|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 19 May 2004
doi: 10.1242/dev.01156
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institut de Génétique et de Biologie Moléculaire et Cellulaire, UMR 7104, CNRS/INSERM/ULP, 1 rue Laurent Fries, BP10142, CU de Strasbourg, 67404, Illkirch Cedex, France
* Author for correspondence (e-mail: thisse{at}igbmc.u-strasbg.fr)
Accepted 27 February 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Zebrafish, Dorsoventral patterning, Fgf, Bmp, Sprouty 2
| Introduction |
|---|
|
|
|---|
As soon as the zygotic genome becomes activated, the expression of the
genes encoding the DV morphogen, bmp2b and bmp7, is
initiated throughout the embryo. However, as development proceeds, the
expression of bmp2b and bmp7 becomes very rapidly restricted
to the ventral part of the embryo where Bmp proteins actually specify ventral
cell fates. This restriction of Bmp gene expression occurs well before the
beginning of gastrulation and is therefore one of the first major
manifestations of zygotic DV patterning. Surprisingly, relatively little
attention has been devoted to the functional relevance of the mechanisms that
act to ensure the early confinement of Bmp gene expression to the ventral side
of the embryo. The homeobox transcription factor bozozok (Boz) is expressed in
the dorsal-most cells of the marginal blastoderm where it directly represses
bmp2b transcription (Koos and Ho,
1997
; Leung et al.,
2003
). Considering its very small domain of expression, Boz can
however clearly not by itself be responsible for the progressive
downregulation of bmp2b expression throughout the entire dorsal half
of the embryo.
We show that the early restriction of Bmp gene expression is independent of the well-known Bmp antagonists chordin (Chd) and noggin (Nog) that bind Bmp proteins and prevent them from interacting with Bmp receptors. We show that the early restriction of Bmp gene expression depends on fibroblast growth factor (Fgf) activity that progressively spreads from the dorsal side of the embryo, causing Bmp gene expression to recede. In accordance with a role of Fgf/Ras/Mapk signalling in the DV patterning of the early zebrafish embryo, activation of this pathway abolishes expression of the ventralising Bmp genes, causing thereby a dorsalisation of the embryo. Most importantly, we show that inhibition of Fgf signalling causes Bmp gene expression to expand dorsalwards, leading to a severe expansion of ventral cell fates. Through the analysis of the genetic interactions between fgf8 and chd, we further demonstrate that these two factors cooperate in vivo to ensure the proper DV patterning of the embryo. Our study therefore shows that in addition to inhibition of Bmp protein activity by Bmp-binding antagonists, Fgf-mediated restriction of Bmp genes expression is essential for the establishment of the zebrafish DV axis.
| Materials and methods |
|---|
|
|
|---|
RNA microinjection
The zebrafish Spry2 open reading frame was inserted into the
BamHI/XhoI sites of pCS2+. Through PCR-based mutagenesis, a
Spry2 construct was generated in which the target sequence of the anti-spry2
morpholino (ATGGAGACGAGAACTCAAAATGGCG) was converted into
ATGGAGACCCGTACTGAAAATGGCG, rendering the cDNA insensible to morpholino-based
translational inhibition. The open reading frames of Fgf24 and Erm1 were
cloned into the EcoRI/XbaI sites and Pea3 into the
BamHI/XbaI sites of pCS2+. For the DN-Fgfr1 construct, the
extracellular and transmembrane parts of the zebrafish Fgfr1 were cloned in
front of a stop codon into the EcoRI/XhoI sites of pCS2+
vector. For sense RNA synthesis, Fgf24-, Pea3-, Erm1- and DN-Fgfr1-pCS2+ were
linearised using NotI; Spry2-pCS2+ was linearised using
KpnI. Constructs for microinjection of chordin
(Miller-Bertoglio et al.,
1999a
), noggin 1 (Nog1)
(Fürthauer et al., 1999
),
Fgf8 (Fürthauer et al.,
1997
), Fgf3 (Fürthauer et
al., 2001
), DN-Ras (Whitman
and Melton, 1992
) and mouse Spry2Y55F
(Hanafusa et al., 2002
) have
been previously described. All injected RNAs have been synthesised with the
mMessage Machine SP6 kit (Ambion). Injection was performed either into the
yolk at the one-cell stage or in an animal blastomere at the 64-cell stage.
Embryos were cultured at 28.5°C in Danieau 0.3x supplemented with 1%
Penicillin/Streptomycin (Gibco, 15140-122). Except when specified otherwise,
embryos were injected with the following doses of RNA: fgf3, 25 pg;
fgf8, 0.2 pg; fgf24, 0.1 pg; nog1, 25 pg;
chd, 200 pg; erm1, 100 pg; pea3, 100 pg;
spry2, 25 pg; DN-Spry2, 200 pg; DN-Fgfr1, 500 pg; DN-Ras, 300 pg.
Morpholino injections
Antisense morpholino oligonucleotides (GeneTools, LLC) designed against
chd (5'-ATCCACAGCAGCCCCTCCATCATCC-3', 0.1 pmol),
spry2 (5'-CGCCATTTTGAGTTCTCGTCTCCAT-3', 4 pmol) and
fgf8 (5'-GAGTCTCATGTTTATAGCCTCAGTA-3', 0.4 pmol) were
injected into two-cell stage embryos. Morpholinos were resuspended in 1x
Danieau.
Whole-mount in situ hybridisation
For in situ hybridisation, the spry2 open reading frame was inserted into
the BamHI/XhoI sites of pBSKII+, the vector linearised with
BamHI and antisense RNA transcribed with T7 RNA polymerase.
bmp2b, cyp26a, fgf8, foxi, ved and zic2 were isolated in the
course of a large-scale in situ hybridisation screen
(http://zfin.org)
and antisense RNA made through NotI linearisation and T7
transcription. The other clones used in this study have been previously
described: bmp7 (Schmid et al.,
2000
), chd
(Miller-Bertoglio et al.,
1999a
), draculin
(Herbomel et al., 1999
),
en3 (Ekker et al.,
1992
), fgf3
(Fürthauer et al., 2001
),
fgf24 (Draper et al.,
2003
), goosecoid
(Thisse et al., 1994
),
hemoglobin (Chan et al.,
1997
), nog1
(Fürthauer et al., 1999
),
otx2 (Mercier et al.,
1995
), shh (Krauss et
al., 1993
), spry4
(Fürthauer et al., 2001
)
and vhnf1 (Thisse and Thisse,
1999
). All whole-mount in situ hybridisations were performed as
described by Thisse and Thisse
(http://zfin.org/zf_info/zfbook/chapt9/9.82.html).
