity. The DISCO proteins and TSH are required in multiple segments where they interact with different HOM-C proteins. Expression of the disco genes and tsh abut at the gnathal-trunk boundary, possibly suggesting similar roles, but in different regions of the embryo. Here, we address these issues by examining the role of DISCO, with and without DFD, and the interplay between DISCO and TSH. We conclude the following: (1) alone, DISCO appears to impart a gnathal segment type; (2) cells can respond to the gnathal HOM-C protein DFD only where DISCO is present; and (3) TSH represses disco (and disco-r) expression in the trunk, thereby preventing gnathal traits from developing in the trunk segments. These observations lead us to propose a new model for the specification of segment identity within the Drosophila embryo.
| Materials and methods |
|---|
|
|
|---|
Induction of UAS-Dfd and UAS-disco
We induced ectopic expression, at 25°C, using arm-Gal4
(Sanson et al., 1996
) and
prd-Gal4 (Yoffe et al.,
1995
) drivers with analogous results (referred to as
arm
disco and prd
disco
respectively, below).
Cuticle analysis
Embryos were collected and prepared for cuticle examination following
procedures described previously (Pederson
et al., 1996
). Females were allowed to lay eggs for up to 24
hours, and embryos were aged for at least 24 hours before fixing the unhatched
terminal larvae.
Expression of Dfd in Df(1)XR14 males
To obtain flies expressing Dfd in the trunk segments of embryos
lacking disco and disco-r, we crossed
Df(1)XR14/FM7c females to UAS-Dfd (II) homozygous
males. The non-FM7c female progeny were crossed to homozygous
prd-Gal4 males producing males hemizygous for Df(1)XR14 and
lacking disco and disco-r. We could recognize those
ectopically expressing Dfd, as ectopic DFD disrupts anterior head
development, thereby further aggravating the phenotype of the
Df(1)XR14 hemizygotes.
In situ localization of mRNA and protein
Localization of mRNA and proteins followed the protocols essentially as
described previously (Pederson et al.,
1996
). Probes for disco and disco-r mRNAs were
from Mahaffey et al. (Mahaffey et al.,
2001
). For other mRNA localizations, probe templates were obtained
from Drosophila genomic DNA using PCR. The primers used to generate
clones were as follows: pannier, ACATTACGGACAGGCGACAC (forward) and
TGCAAACAAGGCCGAGTAG (reverse); salm, GCATACCAGAGCAAAGCACA (forward)
and GATAACCGCGGCACCCGATCACAGACCA (reverse); tsh, GCGTACCTGCACATGGTGGC
(forward) and GATCTCCGCGGCTGACTCTCGGCAGG (reverse).
| Results |
|---|
|
|
|---|
|
|
Alone, prd
disco had no effect on 1.28
transcript distribution (Fig.
1D); transcripts accumulated as in wild type embryos
(Fig. 1C). prd
Dfd, however, caused significant accumulation of
1.28 transcripts in the posterior labial epidermis
(Fig. 1E), and we noted slight
accumulation in a few cells near the posterior edge of the
prd
Dfd segments (not visible in the image). That DFD
induced 1.28 expression in the labial segment was expected as
disco is normally expressed in many labial cells
(Lee et al., 1991
;
Mahaffey et al., 2001
) and
ectopic DFD transforms the labial segment toward a maxillary identity
(Kuziora and McGinnis, 1988
).
The weak expression in the trunk segments was unexpected, but was explained by
the fact that ectopic DFD activated disco (see below). Co-expression
of disco and Dfd caused significant accumulation of
1.28 transcripts in the posterior epidermis of every other trunk
segment (Fig. 1F) overlapping
with prd-Gal4 expression. We conclude from these experiments that the
presence of DISCO makes the trunk segments competent to activate DFD target
genes, and allows ectopic DFD to function in the presence of the trunk
specification system.
The weak expression of 1.28 in prd
Dfd
embryos did not coincide with disco expression in the Keilin's Organ
precursors, but was more lateral and posterior. Because all of our other
results indicated that DFD and DISCO are required together, we examined
disco expression in prd
Dfd and
arm
Dfd embryos. In both cases, ectopic DFD activated
disco (Fig. 3A,C);
this induction is likely to be responsible for the low level of 1.28
RNA accumulation in UAS-Dfd embryos. Our previous results indicate
that DFD is not required for disco expression in the gnathal segments
(Mahaffey et al., 2001
), so we
suspect this DFD induction of disco reflects that DFD can modulate
disco expression.
