|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 2 June 2004
doi: 10.1242/dev.01161
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
School of Biological Sciences, University of Sussex, Falmer, Brighton BN1 9QG, UK
* Author for correspondence (j.p.couso{at}sussex.ac.uk)
Accepted 9 March 2004
| SUMMARY |
|---|
|
|
|---|
Key words: LIM-HOM, Prd-HOM, Chip, Apterous, Legs, Drosophila, DLim1
| Introduction |
|---|
|
|
|---|
Experiments in Drosophila have identified interactions in vivo
between Chip and the LIM-HOM protein Apterous (Ap). Apterous is required for
dorsoventral (DV) patterning and growth of the wing
(Cohen et al., 1992
). Dosage
interactions and other genetic experiments involving Chip and
ap, plus biochemical assays, have indicated that Ap function is
carried out by a tetramer complex comprising two molecules of Ap bridged by a
Chip dimer (Fernández-Fúnez
et al., 1998
; Milan and Cohen,
1999
; Morcillo et al.,
1997
; Rincon-Limas et al.,
2000
; van Meyel et al.,
1999
).
Ap function in the wing is regulated by Dlmo (Bx FlyBase; the
Drosophila homologue of LIM-only, a protein composed only of LIM
domains), which interacts with Chip with higher affinity than Ap to reduce the
formation of active Ap-Chip complexes
(Milan and Cohen, 2000
;
Shoresh et al., 1998
;
Weihe et al., 2001
;
Zeng et al., 1998
). In the
Drosophila CNS, Ap and Chip also interact physically and form
tetrameric complexes required for the proper fasciculation of the
ap-expressing interneurones. However, Ap function is regulated
differently in the CNS than in the wing. For instance, dlmo
(Bx) is not expressed in Ap neurones and the relative dosage between
Ap and Chip is not limiting for the formation of Ap-Chip complexes
(van Meyel et al., 2000
).
Furthermore, a combinatorial code between the LIM-HOM genes islet
(isl; tailup, tup FlyBase) and Lim3
controls motoneurone pathway selection in flies and vertebrates
(Thaler et al., 2002
;
Thor et al., 1999
). In
vertebrates, the combinatorial activities of Islet and Lim3 homologues are not
carried out by homo- or heterotetrameric complexes, instead they are carried
out by a single Ldb-mediated hexameric complex
(Thaler et al., 2002
).
Finally, it has been shown that Chip plays a role in other patterning
processes by binding non-LIM proteins, such as the HOM proteins Bcd and Fz,
and the GATA factor Pannier (Ramain et
al., 2000
; Torigoi et al.,
2000
). Therefore, Lbd specificity depends on the presence of
different cofactors in each developmental context.
In the leg of Drosophila, a regulatory network of LIM-HOM and
Prd-HOM (Paired-homeodomain) genes exists
(Pueyo et al., 2000
). The legs
of Drosophila are formed from groups of epithelial cells, which
segregate inside the embryo and grow during larval development, giving rise to
sac-like structures called imaginal discs. The most distal part of the leg
consists of five tarsal segments plus a pretarsus
(Fig. 1A). Distal leg
patterning first entails the establishment of the tarsal and pretarsal
primordia at 80-90 hours after egg laying (AEL)
(Galindo et al., 2002
),
followed by the subdivision of the tarsal field into smaller domains of gene
expression (Fig.
1B-B''')
(Galindo and Couso, 2000
).
These domains define each tarsal segment
(Kojima et al., 2000
;
Pueyo et al., 2000
) and a
joint is then intercalated between every segment
(Bishop et al., 1999
;
de Celis et al., 1998
;
Rauskolb, 2001
;
Rauskolb and Irvine, 1999
).
Thus at 80-90 hours AEL the presumptive distal region of the leg disc appears
divided into two domains of Prd-HOM gene expression: aristaless
(al) expression in the pretarsus and Bar expression in the
adjacent tarsal cells (Kojima et al.,
2000
). These patterns are activated by Distal-less (Dll) and a
distal gradient of Egfr-Ras signalling
(Campbell, 2002
;
Galindo et al., 2002
). From 90
hours AEL, Bar expression is maintained at high levels by
self-activation in the presumptive fifth tarsal segment, whereas in the fourth
tarsal segment lower levels of Bar are required for the expression of
ap (Fig.