For two-colour in situ hybridisation, embryos were incubated with a mixture of one digoxigenin- and one fluorescein-labelled probe. The digoxigenin-labelled probe was visualised using the standard in situ hybridisation protocol. The staining reaction was arrested by three 5 minute washes in 0.1 M glycine buffer (pH 2.2), 0.1% Tween20. After overnight incubation with a 1:5000 dilution of anti-fluorescein antibody (Roche, Ref. 1426338) the fluorescein-labelled probe was visualised using the ELF in situ hybridisation kit (Molecular Probes, Ref. E6604; used according to manufacturers instructions, except that the substrate component was diluted 80 times).
Pharmacological inhibition of Fgf signalling
To inhibit Fgfr activity, embryos were treated with SU5402
(Mohammadi et al., 1997
)
(Calbiochem) at 40 µM in 0.3x Danieau at 28.5°C in the dark.
| Results |
|---|
|
|
|---|
|
In Xenopus, the analysis of the bmp4 promoter reveals
that it contains Bmp-responsive elements, suggesting that bmp4
expression is subject to positive autoregulation
(Metz et al., 1998
).
Therefore, the progressive dorsal clearance of Bmp gene expression could be
due to the action of dorsally secreted Bmp antagonists, such as Chd, which may
progressively shut down Bmp gene expression through interference with the
positive Bmp gene feedback loop. However, several observations argue strongly
against such a model for the dorsal clearance of Bmp gene expression at
blastula stages. First, the progressive ventral restriction of Bmp gene
expression at blastula stages is unaffected in embryos in which Chd function
has been compromised through the injection of anti-Chd morpholinos
(Fig. 1G) or the inactivating
chordino mutation (not shown)
(Schulte-Merker et al., 1997
).
Second, in the converse experiment, a Chd overexpression through mRNA
microinjection, the expression pattern of bmp2b at early blastula
stage is also unaffected (Fig.
1H). Only later, at gastrula stage, did embryos injected with
chd RNA display a loss of Bmp gene expression from the ventral
blastoderm (not shown). These findings show that Chd is not involved in the
progressive restriction of Bmp gene expression to the ventral side of the
zebrafish blastula. Similarly, overexpression of the Bmp antagonist Nog1 does
not affect blastula stage bmp2b expression
(Fig. 2F). Finally, blastula
stage Bmp gene expression patterns are unaffected by the loss of Bmp2b or Bmp7
function in swirl/bmp2b and snailhouse/bmp7 mutant embryos
(not shown). Loss of Bmp gene transcripts in the ventral non-marginal
blastoderm is observed only later, after the beginning of gastrulation
(Schmid et al., 2000
). All
these observations argue strongly against a role for Bmp gene-autoregulation
in the dorsal clearance of Bmp gene expression at the blastula stage.
|
Analysis of a large set of gene expression patterns within the course of a
whole-mount in situ hybridisation screen has allowed us to identify several
Fgfs as candidate factors that could cause the progressive dorsal clearance of
Bmp gene expression. Our analysis of the early expression pattern of
fgf3 (Kiefer et al.,
1996
), fgf8
(Fürthauer et al., 1997
)
and fgf24 (Draper et al.,
2003
) reveals that these genes are first expressed at the dorsal
margin of the embryo at early blastula stage. Then, their expression
progressively spreads from the dorsal side of the blastula margin towards
ventral territories. This dynamic spreading of Fgf expression is concomitant
with the disappearance of Bmp gene transcripts from dorsal cells and its
restriction to the ventral part of the embryo. Transcripts for fgf8
appear first at the dorsal margin (Fig.
1J) when we observe the beginning of Bmp gene clearance from the
dorsal side of the embryo. Shortly afterwards, the expression of fgf3
and fgf24 becomes detectable in dorsal marginal blastomeres. As
development proceeds, the expression domains of fgf3 and
fgf24 progressively expand ventrally to form a DV gradient at the
margin of the zebrafish blastula (Fig.
1K,L). The DV expression gradient of the Fgf-target gene
sprouty 4 (spry4)
(Fürthauer et al., 2001
)
further suggests the existence of a DV gradient of Fgf activity at blastula
stage (Fig. 1M-O). Taken
together, our observations reveal a temporal coincidence between the
progressive ventral restriction of Bmp gene expression and the ventralwards
expansion of Fgf activity. The observation that the expression of both
fgf3 and fgf24 occurs along a DV gradient at the margin of
the zebrafish blastula suggests that these factors could be implicated in the
establishment of DV patterning.
Fgf signalling affects pre-gastrula stage Bmp gene expression
In agreement with the hypothesis of an implication of Fgf signalling in the
DV patterning of the zebrafish embryo, we found that overexpression of fgf3
(Fig. 2C; 57/57 embryos), fgf24
(Fig. 2D; 62/62 embryos) and
fgf8 (Fig. 4P; 75/76 embryos)
dorsalise the embryo, which adopts a characteristic elongated shape. This
phenotype is similar to the one resulting from inactivation of Bmps
(Kishimoto et al., 1997
;
Dick et al., 2000
;
Schmid et al., 2000
) or
overexpression of the Bmp-antagonist Nog1
(Fig. 2B; 38/39). This strongly
suggests that Fgfs affect the DV patterning by interfering with Bmp
signalling.
|
A previous study revealed that an fgf3-mediated expansion of
dorsolateral neurectodermal derivatives in the gastrula embryo depends on Chd
function (Koshida et al.,
2002
). At early blastula, we found that Bmp gene expression is
unaffected by Chd overexpression (Fig.
1H), suggesting that the inhibitory action of Fgfs on early Bmp
gene expression is independent of Chd. To confirm this hypothesis, we showed
that fgf8 RNA injection in chordin morphants (mo-chd) or
chordino mutants (not shown) causes severe dorsalisation
(Fig. 2O, 79/87 embryos) and
loss of early ventral bmp2b expression
(Fig. 2P, 56/56 embryos) in the
absence of Chd function.
The dorsalising activity of Fgf is mediated through the activation of the
Ras/Map-kinase signal transduction cascade
(Fürthauer et al., 2002
).