TSH represses DISCO during normal trunk segment development
Because, in an otherwise normal embryo, ectopic DFD causes only a limited
trunk to maxillary transformation, and as disco is required for this,
we suspected that co-expression of disco and Dfd should
yield a more complete transformation. Surprisingly, this was not the case. On
average, more cirri developed in the trunk segments upon co-activation with
arm-Gal4, but not with prd-Gal4 (data not shown). This
suggested that DISCO and DFD were not sufficient to induce a stronger
transformation; either something else was needed, or the trunk to maxillary
transformation was inhibited in a manner that could not be overcome by
additional DISCO. Components of the trunk specification program, for example
TSH (Fasano et al., 1991
;
Röder et al., 1992
), are
likely inhibitors, so we examined the effect of ectopic DFD and DISCO in
tsh mutant embryos.
Röder et al. (Röder et al.,
1992
) reported that the trunk segments are partially transformed
toward head identity in embryos lacking TSH, as indicated by ectopic sclerotic
material in the trunk segments, and changes in the trunk peripheral nervous
system. Though we occasionally observed small patches of sclerotic material in
the cuticle of homozygous tsh8 mutant embryos, we never
observed mouth hook-like structures (Fig.
2B). Surprisingly, ectopic DFD caused a stronger transformation
when embryos lacked TSH (Fig.
2D) than in otherwise normal embryos
(Fig. 2C). Cirri and
sclerotized material appeared in most Dfd-expressing segments, and
the sclerotized material more closely resembled normal maxillary mouth hooks.
Co-expression of disco and Dfd in embryos lacking TSH
produced an even more consistent transformation
(Fig. 2E,F), where nearly every
expressing segment produced cirri and well-formed mouth hooks. We note that no
mouthpart structures were produced in embryos lacking disco and
disco-r and tsh, regardless of whether or not ectopic DFD
was present (data not shown).
|
Dfd embryos (see
above), with one notable exception. disco mRNA was still present in
the Keilin's Organ primordia of embryos ectopically expressing Dfd,
but not in tsh mutants (compare
Fig. 3B, tsh mutant,
with Fig. 3C, ectopic
Dfd).
To further test the repression of disco by TSH, we ubiquitously
expressed tsh using the arm-Gal4 driver so that TSH would
accumulate in all of the gnathal cells. As shown in
Fig. 3E,F, TSH altered normal
gnathal expression of disco. At the beginning of germband retraction,
correlating with the onset of arm-Gal4 expression, disco
mRNA levels decreased (Fig. 3E)
until, by the end of germband retraction, the normal gnathal distribution was
no longer detectable (Fig. 3F).
Interestingly, disco mRNA was not completely eliminated. In each
gnathal lobe, disco mRNA accumulated in a small cluster of cells
(Fig. 3F) resembling that
observed in the thoracic Keilin's Organ precursors
(Fig. 3A,D); indeed, ectopic
TSH transforms the labial sense organ into one resembling a Keilin's Organ
(de Zulueta et al., 1994
).
We conclude from the above observations that DISCO and DFD can override the
trunk specification system to generate maxillary identity. One manner in which
this could occur is for our manipulations to repress expression of the trunk
specification system. We noted that ectopic disco expression did not
repress tsh transcription, in contrast to the reverse described above
(data not shown). Still, repression could occur through the trunk
HOM-C genes, and in this regard, it is worth noting that lack of the
trunk HOM-C input does give rise to sclerotized material in the trunk segments
(Struhl, 1983
,
Sato et al., 1985
). However,
our manipulations did not alter the normal distribution of trunk HOM-C
proteins (Fig. 4). We examined
the distribution of several trunk HOM-C proteins in embryos of all
manipulations used in this study, using the arm-Gal4 driver to have
the broadest possible effect. We found no indication that HOM-C protein
accumulation was significantly altered, other than because of the grossly
aberrant morphology of later embryos ectopically expressing DISCO. Even then,
HOM-C proteins were distributed in the proper register (data not shown). We
also examined Labial distribution, as embryos lacking tsh were
reported to accumulate Labial in small clusters of cells in the trunk.