1B-B'''). Consequently, a high dose of Bar
protein and a low dose of Bar plus Ap are necessary for the development of the
fifth and fourth tarsal segments, respectively. In the pretarsus, Al activates
the expression of the LIM-HOM gene Lim1 (also known as
dlim1) after 90 hours AEL, and a positive-feedback mechanism and
cooperation between them ensures pretarsal development. During this process,
mutual repression between Bar on the one hand and al plus
Lim1 on the other establishes a sharp tarsal/pretarsal boundary
(Pueyo et al., 2000
;
Tsuji et al., 2000
).
|
| Materials and methods |
|---|
|
|
|---|
HD,
UAS-ap
LIM and UAS-Lim3-ap
(OKeefe et al., 1998
LID, UAS-Chip
DD and
UAS-Chip-ap (van Meyel et al.,
1999
GST pull-down assay
Glutathione-S-transferase (Gst)-Chip fusion constructs were generated and
kindly provided by Dale Dorset (Torigoi et
al., 2000
). Gst-Ap and Gst-ApLim fusion constructs were generated
by PCR amplification of the ap cDNA using specific primers. The same
forward primer AGAGAGGATCCATGGGCGTCTGCACCGA was used in both amplifications,
whereas the reverse primers were the Ap reverse primer
GAGAGAGAATTCTTCCTGAGCATCCGTTAGTCC and the ApLim reverse primer
GAGAGAGAATTCGCTATGCTGTAGTGGGTC. PCR products were firstly cloned using TA
cloning kit (Invitrogen). Positive clones were double digested with
XhoI/EcoRI and the appropriate DNA fragment was gel
extracted. Finally, the DNA fragment was cloned in the pGEX-2T vector
(Amersham Pharmacia). Expression of the Gst-fusion proteins and binding to
Gluthathione-agarose beads (Amersham Pharmacia) were performed as described by
Torigoi et al. (Torigoi et al.,
2000
). Fly extracts were obtained by homogenisation of 50 brain
and leg complexes from third instar larvae in dry ice, and resuspension in 150
µl of 50 mM Tris (pH 7.2), 150 mM NaCl, 2 mM EGTA, 5% Triton X-100 with
protease inhibitors (Roche). 100 µl of blocked beads with the GST-fusion
proteins were incubated with 300 µl of fly extract for 1 hour at 4°C.
After the binding reaction, beads were washed three times with blocking
solution, twice with PBT, and twice with PBS. 60 µl of 2xDS reducing
buffer/DTT were added to the beads and boiled. The samples were loaded in a
10% SDS-PAGE gel and analysed by western blot. Rabbit anti-BarH1
(Kojima et al., 2000
) and
guinea pig anti-Lim1 (Lilly et al.,
1999
) were used at a 1:5000 dilution, and Rat anti-Al
(Campbell, 2002
) was used at
1:10,000. Secondary antibodies coupled to peroxidase for rabbit and guinea pig
were obtained from Dako and Jackson ImmunoResearch. Finally, the ECL system
was used for detection of peroxidase reaction. In separate experiments, the
TNT Quick Coupled Transcription/Translation Systems (Promega) were used to
express BarH1 cDNA.100 µl of beads with the GST-Chip fusion
proteins were incubated with 100 µl of the TNT reaction. Following the
washes the protocol was followed as above.
Immunocytochemistry
Antibody staining procedures were performed as described previously
(Pueyo et al., 2000
).
Antibodies used were: guinea pig anti-Lim1
(Lilly et al., 1999
); rat
anti-Ap (Lundgren et al.,
1995
); rabbit anti-Dlmo (Milan
et al., 1998
); rabbit anti-ß-galactosidase (Cappel).
Secondary antibodies were obtained from Vector Laboratories and Jackson
ImmunoResearch.
| Results |
|---|
|
|
|---|
|
It has been previously reported that dlmo is expressed in the
legs, but its pattern of expression has not been fully characterised
(Zeng et al., 1998
). Using
anti-Dlmo antibody and a dlmoGal4 reporter line
(Milan et al., 1998
), we did
not detect Dlmo expression in the leg tissue but in a few cells of the
peripodial disc membrane (Fig.