The downstream components of this signalling cascade are transcription factors
belonging to the Ets family (Wasylyk et
al., 1998
). As targets of the Ras/Map-kinase signalling pathway,
Ets proteins function as crucial nuclear integrators of this signalling
cascade. Among the members of this family of transcription factors, two of
them, Erm1 and Pea3 belong to the Fgf8 synexpression group and have been shown
to respond to Fgf8, suggesting that they may be transcriptional mediators of
Fgf signalling (Raible and Brand,
2001
; Roehl and
Nüsslein-Volhard, 2001
). In accordance with this, localised
overexpression of either erm1 or pea3 RNA causes ectopic
expression of the Fgf target-gene spry4
(Fig. 2Q, 51/58 embryos;
Fig. 2S, 48/53 embryos compared
with spry4 expression in wild-type embryo,
Fig. 1O). Misexpression of
these transcription factors leads also to the local inhibition of
bmp2b expression (Fig.
2R, 50/54 embryos; Fig.
2T, 57/62 embryos compared with bmp2b expression in
wild-type embryo, Fig. 2E),
demonstrating that these effectors of the Fgf signalling pathway are able to
negatively regulate Bmp gene expression. Nevertheless, Erm1 and Pea3 are known
to function as transcriptional activators
(Sharrocks, 2001
), suggesting
that, although they are the mediators of the Fgf signalling pathway, they are
not direct repressors of Bmp gene transcription.
Spry2 is a novel member of the Fgf8 synexpression group
If Fgfs are implicated in DV patterning, inactivation of their
physiological antagonists should cause alterations of the DV organisation
similar to Fgf overexpression. We found previously that Spry4 and Sef act as
feedback inhibitors of Fgf signalling
(Fürthauer et al., 2001
;
Fürthauer et al., 2002
;
Tsang et al., 2002
).
Inactivation of Sef or Spry4 results indeed in weakly dorsalised embryos.
However, this phenotype is much less severe than the phenotype resulting from
fgf8 overexpression (Fürthauer et
al., 2001
; Fürthauer et
al., 2002
).
We speculated that the weak dorsalisation of Spry4 or Sef-depleted embryos
may be due to the existence of additional modulators of Fgf signalling. In
accordance with this hypothesis, we isolated a second zebrafish Spry
homologue, most similar to murine spry2
(de Maximy et al., 1999
;
Tefft et al., 1999
), referred
to as zebrafish spry2. The distribution of spry2 transcripts
was analysed by in situ hybridisation and found to closely follow the
expression of fgf3, fgf8 and fgf24 throughout embryonic
development. spry2 transcripts are maternally deposited in the egg.
Although most maternally expressed RNAs are detected throughout the cytoplasm
of early cleavage stage embryos, spry2 transcripts display a
strikingly different localisation. At the 32-cell stage highly localised,
punctate distribution of spry2 transcripts was revealed
(Fig. 3A,B). After the
activation of the zygotic genome, spry2 transcripts start to be
enriched at the margin of the blastula, showing overlap with expression
domains of fgf3, fgf8 and fgf24
(Fig. 3C,D). Marginal
expression of spry2 persists as gastrulation proceeds
(Fig. 3F). At midgastrulation,
spry2 expression becomes detectable in the presumptive
midbrain/hindbrain region, which expresses fgf8
(Fig. 3E,F); in the presumptive
forebrain, which expresses fgf3
(Fig. 3F)
(Fürthauer et al., 2001
);
and in the axial mesendoderm expressing fgf24
(Fig. 3F)
(Draper et al., 2003
). During
segmentation, spry2 is expressed, like fgf8, spry4, sef,
erm1 and pea3, in the telencephalon, midbrain-hindbrain region,
heart primordia, somites and tail bud (Fig.
3G-L,U-X). Later, the cephalic expression of spry2
resolves to the telencephalon, the dorsal diencephalon, the optic stalk and
the midbrain-hindbrain boundary (Fig.
3N). spry2 is further expressed in the anterior otic
vesicle (like fgf3 and fgf8) and in the branchial arch
primordia (like fgf3; Fig.
3O,P). At 48 hpf, weak spry2 expression is observed in
the neurohypophysis, adjacent to the adenohypophyseal fgf8 expression
(Fig. 3Q,R). Complementary
expression of these two genes is also observed in the pectoral fin,
fgf8 being expressed in the apical ectodermal ridge and
spry2 in the underlying mesenchyme
(Fig. 3S,T). Expression profile
analysis therefore identifies spry2 as a novel member of the
fgf8 synexpression group. This also suggests that similarly to
spry4 (Fürthauer et al.,
2001
), spry2 may be expressed in response to Fgf
signalling.
|
Conversely, overexpression of fgf8 RNA, either throughout the embryo or at the animal pole (which is far from its endogenous marginal expression) induces ectopic spry2 expression (Fig. 4C, 36/36 embryos; Fig. 4D, 58/58 embryos). Taken together, these findings establish spry2 as a novel Fgf target gene.
Sprouty2 is necessary to inhibit dorsalising Fgf signals
Because spry2 is a target of Fgf, and as Drosophila Spry
antagonises Fgf signalling (Hacohen et
al., 1998
), we tested whether spry2 is able to inhibit
Fgf activity. Although injection of fgf8 alone causes a severe dorsalisation,
resulting in the elongation of embryos at the beginning of somitogenesis
(Fig. 4H, 62/69), co-injection
of fgf8 and spry2 causes embryos to revert to wild-type
morphology (Fig. 4I, 69/69
embryos). This observation shows that spry2 is able to antagonise
dorsalising Fgf signalling.
If Spry2 is important for the modulation of dorsalising Fgf signals under
physiological conditions, then inhibition of Spry2 function should alter the
DV patterning of the embryo. In accordance with this hypothesis, 31.8%
(n=110) of the embryos injected with a morpholino directed against
spry2 display a moderately dorsalised phenotype at early segmentation
stages (Fig. 4J) and 38.2%
embryos a severely dorsalised phenotype
(Fig. 4J,N), similar to
fgf8 overexpression phenotype
(Fig. 4P) or genetic loss of
Bmp2b or Bmp7 function (Kishimoto et al.,
1997
; Dick et al.,
2000
; Schmid et al.,
2000
). The specificity of the morpholino was demonstrated by the
rescue of this dorsalisation (Fig.
4K, n=64) after co-injection of a full-length spry2 RNA
in which the sequence recognised by the morpholino has been mutated
(mut-spry2, see Materials and methods).
The effect of Spry2 on DV patterning was confirmed by injection of an RNA
encoding a dominant-negative form
(Hanafusa et al., 2002
) of the
mouse spry2 (Fig. 4O;
45.6% moderately and 25.6% strongly dorsalised, n=90). Co-injection
of RNA encoding this dominant-negative form with spry2 morpholino further
enhances the penetrance of the dorsalised phenotype
(Fig. 4L; 18.1% weakly and
73.6% severely dorsalised embryos, n=144).