However, we could not detect ectopic labial expression in our
tsh8 embryos. We conclude that the combination of DISCO
and DFD can override the trunk identity system, redirecting development toward
maxillary identity. Clearly, this was more complete when the trunk
specification system is compromised, as it is when TSH is absent.
|
disco embryos with anti-Engrailed/Invected
(EN) antibodies (DiNardo et al.,
1985
disco embryos, the EN-expressing cells and a few
cells anterior to these did not extend toward the dorsal midline
(Fig. 5B). Only those cells in
the anterior half of the affected segments - those cells not expressing
prd
disco - completed dorsal closure. We noted that the
lack of dorsal closure caused the altered trunk segments to acquire a shape
similar to the gnathal lobes.
|
disco embryos, this continuous line of pnr
mRNA accumulation was broken (Fig.
5D). Double-labeling with EN antibodies confirmed that the gaps in
pnr mRNA accumulation coincided with the cells expressing
prd
disco (data not shown). Repression of pnr
was transient. Later in development, as ectopic disco mRNA faded
(late stage 12 to early 13), pnr mRNA was detected in the dorsal
limits of the affected segments (data not shown), but apparently, this was too
late to rescue dorsal closure. At this time, we do not know whether repression
of pnr is direct.
Dorsal development is very limited in the gnathal segments, where
disco is normally expressed. The dorsal ridge is a reduced
segment-like structure derived from the gnathal segments
(Fig. 5E), and it is the
anteriormost structure able to adopt a dorsal fate
(Rogers and Kaufman, 1996
).
Many of the cells that will give rise to the dorsal ridge appear as de novo
EN-expressing cells along the dorsal edge of the maxillary and labial lobes
(Rogers and Kaufman, 1996
).
Though disco is expressed in many gnathal cells
(Lee et al., 1991
;
Mahaffey et al., 2001
), it is
not expressed in these dorsal ridge precursors. In fact, the dorsal ridge was
quite reduced or eliminated when disco was ectopically expressed in
these cells (Fig. 5F). This
prompted us to ask whether dorsal ridge development was altered in embryos
lacking disco and disco-r, and, indeed, this appeared to be
the case. In male embryos carrying Df(1)XR14, the dorsal ridge was
enlarged and joined with the labial, and sometimes maxillary, lobes
(Fig. 5G). We conclude that
normal disco expression is needed to limit gnathal contribution to
the dorsal ridge.
Ectopic disco expression disrupted other aspects of trunk
development. Previously, we showed that DISCO repressed denticle formation
(Robertson et al., 2002
), and
now we find that other aspects of trunk development are also disrupted. The
dorsal trachea and oenocytes were absent
(Fig. 6A,B), as indicated by
lack of spalt-major (salm) expression, which is required for
formation of these structures
(Kühnlein et al., 1994
).
We note that other regions of salm expression were unaffected. The
trunk peripheral nervous system was also altered by ectopic disco
expression. Visualized using anti-22c10/Futsch antibodies
(Hummel et al., 2000
), there
is a characteristic pattern of sensory neurons produced in each trunk segment
(Campos-Ortega and Hartenstein,
1997
), and ectopic DISCO altered these in several ways
(Fig. 6C,D). The chordotonal
organs were absent as were other sensory structures. Ectopic DISCO did not
simply eliminate neural structures. Sensory neurons formed, but they did not
resemble those normally found in the trunk. We are uncertain of their
identity, but suggest that they have a mixed gnathal/trunk identity as both
DISCO and TSH are present in these segments. Unknowingly, the role of DISCO in
the absence of TSH has been examined previously, while examining tsh
mutants. As we described above, disco and disco-r are
activated in the trunk of embryos lacking TSH, and Röder et al.
(Röder et al., 1992
)
concluded that the trunk neurons can acquire a gnathal identity in these
embryos.
|
|
| Discussion |
|---|
|
|
|---|
We have extended these studies and show that: (1) DFD can only direct maxillary developmental when DISCO and/or DISCO-R are present; (2) TSH represses disco (and disco-r), helping to distinguish between trunk and gnathal segment types, and thereby establishing domains for appropriate HOM-C protein function; and (3) when ectopically expressed in the trunk, DISCO represses trunk development and may transform these segments towards a gnathal segment type.