1D). In addition, loss-of-function dlmo alleles did not
produce a mutant leg phenotype (not shown). Another dlmo-like gene
annotated as CG5708 has been found in the fly genome
(Adams et al., 2000
). In situ
hybridisation was performed using a specific cDNA for this gene as a probe and
expression was observed in the CNS, but not in the leg imaginal discs (not
shown). Thus it appears that dlmo genes do not regulate LIM-HOM
function in the legs. Nevertheless, ectopic expression of UAS-dlmo in
the ap domain causes the loss of the fourth tarsal segment
(Fig. 1I) without removing Ap
protein expression (data not shown). As the Dlmo protein cannot bind the LIM
domains of Ap but does bind the Chip LIM-interaction domain with higher
efficiency than Ap (Milan et al.,
1998
; Weihe et al.,
2001
), it is possible that ectopic expression of Dlmo in the leg
sequesters Chip, thereby disrupting the formation of Chip-Ap complexes. In
agreement with this interpretation, partial rescue of the UAS-dlmo
dominant-negative effect was achieved by co-expression of UAS-Chip
(Fig. 1J). Therefore, although
the dlmo gene is not expressed during the development of the
wild-type leg, its ectopic expression interferes with the posttranslational
interaction of Ap and Chip. We used a similar rationale to identify further
interacting partners of Ap and Chip in the legs.
Ectopic expression of LIM-HOM genes interferes with Ap function posttranslationally
Sequence comparisons have shown that LIM-HOM proteins have been conserved
throughout evolution (Dawid et al.,
1998
; Hobert and Westphal,
2000
). Their developmental role also seems to be conserved,
because distinct neural fates are specified by identical combinations of
LIM-HOM genes in Drosophila and in vertebrates
(Thor et al., 1999
).
Furthermore, ectopic expression of vertebrate LIM-HOM orthologues induce the
same developmental effects in flies as the endogenous Drosophila
genes do, indicating that the mechanisms of action of LIM-HOM proteins are
conserved (Rincón-Limas et al.,
1999
; Tsuji et al.,
2000
). In view of these LIM-HOM functional relationships, we
tested whether other LIM-HOM proteins could rescue Ap function in legs.
Expression of UAS-Lim1 in ap mutant legs does not produce
any rescue of the ap mutant phenotype
(Pueyo et al., 2000
), and no
rescue was obtained by expressing the LIM-HOM gene islet either (not
shown). However, OKeefe et al.
(OKeefe et al., 1998
)
showed that expression of a hybrid protein containing the LIM domains of Lim3
and the homeodomain of Ap (Lim3-Ap) was able to partially rescue the
ap mutant phenotype in the wing. This functional overlap extends to
the leg as the hybrid Lim3-Ap molecule also rescues the ap mutant leg
phenotype (Fig. 2D); this shows
that the primary function of the LIM domains of Ap must be common to those of
Lim3, most likely binding of Chip as shown in other systems
(Milan et al., 1998
;
Thor and Thomas, 1997
;
van Meyel et al., 2000
).
When LIM-HOM genes (Lim3, islet) were expressed ectopically in the ap domain of otherwise wild-type flies, the existence of an unknown cofactor of Ap was revealed. apGal4;UAS-Lim3 and apGal4;UAS-isl flies lack the fourth tarsal segment (Fig. 2E). These flies still expressed ap in the legs (Fig. 2G-G'') and their phenotype was not rescued by simultaneous co-expression of UAS-ap (Fig. 2F). As these LIM-HOM proteins can interact with Chip, quenching of Chip could explain their ap-like dominant-negative phenotypes. However, these dominant-negative effects were also not rescued by co-expression of UAS-Chip (data not shown). The lack of phenotypic rescue by co-expression of either Chip or Ap could be due either to higher binding affinities of the Islet and Lim3 proteins, or to different levels of expression of the UAS transgenes employed. However, several UAS-ap and UAS-Chip transgenes with different expression levels were used in these experiments, with no rescue of the dominant-negative mutant phenotype. An alternative explanation is that Lim3 and Islet proteins interfere with another cofactor required for Ap function in the legs.