In accordance with the hypothesis that Fgf signalling affects the DV patterning through the inhibition of Bmp gene expression, inhibition of spry2 function by co-injection of spry2 morpholino and DN-Spry2 RNA, which results in an increase of Fgf activity, causes a reduction of bmp2b expression in the ventral blastoderm (Fig. 5A-D, 47/47). Inactivation of Spry2 causes an expansion of the expression domain of a marker of dorsal ectoderm (anterior neurectoderm) cyp26a (Fig. 5E,F; 50/50 embryos) and the concomitant reduction of ventral ectoderm (epidermis) revealed by foxi1 expression (Fig. 5I,J; 40/44 embryos). The dorsalising effect of spry2 loss of function can be abolished by co-injection of bmp2b: cyp26a disappears from dorsal ectoderm (Fig. 5G; 13 reduced, 35 abolished, n=48), while foxi1 expression is rescued and even enlarged (Fig. 5K; 15 wild-type, 23 enlarged, n=38).
|
|
|
Because inhibition of Bmp signalling is known to be required for the specification of dorsal ectoderm (neural fates), reduction of the neural plate may be due to the expansion of bmp2b expression. To test this hypothesis, we carried out two colour in situ hybridisation to visualise simultaneously bmp2b expression and the limits of the neural plate, outlined by the forebrain marker otx2 (Fig. 6Q,R). We found that both in wild-type and in Fgf-depleted embryos, the expression domains of bmp2b and otx2 abut each other (Fig. 6Q,R, arrowhead). When Fgf signalling is inhibited, bmp2b expression expands dorsally and otx2 becomes restricted to the small residual bmp2b-free zone next to the dorsal margin (Fig. 6R). Similarly, the expression of the anterior neural marker cyp26a abuts the expression of the Bmp-target ved both in wild-type and in dn-ras-injected embryos (Fig. 6S,T). Again, cyp26a expression becomes confined to the residual ved-free domain of dn-ras injected embryos (Fig. 6T). These observations strongly suggest that the reduction of the neurectoderm (dorsal ectoderm) observed in Fgf-signalling deficient embryos is due to increased Bmp signalling levels.
To confirm this hypothesis, we tested the capacity of the Bmp antagonist
Nog1 to rescue ectodermal patterning in Fgf signalling-deficient embryos. The
transcription factor foxi1 is expressed in the presumptive epidermis
(Fig. 7A), a tissue that
requires high Bmp signalling levels
(Wilson and Hemmati-Brivanlou,
1995
). After inhibition of Fgf signalling, the epidermal territory
expands dorsally (Fig. 7B,
43/44 embryos). Co-injection of RNA encoding Nog1 saves this DV patterning
defect and even completely abolishes foxi1 expression
(Fig. 7C; dn-ras injected
embryos 42/45 embryos), similar to the Nog1 overexpression phenotype
(Fig. 7D, 43/43).
|
Taken together, we show that enhanced Bmp signalling in Fgf-depleted embryos causes major alterations in the DV patterning of both mesodermal and ectodermal germ layers. Our results demonstrate that the Fgf-mediated ventralwards restriction of Bmp gene expression at blastula stage is essential for the establishment of the DV axis of the early zebrafish embryo (see Fig. 9F).
Chordin and Fgf8 cooperate to ensure proper DV patterning
Although overexpression of Fgf3/8/24 causes pronounced alterations of DV
patterning, inactivation of these factors has only very minor
(Reifers et al., 1998
) or no
effects on DV patterning (Draper et al.,
2003
) (M.F., C.T. and B.T., unpublished). We show here that
modulation of Bmp activity is ensured both by Fgf-mediated inhibition of Bmp
expression and by Bmp-binding antagonists. This suggests that the contribution
of individual Fgfs to DV patterning may be masked by the predominant role of
chd, a major Bmp-binding antagonist. To test this hypothesis, we
analysed whether inactivation of Fgf8 affects DV patterning in the context of
Chd-deficient embryos. In a first experiment, the phenotype of embryos
injected with a morpholino against chd was compared with the
phenotypes of embryos in which the function of both chd and
fgf8 was abolished through morpholino injection. Injection of Fgf8
morpholino has no effect on DV patterning
(Fig. 8B). Following injection
of Chd morpholino, of the embryos display a moderate (79.3%, n=87,
Fig. 8C) or a severe expansion
of the ventral haematopoietic mesoderm (17.3%, n=87). This expansion
of ventral haematopoietic mesoderm is considerably enhanced by co-injection of
a Fgf8 morpholino with 82.4% of the embryos displaying a severe expansion of
the ventral mesoderm (Fig. 8D;
n=125).
|
In a third experiment, Chd morpholino was injected into ace/fgf8 mutant embryos. ace homozygous mutant embryos are easily recognisable because of the lack of engrailed3 (en3) expression at the midbrain-hindbrain boundary (Fig. 8I,K). These embryos were probed for the expression of the hemoglobin (hem) gene. Injection of Chd morpholino causes a moderate enlargement of the haematopoietic territory and a severe enlargement in 86.7% (Fig. 8J) and 13.3%, respectively, of the injected ace heterozygotes (n=30). By contrast, injection into ace homozygous mutants results into 90% of the embryos displaying a severe expansion of the ventral mesoderm (Fig. 8L, n=30).
In order to assess whether the observed morphological changes result from early DV patterning alterations, we analysed the expression of the dorsal ectodermal marker cyp26a and the ventral mesodermal marker draculin. Following Chd morpholino injection, neural cyp26a expression is moderately reduced in 64.9% (Fig. 8O) and severely reduced in 35.1% of the embryos (n=37). Co-injection of Chd and Fgf8 morpholinos leads to a severe reduction or a nearly complete loss of neural cyp26a (77.1%; n=35). Similarly, combined inhibition of chd and fgf8 causes a more pronounced dorsal expansion of draculin (Fig. 8T; mean angular extent 313°, n=39) than the loss of Chd function alone (Fig. 8S, mean angular extent 279°, n=45). Taken together, our results show that Fgf8 and Chd act redundantly to ensure the proper modulation of Bmp activity that is required to establish DV patterning.
| Discussion |
|---|
|
|
|---|
The decrease of Bmp gene expression and the concomitant dorsalisation of embryos depleted for the Fgf-signalling antagonist spry2 shows clearly that Fgfs, when signalling from their endogenous expression territories, can affect the DV patterning of the zebrafish (Fig. 9D). Most importantly, inhibition of Fgf signalling through the use of dominant-negative Fgf receptors, the endogenous Fgf-signalling antagonist spry2 or pharmacological antagonist SU5402 causes a dorsalwards expansion of Bmp gene expression and a concomitant expansion of ventral cell fates (Fig. 9E).