Though HOM-C genes have a clear role in establishing segment identities, ectopic expression often has only a limited effect. Our data indicate that, for DFD, this restriction arises because of the limited distribution of DISCO in the trunk segments. There are two important conclusions from these observations. First, the spatial distribution of DISCO establishes where cells can respond to DFD, and this is probably true for SCR as well. Cells expressing disco develop a maxillary identity when provided with DFD, even though this may not have been their original HOM-C-specified fate. This highlights the second point: the combination of DISCO and DFD overrides normal trunk patterning, without altering expression of tsh and trunk HOM-C genes. As with the maxillary segment, identity is lost in the mandibular and labial segments when embryos lack disco and disco-r. This indicates that DISCO and DISCO-R may have similar roles in all gnathal segments. That co-expression of DISCO and SCR in the trunk activates the SCR gnathal target gene pb strengthens this conclusion. Therefore, we propose that DISCO defines the gnathal region, and establishes where the gnathal HOM-C proteins DFD and SCR can function.
Alone, ectopic DISCO significantly alters development, indicating that DISCO has a morphogenetic ability, separate from gnathal HOM-C input. As DISCO is required for normal gnathal development, we suspect that disco specifies a general gnathal segment type. Definitive identification is difficult because of the lack of morphological or molecular markers that denote a general gnathal segment type. Yet, there is support for the conclusion that disco expression establishes a gnathal segment type. Ectopic DISCO can, to some extent, override the trunk specification system and repress trunk development (repressing denticles, oenocytes and trachea). Furthermore, ectopic DISCO blocks dorsal closure, which is similar to the role of endogenous DISCO in the gnathal segments.
Perhaps the most compelling evidence that DISCO specifies a gnathal segment
type comes from the observation that disco is activated in the trunk
segments when embryos lack TSH. The identity of the trunk segments in
tsh mutant embryos is somewhat uncertain. Fasano et al.
(Fasano et al., 1991
) and
Röder et al. (Röder et
al.,1992
) suggested that some aspects of the tsh
phenotype indicate the trunk segments acquire gnathal characteristics; for
example, the ventral neural clusters appear to be transformed to a
gnathal-like identity (as mentioned above). Röder et al. state that
`Mutations in the tsh gene can therefore be interpreted in two ways;
either they partially transform the trunk segments into a gnathal-like
identity, and in particular the prothoracic segment into a labial one, or they
cause a non-specific change in segmental identity perhaps due to cell death';
however, they also report that the loss of tsh and the trunk
HOM-C genes may transform the trunk cuticle toward anterior head
cuticle. Again, the difficulty in assigning an identity is due to the lack of
a readily discernable gnathal morphological or molecular marker. We present
evidence that disco and disco-r are reliable molecular
markers for gnathal identity, and we show that disco mRNA is present
in the ventral and lateral regions of the trunk segments in tsh
mutant embryos. This expression of disco coincides, spatially, with
the region of the trunk that is transformed in tsh mutant embryos.
UAS-driven disco does mimic some aspects of tsh mutants,
denticles are reduced and the ventral chordotonal neurons do not develop, but
as TSH is still present, the transformation caused by ectopic disco
may be incomplete. Finally, DFD cannot induce maxillary structures, even in
tsh mutants, when disco and disco-r are absent.
This reinforces the role for DISCO in establishing gnathal identity, and
indicates that the ectopic DISCO present in embryos lacking TSH is functional.
Therefore, considering these arguments, we propose that DISCO and DISCO-R
establish the gnathal region of the Drosophila embryo, and in this
regard, they function similarly to TSH, which specifies the trunk region.