Overexpression of Bar suppresses the dominant-negative effect caused by ectopic LIM-HOM proteins in the ap domain
An element related to Ap function is the HOM gene Bar. Bar is
required for the development of tarsal segments four and five
(Fig. 1B,B' and
Fig. 3A)
(Kojima et al., 2000
). The
main functional role of Bar in tarsus four had been attributed to the
transcriptional activation of ap, as part of the regulatory network
patterning the distal leg (Kojima et al.,
2000
; Pueyo et al.,
2000
). Ectopic Lim1 driven by apGal4 eliminates tarsal
structures and represses Bar expression
(Fig. 3C,D-D''), leading
to the loss of Ap expression (Pueyo et
al., 2000
). As it might be expected, co-expression of Bar in
apGal4/UAS-Lim1;UAS-Bar flies produces a partial rescue of the fourth
tarsal segment (Fig. 3E).
|
A proper balance of Bar and Ap proteins is required during tarsal development
LIM-HOM proteins can form multi-protein complexes with other HOM proteins,
either by direct interactions or through interaction with Ldb proteins
(Hobert and Westphal, 2000
).
As Bar behaves as a cofactor of Ap, Ap and Bar proteins could interact and
form a transcriptional complex to regulate target genes. In this case, changes
of dosage of either Bar or ap might disrupt the formation of
Ap-Bar complexes. To test this hypothesis, we performed gene dosage
experiments. First, the phenotypes of both Bar
(InBM2) and ap (apGal4/apUGO
at 25°C) mutants were enhanced by removing a copy of ap and
Bar, respectively (Fig.
4A-C; compare with Fig.
2A). Second, overexpression of Bar causes loss of the fourth
tarsal segment (Fig. 4E),
although Ap was still expressed in these flies
(Fig. 4D)
(Kojima et al., 2000
). As Bar
is expressed in a graded manner in the wild type, at a higher level in the
fifth tarsal segment and at a lower level in the fourth
(Fig. 1B,B'), these
observations suggest that the correct amount of Bar is necessary for the
development of the fourth tarsal segment. If Bar overexpression alters the
stoichiometry of Ap and Bar, and thus prevents the formation of functional
Ap-Bar complexes, then this dominant-negative effect should be rescued by
restoring the appropriate balance with co-expression of Ap. As predicted,
apGal4/UAS-ap;UAS-Bar flies show a completely rescued phenotype with
five tarsal segments (Fig.
4F).
|
Bar interacts with Chip and Ap
To test the possibility of Chip-mediated complexes involving Bar, a direct
interaction between Bar and Chip was tested in a Gst pull-down assay. Bar
protein, both expressed in vitro or present in leg disc extracts, is retained
by Chip-Gst fusions (Fig.
5A,B), as is Lim1 (Fig.
5A,B) (Lilly et al.,
1999
) and Ap (Torigoi et al.,
2000
). This protein interaction explains the requirement for Chip
in tarsus five, and suggests that a complex of Bar-Chip is the functional
element in this segment. In tarsus four, Chip seems to also bind Ap, as shown
by the results involving the Ap-Chip chimaera in the legs (see above).
Therefore, the dominant-negative interactions between Bar and Ap (and other
LIM-HOM) proteins in tarsus four could be based on competition for Chip.
|
In summary, our results show that the development of the tarsus requires
stoichiometric interactions between Bar, Ap and Chip proteins, with Bar being
the limiting factor in this process. These interactions seem to rely on: (1)
the binding of Ap and Chip through their LIM and LID domains, respectively;
(2) an interaction between Bar and Chip through a different domain; and (3)
further complexing mediated by the Chip dimerisation domain. These
interactions lead to the formation of Ap-Chip-Bar and Bar-Chip, functional
units in tarsus four and five, respectively. Direct interactions between
LIM-HOM and HOM transcription factors leading to the transcriptional
regulation of target genes have already been described
(Bach et al., 1997
).
Interactions between LIM-HOM, Chip and HOM proteins in the pretarsus
The pretarsus at the tip of the leg is composed of the claw organ (a
multicellular organ providing sensory information and grip to the substrate),
plus a muscle attachment site and its associated tendon. Lim1 and the
Prd-HOM gene al are required for pretarsus development, and display
synergistic functional interactions (Pueyo
et al., 2000
). One of the outcomes of their co-operation is the
repression of Bar expression. Thus, weak alleles of al or strong
alleles of Lim1 lead to mild ectopic Bar expression in the pretarsus
(Fig. 6A,B)
(Kojima et al., 2000
), whereas
complete loss of both al and Lim1 allows Bar to completely
invade the presumptive leg tip (Fig.