Taken together, our work shows that in addition to the well-known interaction between Bmps and Bmp antagonists, the establishment of the DV axis of the zebrafish embryo requires the ventral restriction of Bmp genes expression at blastula stage, a process controlled by the Fgf signalling pathway (Fig. 9A).
Contribution of individual Fgfs to DV patterning
Despite their dorsalising activities, inactivation of individual Fgfs fail
to show any effect on DV patterning. This may be due to a functional
redundancy between Fgf family members. Accordingly, complete inhibition of Fgf
signalling results in pronounced DV patterning alterations, demonstrating that
the Fgf pathway is required for the control of this process.
A functional redundancy is also observed amongst Bmp-binding antagonists.
Loss of Chd function results in embryos displaying an incomplete
ventralisation, which is enhanced by the simultaneous loss of ogon
activity (Miller-Bertoglio et al.,
1999b
).
Chd and Fgfs affect DV patterning through different mechanisms: Chd abolishes Bmp signalling by binding Bmp proteins (Fig. 9B). By contrast, Fgf overexpression abolishes Bmp gene expression (Fig. 9C). In both cases, the ultimate outcome is a loss of Bmp signalling, which results in an expansion of dorsal cell fate concomitant with loss of ventral cell fates.
Chd has a very strong inhibitory effect on Bmp that makes it difficult to detect the effect of a weak decrease in the dorsal inhibition of Bmp gene expression by loss-of-function of a single Fgf. In accordance with this hypothesis, in Chd loss-of-function mutant, inactivation of Fgf8 enhances the ventralisation phenotype providing therefore genetic evidence for the implication of Fgf signalling in early DV patterning.
Fgf signalling and neural induction
Although some studies suggest that inhibition of ectodermal Bmp signalling
is sufficient for the acquisition of neural identity, experiments carried out
in the Xenopus and chicken suggest a requirement for Fgf signalling
for the early acquisition of neural competence
(Streit and Stern, 1999
).
According to this second view, Fgf signalling would be required for an early
phase of neural induction during the blastula period that cannot be achieved
by the Bmp antagonists Nog and Chd (Streit
et al., 2000
). Our study shows that, in the zebrafish, Fgf
signalling affects DV patterning already at blastula stage. We do however find
that the requirement for the early action of Fgfs can be bypassed if Bmp
signalling is inhibited by microinjection of Nog. Our observations are
therefore similar to those of Wilson and co-workers
(Wilson et al., 2000
), which
suggest that neural cell fate specification starts at blastula stages with an
Fgf-mediated inhibition of Bmp expression in the domain of the prospective
neural plate.
Previous work in Xenopus and zebrafish
(Dosch et al., 1997
;
Barth et al., 1999
) revealed
that Bmp signalling specifies DV identity in both mesoderm and ectoderm. In
addition, our past studies have shown that formation of the neurectoderm does
not depend on the presence of mesoderm
(Thisse and Thisse, 1999
;
Thisse et al., 2000
).
Consequently, neural induction should not be viewed as a distinct process but
as one aspect of the DV patterning: the definition of dorsal ectodermal
territories.
We show here that Fgf, through the control of Bmp activity, affects DV patterning in both mesoderm and ectoderm. Therefore, rather than considering our results as an evidence for a role of Fgf signalling in neural induction, they provide evidence that Fgf-mediated regulation of Bmp expression is essential for the DV patterning of both mesodermal and ectodermal derivatives.
Multiple effects of Fgf signalling
Fgfs are known for their implication in posterior development
(Kudoh et al., 2002
;
Cox and Hemmati-Brivanlou,
1995
; Kengaku and Okamoto,
1995
; Griffin et al.,
1995
), mesoderm induction and maintenance
(Schulte-Merker and Smith,
1995
; Isaacs et al.,
1994
) (for a review, see Yasuo
and Lemaire, 2001
). We show in the present study that Fgf
signalling does also affect the DV axis of the early zebrafish embryo. Early
in development, inhibition of Fgf signalling does not cause the loss of
mesoderm but a dorsal expansion of ventral mesodermal fates concomitant with a
progressive loss of dorsal mesoderm. In addition, overexpression of Fgf,
either by RNA injection or by inhibition of its feedback antagonist
spry2, affects the DV patterning of both mesoderm and ectoderm but
does not result in an increase of mesoderm. Therefore, it appears clearly that
at blastula stage Fgf controls cell identity along the DV axis rather than the
establishment of the mesodermal germ layer. This territory is lost later in
development, during gastrulation. This process is likely independent of Bmp
signalling as loss of Bmp gene function (in bmp2b/swr)
(Kishimoto et al., 1997
) or in
bmp7/snh (Schmid et al.,
2000
) affects ventral mesoderm formation but does not prevent
formation of axial or paraxial mesoderm. In addition, Bmp gain of function
(through Bmp RNA injections) affects DV patterning but not mesoderm
induction.
In addition to its function in DV patterning and mesoderm formation, the
Fgf signalling pathway is also involved in posterior development of the
embryo. In particular, at gastrulation, inhibition of Fgf activity results in
loss of posterior neurectoderm. We show here that this effect is independent
of Bmp signalling. The inhibition of Bmp activity through overexpression of
Nog1 is able to rescue DV patterning defect but fails to rescue the posterior
neurectoderm. In addition the loss of posterior neurectoderm is also
independent of mesoderm formation as posterior neurectoderm can be formed in
absence of both endoderm and mesoderm
(Thisse and Thisse, 1999
;
Thisse et al., 2000
). Finally,
we observe that the sensitivity of Fgf8 and Fgf3 for DV and AP patterning are
not identical (not shown). At low doses (injection of 0.2 pg RNA), Fgf8
affects DV patterning with little effect on AP patterning. At the opposite,
low dose (injection of 1 pg RNA) of Fgf3 posteriorises the neurectoderm,
whereas little or no effect is observed on DV patterning. At higher dose (1 pg
Fgf8 RNA and 5 pg Fgf3 RNA) both DV and AP patterning are affected by these
two ligands. Two Fgf receptors, Fgfr1 and Fgfr4 are expressed at blastula
stage (Thisse et al., 1995
)
(M.F., C.T. and B.T., unpublished). One explanation for the pleiotropy of Fgf
signalling may reside in the difference in affinity of Fgf ligand for the
different Fgf receptors that may act through the stimulation of different
downstream signalling pathways (Klint and
Claesson-Welsh, 1999
).