There are other parallels between DISCO/DISCO-R and TSH. They are
regionally expressed zinc-finger transcription factors, and they are required
in parallel with the HOM-C proteins for proper segment identity. Furthermore,
the distribution of these proteins establishes domains in which specific HOM-C
proteins can properly direct embryonic development. Our data reveal a
regulatory relationship between TSH and disco (and disco-r),
indicating they are part of an interacting network that helps regionalize the
Drosophila embryo. The HOM-C proteins then establish specific
segmental identities in the appropriate region. A schematic of this model is
presented in Fig. 8. In the
trunk segments, TSH, along with the trunk HOM-C proteins, specifies the trunk
segment characteristics, in part by repressing disco and, thereby,
preventing gnathal characteristics from arising in the trunk segments. Our
model requires that tsh expression be limited to the trunk segments,
and we propose this is accomplished by another C2H2 zinc-finger protein, SALM.
Röder et al. (Röder et al.,
1992
) demonstrated that tsh expression expands into the
posterior gnathal and posterior abdominal segments in embryos lacking SALM.
Therefore, SALM establishes the boundary between the TSH and DISCO domains. We
stress that, at this time, we do not know what parts of this regulation are
direct. Interestingly, other zinc-finger transcription factors are responsible
for positioning salm expression (Kühnlein et al., 1997), so that
a more extensive hierarchy of zinc-finger transcription factors leads to
regionalization, eventually establishing the domains of HOM-C protein
function. We also note that TSH has other roles than just repressing
disco. TSH actively establishes the trunk region, just as DISCO does
the gnathal. It is also noteworthy that ectopic TSH activated disco
in the labial sense organ primordia, leading to a Keilin's Organs fate, as
occurs in the thoracic segments. Therefore, for unknown reasons, TSH changes
from a repressor of disco to an activator in these cells. This
observation highlights the complex interplay between factors like TSH and
DISCO, and it will be interesting to determine what causes these opposing
roles.
|
Finally, we are left with the question of whether or not factors such as
DISCO and TSH establish head/trunk domains and delimit HOM-C protein function
only in the Drosophila embryo, in all stages of Drosophila
or in other animals as well. Though this remains to be tested experimentally,
there are indications that this may be a general mechanism. Homologues of
these zinc-finger genes are found in vertebrates and in other invertebrates
(Caubit et al., 2000
;
Knight and Shimeld, 2001
),
and, although only limited data are currently available
(Caubit et al., 2000
) (M. K.
Patel and J.W.M., unpublished), expression data indicate that these genes may
have similar roles to their Drosophila counterparts during embryonic
patterning. In an informative experiment by Brown et al.
(Brown et al., 1999
), they
expressed the Tribolium Dfd homologue, Tc-Dfd, in
Drosophila embryos lacking the endogenous Dfd gene and
showed that persistent expression of Tc-Dfd could rescue maxillary
development. Though, at present, it is not known whether or not a direct
interaction is required between DISCO and DFD, this result would indicate that
the Tribolium DFD protein can fulfill the same roles as the
Drosophila protein, and, therefore, it must be able to function with
the Drosophila regionalization system. In any case, it will be
important to investigate and interpret the role of the regionalizing genes as
they relate to development and evolution of body pattern in other animals, and
to ask whether a similar network is involved in patterning all animals.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Akam, M. (1995). Hox genes and the evolution of
diverse body plans. Philos. Trans. R. Soc. Lond. B. Biol.
Sci. 349,313
-319.[CrossRef][Medline]
Biggin, M. D. and McGinnis, W. (1997).
Regulation of segmentation and segmental identity by Drosophila homeoproteins:
the role of DNA binding in functional activity and specificity.
Development 124,4425
-4433.[Abstract]
Brown S., Holtzman, S., Kaufman, T. and Denell, R.
(1999). Characterization of the Tribolium Deformed ortholog and
its ability to directly regulate Deformed target genes in the rescue of a
Drosophila Deformed null mutant. Dev. Genes Evol.
209,389
-398.[CrossRef][Medline]
Campos-Ortega, J. A. and Hartenstein, V.
(1997). The Embryonic Development of
Drosophila melanogaster, 2nd edn. New York:
Springer-Verlag.
Carr, A. and Biggin, M. D. (1999). A comparison
of in vivo and in vitro DNA-binding specificities suggests a new model for
homeoprotein DNA binding in Drosophila embryos. EMBO
J. 18,1598
-1608.[CrossRef][Medline]
Castelli-Gair, J. (1998). The lines gene of
Drosophila is required for specific functions of the Abdominal-B HOX protein.