6C) (Tsuji et al.,
2000
). Reciprocally, ectopic expression of Al or Lim1 alone does
not repress Bar (Fig. 6D)
(Kojima et al., 2000
), but
ectopic expression of Lim1 plus the ensuing ectopic expression of Al
(Fig. 6F)
(Tsuji et al., 2000
) produce
loss of Bar expression (Fig.
3D-D'') (Pueyo et al.,
2000
). The repression of Lim1 plus Al on Bar expression is
reciprocal, as ectopic Bar represses Al and Lim1 expression
(Fig.
6I-I'''; compare with H-H''')
(Tsuji et al., 2000
),
producing the loss of pretarsal structures
(Fig. 6E), whereas loss of Bar
leads to ectopic expression of Lim1 (Fig.
6G). Thus, mutual antagonism between Al plus Lim1 in the pretarsus
and Bar in the tarsus leads to mutually exclusive patterns of expression, and
establishes a sharp pretarsus-tarsus boundary that is crucial for both tarsus
five and claw organ development (Kojima et
al., 2000
; Pueyo et al.,
2000
).
|
|
| Discussion |
|---|
|
|
|---|
A regulatory network of transcription factors controls distal leg development
Bar and ap genes are expressed in the fourth tarsal
segment and are required for its proper development, whereas the al
and Lim1 genes are expressed and required in the pretarsus
(Kojima et al., 2000
;
Pueyo et al., 2000
;
Tsuji et al., 2000
). All of
these genes encode putative transcription factors and display canonical
regulatory relationships. Thus, al activates lim1 expression
and then both genes cooperate to repress Bar expression in the
pretarsus. Reciprocally, Bar represses al and lim1
expression while activating the expression of ap in tarsus four.
After the refinement of their gene expression domains by these regulatory
interactions, Bar directs tarsus five development, whereas
cooperation between al and lim1 directs pretarsus
development (Pueyo et al.,
2000
), and cooperation between Bar and ap
directs tarsus four (this study). Our results offer more evidence for the
existence of this regulatory network, but also suggest an interesting role for
direct protein interactions in its mechanism.
The cooperation between Bar and Ap on the one hand, and Al and Lim1 on the
other, is likely to be carried out by transcriptional complexes involving Chip
(Fig. 8). The Chip protein is
required for development of the tarsus four, five and pretarsus, and Gst
experiments reveal its ability to bind Ap, Bar, Lim1 and Al
(Lilly et al., 1999
;
Milan et al., 1998
) (this
work). However, our results also show that modulation of LIM-HOM protein
activity by Chip alone does not explain distal leg development. For example,
Ap function is not modulated primarily by Chip and Dlmo. The relative amount
of Chip and Ap has to be grossly unbalanced before a phenotype is obtained in
the leg (Pueyo et al., 2000
)
(this work), and dlmo is not expressed or required in leg
development. Furthermore, the interaction between Ap and Chip does not confer
the developmental specificity that allows LIM-HOM proteins to produce
different outcomes in different parts of the leg. First, Ap and Chip also
interact in the wing and the CNS. Second, a chimaeric Lim3-Ap protein
containing the LIM domains of Lim3 and the HOM domain of Ap does not behave as
a dominant negative when expressed in tarsus four, and is even able to fulfil
Ap function and rescue ap mutants. In the distal leg, developmental
specificity seems to be achieved at the level of DNA binding and the
transcriptional control of targets genes, mediated by partnerships between
LIM-HOM and HOM proteins.
|
The notion of a protein complex involving Ap, Chip and Bar together is also supported by the Gst pull-down assays. The domain of Chip involved in Ap binding, the LID, is not involved in Bar binding. However, the LID and the dimerisation domains of Chip are necessary to rescue the dominant-negative effect of UAS-Bar on tarsus four, suggesting a requirement for the formation of a complex with a LIM-HOM protein such as Ap. In agreement with this view, the Ap protein, and the LIM domains of Ap alone, are able to retain Bar protein in a Gst assay.