Altogether, these observations suggest that the three functions of Fgfs during early zebrafish development, mesoderm formation, AP and DV patterning are distinct. We show in this report that Fgfs, which signal through the Ras-MAP kinase pathway, regulate the DV patterning at the level of Bmp gene expression. However, the effect on AP patterning may involve interactions between Fgfs and other posteriorising factors, such as Wnt8. Finally, the effect on mesoderm formation is likely to imply interactions with Nodal signalling.
Understanding how the action of a single signalling pathway can contribute to mesoderm formation, DV and AP patterning, and the nature of the interaction between Fgfs and Wnt or Nodal signalling pathways will be the major challenges for future studies.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Barth, K. A., Kishimoto, Y., Rohr, K. B., Seydler, C.,
Schulte-Merker, S. and Wilson, S. W. (1999) Bmp activity
establishes a gradient of positional information throughout the entire neural
plate. Development 126,4977
-4987.[Abstract]
Chan, F. Y., Robinson, J., Brownlie, A., Shivdasani, R. A.,
Donovan., A., Brugnara, C., Kim, J., Lau, B. C., Witkowska, H. E. and Zon, L.
I. (1997). Characterization of adult alpha- and beta-globin
genes in the zebrafish. Blood
89,688
-700.
Cox, W. G. and Hemmati-Brivanlou, H. (1995).
Caudalization of neural fate by tissue recombination and bFGF.
Development 121,4349
-4358.[Abstract]
de Maximy, A. A., Nakatake, Y., Moncada, S., Itoh, N., Thiery,
J. and Bellusci, S. (1999) Cloning and expression pattern of
a mouse homologue of drosophila sprouty in the mouse embryo. Mech.
Dev. 81,213
-216.[CrossRef][Medline]
Dick, A., Hild, M., Bauer, H., Imai, Y., Maifeld, H., Schier, A.
F., Talbot, W. S., Bouwmeester, T. and Hammerschmidt, M.
(2000). Essential role of Bmp7 (snailhouse) and its prodomain in
dorsoventral patterning of the zebrafish embryo.
Development 127,343
-354.[Abstract]
Dosch, R., Gawantka, V., Delius, H., Blumenstock, C. and Niehrs,
C. (1997). Bmp-4 acts as a morphogen in dorsoventral mesoderm
patterning in Xenopus. Development
124,2325
-2334.[Abstract]
Draper, B. W., Stock, D. W. and Kimmel, C. B.
(2003). Zebrafish fgf24 functions with fgf8 to promote posterior
mesodermal development. Development
130,4639
-4654.
Ekker, M., Wegner, J., Akimenko, M. A. and Westerfield, M.
(1992). Coordinate embryonic expression of three zebrafish
engrailed genes. Development
116,1001
-1010.[Abstract]
Fürthauer, M., Thisse, C. and Thisse, B.
(1997). A role for FGF-8 in the dorsoventral patterning of the
zebrafish gastrula. Development
124,4253
-4264.[Abstract]
Fürthauer, M., Thisse, B. and Thisse, C.
(1999). Three different noggin genes antagonize the activity of
bone morphogenetic proteins in the zebrafish embryo. Dev.
Biol. 214,181
-196.[CrossRef][Medline]
Fürthauer, M., Reifers, F., Brand, M., Thisse, B. and
Thisse, C. (2001). sprouty4 acts in vivo as a
feedback-induced antagonist of FGF signaling in zebrafish.
Development 128,2175
-2186.
Fürthauer, M., Lin, W., Ang, S.-L., Thisse, B. and Thisse,
C. (2002). Sef is a feedback-induced antagonist of
Ras/MAPK-mediated FGF signalling. Nat. Cell Biol.
4, 170-174.[CrossRef][Medline]
Griffin, K., Patient, R. and Holder, N. (1995).
Analysis of FGF function in normal and no tail zebrafish embryos reveals
separate mechanisms for formation of the trunk and the tail.
Development 121,2983
-2994.[Abstract]
Hacohen, N., Kramer, S., Sutherland, D., Hiromi, Y. and Krasnow,
M. A. (1998). sprouty encodes a novel antagonist of FGF
signaling that patterns apical branching of the Drosophila airways.
Cell 92,253
-263.[CrossRef][Medline]
Hanafusa, H., Torii, S., Yasunaga, T. and Nishida, E.
(2002). Sprouty1 and Sprouty2 provide a control mechanism for the
Ras/MAPK signalling pathway. Nat. Cell Biol.
4, 850-858.[CrossRef][Medline]
Herbomel, P., Thisse, B. and Thisse, C. (1999).
Ontogeny and behaviour of early macrophages in the zebrafish embryo.
Development 126,3735
-3745.[Abstract]
Isaacs, H. V., Pownall, M. E. and Slack, J. M. W.
(1994). eFGF regulates Xbra expression during Xenopus
gastrulation. EMBO J.
13,4469
-4481.[Medline]
Kengaku, M. and Okamoto, H. (1995). bFGF as a
possible morphogen for the anteroposterior axis of the central nervous system
in Xenopus. Development
121,3121
-3130.[Abstract]
Kiefer, P., Mathieu, M., Mason, I. and Dickson, C.
(1996). Secretion and mitogenic activity of zebrafish FGF3 reveal
intermediate properties relative to mouse and Xenopus homologues.
Oncogene 12,1503
-1511.[Medline]
Kishimoto, Y., Lee, K. H., Zon, L., Hammerschmidt, M. and
Schulte-Merker, S. (1997). The molecular nature of zebrafish
swirl: BMP2 function is essential during early dorsoventral patterning.
Development 124,4457
-4466.[Abstract]
Klint, P. and Claesson-Welsh, L. (1999). Signal
transduction by fibroblast growth factor receptors. Front.
Biosci. 15,D165
-D177.
Koos, D. S. and Ho, R. K. (1997). The
nieuwkoid/dharma homeobox gene is essential for bmp2b repression in the
zebrafish pregastrula. Dev. Biol.
215,190
-207.
Koshida, S., Shinya, M., Nikaido, M., Ueno, N., Schulte-Merker,
S., Kuroiwa, A. and Takeda, H. (2002). Inhibition of BMP
activity by the FGF signal promotes posterior neural development in zebrafish.
Dev. Biol. 244,9
-20.[CrossRef][Medline]
Krauss, S., Concordet, J. P. and Ingham, P. W.