Development 125,1269
-1274.[Abstract]
Caubit, X., Core, N., Boned, A., Kerridge, S., Djabali, M. and
Fasano, L. (2000). Vertebrate orthologues of the Drosophila
region-specific patterning gene teashirt. Mech. Dev.
91,445
-448.[CrossRef][Medline]
Chan, S. K., Jaffe, L., Capovilla, M., Botas, J. and Mann, R.
S. (1994). The DNA binding specificity of Ultrabithorax is
modulated by cooperative interactions with extradenticle, another
homeoprotein. Cell 78,603
-615.[CrossRef][Medline]
de Zulueta, P., Alexandre, E., Jacq, B. and Kerridge, S.
(1994). Homeotic complex and teashirt genes co-operate to
establish trunk segmental identities in Drosophila.
Development 120,2287
-2296.[Abstract]
DiNardo, S., Kuner, J. M., Theis, J. and O'Farrell, P. H.
(1985). Development of embryonic pattern in D. melanogaster as
revealed by accumulation of the nuclear engrailed protein.
Cell 43,59
-69.[CrossRef][Medline]
Ekker, S. C., Jackson, D. G., von Kessler, D. P., Sun, B. I.,
Young, K. E. and Beachy, P. A. (1994). The degree of
variation in DNA sequence recognition among four Drosophila homeotic proteins.
EMBO J. 13,3551
-3560.[Medline]
Fasano, L., Röder, L., Core, N., Alexandre, E., Vola, C.,
Jacq, B. and Kerridge, S. (1991). The gene teashirt is
required for the development of Drosophila embryonic trunk segments and
encodes a protein with widely spaced zinc finger motifs.
Cell 64,63
-79.[CrossRef][Medline]
Gonzalez-Reyes, A., Macias, A. and Morata, G.
(1992). Autocatalysis and phenotypic expression of Drosophila
homeotic gene Deformed: its dependence on polarity and homeotic gene function.
Development 116,1059
-1068.[Abstract]
Herranz, H. and Morata, G. (2001). The
functions of pannier during Drosophila embryogenesis.
Development 128,4837
-4846.
Hoey, T. and Levine, M. (1988). Divergent homeo
box proteins recognize similar DNA sequences in Drosophila.
Nature 332,858
-861.[CrossRef][Medline]
Hummel, T., Krukkert, K., Roos, J., Davis, G. and Klambt, C.
(2000). Drosophila Futsch/22C10 is a MAP1B-like protein required
for dendritic and axonal development. Neuron
26,357
-370.[CrossRef][Medline]
Knight, R. D. and Shimeld, S. M. (2001).
Identification of conserved C2H2 zinc-finger gene families in the Bilateria.
Genome Biol. 2,1
-8.
Kühnlein, R. P., Frommer, G., Friedrich, M.,
Gonzalez-Gaitan, M., Weber, A., Wagner-Bernholz, J. F., Gehring, W. J.,
Jackle, H. and Schuh, R. (1994). spalt encodes an
evolutionarily conserved zinc finger protein of novel structure which provides
homeotic gene function in the head and tail region of the Drosophila embryo.
EMBO J. 13,168
-179.[Medline]
Kuziora, M. A. and McGinnis, W. (1988).
Autoregulation of a Drosophila homeotic selector gene.
Cell 55,477
-485.[CrossRef][Medline]
Lee, K. J., Freeman, M. and Steller, H. (1991).
Expression of the disconnected gene during development of Drosophila
melanogaster. EMBO J.
10,817
-826.[Medline]
Li, X., Murre, C. and McGinnis, W. (1999).
Activity regulation of a Hox protein and a role for the homeodomain in
inhibiting transcriptional activation. EMBO J.
18,198
-211.[CrossRef][Medline]
Mahaffey, J. W., Griswold, C. M. and Cao, Q. M.
(2001). The Drosophila genes disconnected and disco-related are
redundant with respect to larval head development and accumulation of mRNAs
from deformed target genes. Genetics
157,225
-236.
Mahaffey, J. W., Jones, D. F., Hickel, J. A. and Griswold, C.