In the pretarsus, Al and Lim1 are possibly engaged in a partnership with
Chip similar to that suggested for Ap, Chip and Bar. Synergistic cooperation
between Al and Lim1 is required to direct pretarsus development and to repress
Bar expression and function. Their cooperation entails a close functional
relationship because a proper balance of Al, Lim1 and Chip is required, as is
shown by the loss of pretarsal structures in UAS-Chip or
UAS-Lim1 flies. Ectopic expression of LIM-HOM proteins in the
pretarsus also disrupts pretarsal development without affecting Lim1 and Al
expression. The possibility of direct protein interactions between Al, Lim1
and Chip is also suggested by the reciprocal ability of Al to interfere
posttranscriptionally with Bar and Ap in tarsus four, and by the binding of
Chip to Lim1 and to Al in in vitro experiments
(Fig. 5)
(Lilly et al., 1999
).
Different developmental outcomes correlate with different sets of interacting proteins
Comparison of tarsal development with other developmental processes
illustrates how LIM-HOM proteins are versatile factors to regulate
developmental processes. It had been observed that the outcome of LIM-HOM
activity depends on their developmental context. This context we can now
analyse as being composed of the presence, concentration and relative
affinities of other LIM-HOM proteins, Ldb adaptors, and other cofactors such
as LMO proteins and HOM proteins (Fig.
8). We propose that the different developmental outcomes of
LIM-HOM protein function could be due to the precise identity and dosage of
cofactors available locally.
Ectopic expression experiments distort these contexts and lead to
non-functional or misplaced LIM-HOM activities. In the wing, a finely balanced
amount of functional Ap protein is modulated by Dlmo and Chip
(Fig. 8A). Over-abundance of
Chip stops the formation of functional tetramers in the wing but not in the
CNS, where the relative amount of Ap, which is not modulated by Dlmo, is
limiting for the formation of Ap-Chip functional complexes
(Fig. 8B) (Fernández-Fúnez et al.,
1998
; Milan and Cohen,
1999
; Milan et al.,
1998
; OKeefe et al.,
1998
; van Meyel et al.,
1999
; van Meyel et al.,
2000
). In tarsus four (Fig.
8C), the Ap-Chip-Bar partnership is affected by experimentally
induced over-abundance of Chip, presumably also because ectopic Ap-Chip
tetramers typical of the CNS and the wing, and Bar-Chip complexes typical of
tarsus five, are produced. Similarly, an excess of Bar might be interpreted by
the cells as being a wrong developmental outcome, as high levels of Bar in the
absence of Ap direct tarsus five development
(Fig. 8D)
(Kojima et al., 2000
).
Overexpression of Ap rescues this Bar dominant-negative effect, by restoring
the relative amounts of Bar and Ap, which are determinant and limiting for
tarsus four development. Finally, the dominant-negative effects produced by
overexpression of either Chip or Lim1 in the pretarsus could either prevent
the formation of Al-Chip-Lim1 complexes
(Fig. 8E), or could favour the
existence of Lim1-Chip complexes typical of the CNS
(Lilly et al., 1999
).
The wing and the CNS models have postulated that Ap function is carried out
by an Ap-Chip tetramer; however, the molecular scenario might be more complex.
A new component of Ap-Chip complexes, named Ssdp, has been identified and is
required for the nuclear localisation of the complex
(Chen et al., 2002
;
van Meyel et al., 2003
). Thus
it is possible that an Ap-Chip tetramer also contains two molecules of Ssdp.
In addition, different types of Chip-mediated transcriptional complexes and
different regulators have been identified in other developmental contexts,
such as in sensory organ development and thorax closure, in which the GATA
factor Pannier forms a complex with Chip and with the bHLH protein
Daughterless. Heterodimers of this complex are negatively regulated by a
protein interaction with Osa (Heitzler et
al., 2003
; Ramain et al.,
2000
). Thus, although our results indicate that in different
segments of the leg there exist specific interactions between LIM-HOM, Chip
and HOM proteins, the involvement of further elements in these multiprotein
complexes is not excluded.
Partnership between Prd-HOM and LIM-HOM proteins in flies and vertebrates
Our results support a partnership between HOM and LIM-HOM proteins in the
specification of distinct segments of the leg, and the results are compatible
with Ap-Chip-Bar, Bar-Chip and Lim1-Chip-Al forming transcriptional complexes.