(1993). A functionally conserved homolog of the Drosophila
segment polarity gene hh is expressed in tissues with polarizing activity in
zebrafish embryos. Cell
75,1431
-1444.[CrossRef][Medline]
Kudoh, T., Wilson, S. W., Dawid, I. B. (2002).
Distinct roles for Fgf, Wnt and retinoic acid in posteriorizing the neural
ectoderm. Development
129,4335
-4346.
Leung, T., Bischof, J., Soll, I., Niessing, D., Zhang, D., Ma,
J., Jäckle, H. and Driever, W. (2003). Bozozok directly
represses bmp2b transcription and mediates the earliest dorsoventral asymmetry
of bmp2b expression in zebrafish. Development
130,3639
-3649.
Mercier, P., Simeone, A., Cotelli, F. and Boncinelli, E.
(1995) Expression pattern of two otx genes suggests a role in
specifying anterior body structures in zebrafish. Int. J. Dev.
Biol. 39,559
-573.[Medline]
Metz, A., Knochel, S., Buchler, P., Koster, M. and Knöchel,
W. (1998). Structural and functional analysis of the BMP-4
promoter in early embryos of Xenopus laevis. Mech.
Dev. 74,29
-39.[CrossRef][Medline]
Miller-Bertoglio, V. E., Fisher, S., Sanchez, A., Mullins, M. C.
and Halpern, M. E. (1999a). Differential regulation of
chordin expression domains in mutant zebrafish. Dev.
Biol. 192,537
-550.
Miller-Bertoglio, V., Carmany-Rampey, A., Fürthauer, M.,
Gonzalez, E., Thisse, C., Thisse, B., Halpern, M. and Solnica-Krezel, L.
(1999b). Maternal and zygotic activity of the zebrafish
mercedes/ogon/short-tail locus antagonizes BMP
signaling. Dev. Biol.
214, 72-86.[CrossRef][Medline]
Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh,
B. K., Hubbard, S. R. and Schlessinger, J. (1997). Structures
of the tyrosine kinase domain of fibroblast growth factor receptor in complex
with inhibitors. Science
276,955
-960.
Nikaido, M., Tada, M., Saji, T. and Ueno, N.
(1997). Conservation of BMP signaling in zebrafish mesoderm
patterning. Mech. Dev.
61, 75-88.[CrossRef][Medline]
Piccolo, S., Sasai, Y., Lu, B. and de Robertis, E. M.
(1996). Dorsoventral patterning in Xenopus: inhibition of ventral
signals by direct binding of chordin to BMP-4. Cell
86,589
-598.[CrossRef][Medline]
Raible, F. and Brand, M. (2001). Tight
transcriptional control of the ETS domain factors Erm and Pea3 by Fgf
signaling during early zebrafish development. Mech.
Dev. 107,5
-17.
Reifers, F., Bohli, H., Walsh, E. C., Crossley, P. H., Stainier,
D. Y. and Brand, M. (1998). Fgf8 is mutated in zebrafish
acerebellar (ace) mutants and is required for maintenance of
midbrain-hindbrain boundary development and somitogenesis.
Development 125,2381
-2395.[Abstract]
Roehl, H. and Nüsslein-Volhard, C. (2001).
Zebrafish pea3 and erm are general targets of FGF8 signaling. Curr.
Biol. 11,503
-507.[CrossRef][Medline]
Schmid, B., Fürthauer, M., Connors, S. A., Trout, J.,
Thisse, B., Thisse, C. and Mullins, M. C. (2000). Equivalent
genetic roles for bmp7/snailhouse and bmp2b/swirl in dorsoventral pattern
formation. Development
127,957
-967.[Abstract]
Schulte-Merker, S. and Smith, J. C. (1995).
Mesoderm formation in response to brachyury requires FGF signalling.
Curr. Biol. 5,62
-67.[CrossRef][Medline]
Schulte-Merker, S., Lee, K. J., McMahon, A. P. and
Hammerschmidt, M. (1997). The zebrafish organizer requires
chordino. Nature 38,862
-863.
Sharrocks, A. D. (2001). The ETS-domain
transcription factor family. Nat. Rev. Mol. Cell.
Biol. 2,827
-837.[CrossRef][Medline]
Shimizu, T., Yamanaka, Y., Nojima, H., Yabe, T., Hibi, M. and
Hirano, T. (2002). A novel repressor-type homeobox gene, ved,
is involved in dharma/bozozok-mediated dorsal organizer formation in
zebrafish. Mech. Dev.
118,125
-138.[CrossRef][Medline]
Streit, A. and Stern, C. D. (1999). Neural
induction. A bird's eye view. Trends Genet.
15, 20-24.[CrossRef][Medline]
Streit, A., Berliner, A. J., Papanayotou, C., Sirulnik, A. and
Stern, C. D. (2000). Initiation of neural induction by FGF
signalling before gastrulation. Nature
406, 74-78.[CrossRef][Medline]
Tefft, J. D., Lee, M., Smith, S., Leinwand, M., Zhao, J.,
Bringas, P., Jr, Crowe, D. L. and Warburton, D. (1999).
Conserved function of mSpry-2, a murine homolog of Drosophila sprouty, which
negatively modulates respiratory organogenesis. Curr.
Biol. 9,219
-222.[CrossRef][Medline]
Thisse, C., Thisse, B., Halpern, M. E. and Postlethwait, J.
H. (1994). Goosecoid expression in neurectoderm and
mesendoderm is disrupted in zebrafish cyclops gastrulas. Dev.
Biol. 164,420
-429.[CrossRef][Medline]
Thisse, B., Thisse, C. and Weston, J. A.
(1995). The zebrafish FGF receptor 4 is dynamically expressed in
mesoderm and neurectoderm during early embryogenesis. Dev.
Dyn. 203,377
-391.[Medline]
Thisse, C. and Thisse, B. (1999). Antivin, a
novel and divergent member of the TGFß superfamily, negatively regulates
mesoderm induction. Development
126,229
-240.[Abstract]
Thisse, B., Wright, C. V. E. and Thisse, C.
(2000). Activin and Nodal-related factors control
antero-posterior patterning of the zebrafish embryo.
Nature 403,425
-427.[CrossRef][Medline]
Tsang, M., Friesel, R., Kudoh, T. and Dawid, I. B.
(2002). Identification of Sef, a novel modulator of FGF
signalling. Nat. Cell Biol.
4, 165-169.[CrossRef][Medline]
Wasylyk, B., Hagman, J. and Gutierrez-Hartmann, A.
(1998). Ets transcription factors: nuclear effectors of the
Ras-MAP-kinase signaling pathway. Trends Biochem Sci.