M. (1993). Identification and characterization of a gene
activated by the deformed homeoprotein. Development
118,203
-214.[Abstract]
Mann, R. S. and Morata, G. (2000). The
developmental and molecular biology of genes that subdivide the body of
Drosophila. Annu. Rev. Cell Dev. Biol.
16,243
-271.[CrossRef][Medline]
McGinnis, W. and Krumlauf, R. (1992). Homeobox
genes and axial patterning. Cell
68,283
-302.[CrossRef][Medline]
Mohler, J., Mahaffey, J. W., Deutsch, E. and Vani, K.
(1995). Control of Drosophila head segment identity by the bZIP
homeotic gene cnc. Development
121,237
-247.[Abstract]
Pederson, J. A., LaFollette, J. W., Gross, C, Veraksa, A.,
McGinnis, W. and Mahaffey, J. W. (2000). Regulation by
homeoproteins: a comparison of deformed-responsive elements.
Genetics 156,677
-686.
Pederson, J. D., Kiehart, D. P. and Mahaffey, J. W.
(1996). The role of HOM-C genes in segmental transformations:
reexamination of the Drosophila Sex combs reduced embryonic phenotype.
Dev. Biol. 180,131
-142.[CrossRef][Medline]
Peifer, M. and Wieschaus, E. (1990). Mutations
in the Drosophila gene extradenticle affect the way specific homeodomain
proteins regulate segmental identity. Genes Dev.
4,1209
-1223.
Rusch, D. B. and Kaufman, T. C. (2000).
Regulation of proboscipedia in Drosophila by homeotic selector genes.
Genetics 56,183
-194.
Robertson, L. K., Dey, B. K., Campos, A. R. and Mahaffey, J.
W. (2002). Expression of the Drosophila gene disconnected
using the UAS/GAL4 system. Genesis
34,103
-106.[CrossRef][Medline]
Röder, L., Vola, C. and Kerridge, S.
(1992). The role of the teashirt gene in trunk segmental identity
in Drosophila. Development
115,1017
-1033.[Abstract]
Rogers, B. T. and Kaufman, T. C. (1996).
Structure of the insect head as revealed by the EN protein pattern in
developing embryos. Development
122,3419
-3432.[Abstract]
Sanson, B., White, P. and Vincent, J. P.
(1996). Uncoupling cadherin-based adhesion from wingless
signalling in Drosophila. Nature
383,627
-630.[CrossRef][Medline]
Sato, T., Hayes, P. H. and Denell, R. E.
(1985). Homeosis in Drosophila: roles and spatial patterns of
expression of the Antennapedia and Sex combs reduced loci in
embryogenesis. Dev. Biol.
111,171
-192.[CrossRef]
Steller, H., Fischbach, K. F. and Rubin, G. M.
(1987). Disconnected: a locus required for neuronal pathway
formation in the visual system of Drosophila. Cell
50,1139
-1153.[CrossRef][Medline]
Struhl, G. (1983). Role of the esc+ gene
product in ensuring the selective expression of segment-specific homeotic
genes in Drosophila. J. Embryol. Exp. Morphol.
76,297
-331.[Medline]
Walter, J., Dever, C. A. and Biggin, M. D.
(1994). Two homeo domain proteins bind with similar specificity
to a wide range of DNA sites in Drosophila embryos. Genes
Dev. 8,1678
-1692.
Yoffe, K. B., Manoukian, A. S., Wilder, E. L., Brand, A. H. and
Perrimon, N. (1995). Evidence for engrailed-independent
wingless autoregulation in Drosophila. Dev. Biol.
170,636
-650.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. Vanhoutteghem, A. Maciejewski-Duval, C. Bouche, B. Delhomme, F. Herve, F. Daubigney, G. Soubigou, M. Araki, K. Araki, K.-i. Yamamura, et al. Basonuclin 2 has a function in the multiplication of embryonic craniofacial mesenchymal cells and is orthologous to disco proteins PNAS, August 25, 2009; 106(34): 14432 - 14437. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Sanders, M. Patel, and J. W. Mahaffey The Drosophila Gap Gene giant Has an Anterior Segment Identity Function Mediated Through disconnected and teashirt Genetics, May 1, 2008; 179(1): 441 - 453. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||