23,213
-216.[CrossRef][Medline]
Whitman, M. and Melton, D. A. (1992).
Involvement of p21ras in Xenopus mesoderm induction.
Nature 357,252
-254.[CrossRef][Medline]
Wilson, P. A. and Hemmati-Brivanlou, A. (1995).
Induction of epidermis and inhibition of neural fate by Bmp-4.
Nature 376,331
-333.[CrossRef][Medline]
Wilson, S. I., Graziano, E., Harland, R., Jessell, T. M. and
Edlund, T. (2000). An early requirement for FGF signalling in
the acquisition of neural cell fate in the chick embryo. Curr.
Biol. 10,421
-429.[CrossRef][Medline]
Yasuo, H. and Lemaire, P. (2001). Generation of
the germ layers along the animal-vegetal axis in Xenopus laevis.
Int. J. Dev. Biol. 45,229
-235.[Medline]
Zimmerman, L. B., de Jesus-Escobar, J. M. and Harland, R. M.
(1996). The Spemann organizer signal noggin binds and inactivates
bone morphogenetic protein 4. Cell
86,599
-606.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J.-D. Fauny, B. Thisse, and C. Thisse The entire zebrafish blastula-gastrula margin acts as an organizer dependent on the ratio of Nodal to BMP activity Development, November 15, 2009; 136(22): 3811 - 3819. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Anastasaki, A. L. Estep, R. Marais, K. A. Rauen, and E. E. Patton Kinase-activating and kinase-impaired cardio-facio-cutaneous syndrome alleles have activity during zebrafish development and are sensitive to small molecule inhibitors Hum. Mol. Genet., July 15, 2009; 18(14): 2543 - 2554. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Gibby, K. McDonnell, M. O. Schmidt, and A. Wellstein A distinct role for secreted fibroblast growth factor-binding proteins in development PNAS, May 26, 2009; 106(21): 8585 - 8590. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kai, C.-P. Heisenberg, and M. Tada Sphingosine-1-phosphate receptors regulate individual cell behaviours underlying the directed migration of prechordal plate progenitor cells during zebrafish gastrulation Development, September 15, 2008; 135(18): 3043 - 3051. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gaulden and J. F. Reiter Neur-ons and neur-offs: regulators of neural induction in vertebrate embryos and embryonic stem cells Hum. Mol. Genet., April 15, 2008; 17(R1): R60 - R66. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Cotton, M. K. O'Bryan, and B. T. Hinton Cellular Signaling by Fibroblast Growth Factors (FGFs) and Their Receptors (FGFRs) in Male Reproduction Endocr. Rev., April 1, 2008; 29(2): 193 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ochi, S. Hans, and M. Westerfield Smarcd3 Regulates the Timing of Zebrafish Myogenesis Onset J. Biol. Chem., February 8, 2008; 283(6): 3529 - 3536. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Walmsley, D. Cleaver, and R. Patient Fibroblast growth factor controls the timing of Scl, Lmo2, and Runx1 expression during embryonic blood development Blood, February 1, 2008; 111(3): 1157 - 1166. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chang and R. M. Harland Neural induction requires continued suppression of both Smad1 and Smad2 signals during gastrulation Development, November 1, 2007; 134(21): 3861 - 3872. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yao, S. Nowak, A. Yochelis, A. Garfinkel, and K. I. Bostrom Matrix GLA Protein, an Inhibitory Morphogen in Pulmonary Vascular Development J. Biol. Chem., October 12, 2007; 282(41): 30131 - 30142. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hans and M. Westerfield Changes in retinoic acid signaling alter otic patterning Development, July 1, 2007; 134(13): 2449 - 2458. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Nakazawa, H. Nagai, M. Shin, and G. Sheng Negative regulation of primitive hematopoiesis by the FGF signaling pathway Blood, November 15, 2006; 108(10): 3335 - 3343. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Q. Matus, K. Pang, H. Marlow, C. W. Dunn, G. H. Thomsen, and M. Q. Martindale From the Cover: Molecular evidence for deep evolutionary roots of bilaterality in animal development PNAS, July 25, 2006; 103(30): 11195 - 11200. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Holley Anterior-posterior differences in vertebrate segments: specification of trunk and tail somites in the zebrafish blastula Genes & Dev., July 15, 2006; 20(14): 1831 - 1837. [Full Text] [PDF] |
||||
![]() |
D. P. Szeto and D. Kimelman The regulation of mesodermal progenitor cell commitment to somitogenesis subdivides the zebrafish body musculature into distinct domains Genes & Dev., July 15, 2006; 20(14): 1923 - 1932. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Reim and M. Brand Maternal control of vertebrate dorsoventral axis formation and epiboly by the POU domain protein Spg/Pou2/Oct4 Development, July 15, 2006; 133(14): 2757 - 2770. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. J. Machingo, A. Fritz, and B. D. Shur A {beta}1,4-galactosyltransferase is required for Bmp2-dependent patterning of the dorsoventral axis during zebrafish embryogenesis Development, June 1, 2006; 133(11): 2233 - 2241. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Poulain, M. Furthauer, B. Thisse, C. Thisse, and T. Lepage Zebrafish endoderm formation is regulated by combinatorial Nodal, FGF and BMP signalling Development, June 1, 2006; 133(11): 2189 - 2200. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Fletcher, J. C. Baker, and R. M. Harland FGF8 spliceforms mediate early mesoderm and posterior neural tissue formation in Xenopus Development, May 1, 2006; 133(9): 1703 - 1714. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gestri, M. Carl, I. Appolloni, S. W. Wilson, G. Barsacchi, and M. Andreazzoli Six3 functions in anterior neural plate specification by promoting cell proliferation and inhibiting Bmp4 expression Development, May 15, 2005; 132(10): 2401 - 2413. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Stern Neural induction: old problem, new findings, yet more questions Development, May 1, 2005; 132(9): 2007 - 2021. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rhinn, K. Lun, M. Luz, M. Werner, and M. Brand Positioning of the midbrain-hindbrain boundary organizer through global posteriorization of the neuroectoderm mediated by Wnt8 signaling Development, March 15, 2005; 132(6): 1261 - 1272. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Delaune, P. Lemaire, and L. Kodjabachian Neural induction in Xenopus requires early FGF signalling in addition to BMP inhibition Development, January 15, 2005; 132(2): 299 - 310. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kudoh, M. L. Concha, C. Houart, I. B. Dawid, and S. W. Wilson Combinatorial Fgf and Bmp signalling patterns the gastrula ectoderm into prospective neural and epidermal domains Development, August 1, 2004; 131(15): 3581 - 3592. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||