Although the characterisation of the target sequences, followed by further
biochemical and molecular assays, is necessary to study the transcriptional
mechanism of these interactions, it has been shown that LIM-HOM proteins can
interact specifically and directly with other transcription factors to
regulate particular genes. For instance, mouse Lim1 (Lhx1) interacts directly
with the HOM protein Otx2 (Nakano et al.,
2000
). In addition, the bHLH E47 transcription factor interacts
with Lmx1, and both synergistically activate the insulin gene
(Johnson et al., 1997
). This
interaction is specific to Lmx1, as E47 is unable to interact with other
LIM-HOM proteins such as Islet (Johnson et
al., 1997
). Moreover, Chip is able to bind to other Prd-HOM
proteins, such as Otd, Bcd and Fz, to activate downstream genes
(Nakano et al., 2000
;
Perea-Gomez et al., 1999
;
Shawlot et al., 1999
;
Varela-Echavarría et al.,
1996
). Chip also complexes with Lhx3 and the HOM protein P-Otx,
increasing their transcriptional activity
(Bach et al., 1997
). Our
results reinforce the notion of Chip as a multifunctional transcriptional
adaptor that has specific domains involved in each interaction.
Experiments in Drosophila have demonstrated a conservation of
LIM-HOM activity at the functional and developmental level in the CNS between
Drosophila and vertebrates
(Thaler et al., 2002
;
Thor et al., 1999
). In
addition, xenorescue experiments have shown that the mechanism of action of Ap
and its vertebrate homologue Lhx2 is very conserved in Drosophila
wings (Rincón-Limas et al.,
1999
), whereas ectopic expression of dominant-negative forms of
chick Lim1, Chip, Ap and Lhx2 mimic both Ap and Lhx2 loss-of-function
phenotypes (Bach et al., 1999
;
Milan and Cohen, 1999
;
OKeefe et al., 1998
;
Rodríguez-Esteban et al.,
1998
; van Meyel et al.,
1999
). The developmental role of Ap, Bar and Al in the fly leg,
and their putative molecular interactions may also have been conserved because
their vertebrate homologues Lhx2, Barx and Al4 are also co-expressed in the
limb bud (Barlow et al., 1999
;
Qu et al., 1997
;
Rincón-Limas et al.,
1999
). We would expect that the interactions between the LIM-HOM
and Prd-HOM proteins shown here represent a conserved mechanism to specify
different cellular fates during animal development.
| REFERENCES |
|---|
|
|
|---|
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A.,
Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A.,
Galle, R. F. et al. (2000). The genome sequence of Drosophila
melanogaster. Science
287,2185
-2195.
Arber, S. and Caroni, P. (1996). Specificity of
single LIM motifs in targeting and LIM/LIM interactions in situ.
Genes Dev. 10,289
-300.
Bach, I. (2000). The LIM domain: regulation by association. Mech. Dev. 91, 5-17.[CrossRef][Medline]
Bach, I., Rhodes, S. J., Pearse, R. V., Heinzel, T., Gloss, B.,
Scully, K. M., Sawchenko, P. E. and Rosenfeld, M. G. (1995).
P-LIM, a LIM homeodomain factor, is expressed during pituitary organ and cell
commitment and synergizes with Pit-1. Proc. Natl. Acad. Sci.
USA 92,2720
-2724.
Bach, I., Carriere, C., Ostendorff, H. P., Andersen, B. and
Rosenfeld, M. G. (1997). A family of LIM domain-associated
cofactors confer transcriptional synergism between LIM and Otx homeodomain
proteins. Genes Dev. 11,1370
-1380.
Bach, I., Rodriguez-Esteban, C., Carriere, C., Bhushan, A., Krones, A., Rose, D. W., Glass, C. K., Andersen, B., Izpisua Belmonte, J. C. and Rosenfeld, M. G. (1999). RLIM inhibits functional activity of LIM homeodomain transcription factors via recruitment of the histone deacetylase complex. Nat. Genet. 22,394 -399.[CrossRef][Medline]
Barlow, A. J., Bogardi, J. P., Ladher, R. and Francis-West, P. H. (1999). Expression of chick Barx-1 and its differential regulation by FGF-8 and BMP signaling in the maxillary primordia. Dev. Dyn. 214,291 -302.[CrossRef][Medline]
Bishop, S. A., Klein, T., Arias, A. M. and Couso, J. P. (1999). Composite signalling from Serrate and Delta establishes leg segments in Drosophila through Notch. Development 126,2993 -3003.[Abstract]
Campbell, G. (2002). Distalization of the Drosophila leg by graded EGF-recepton activity. Nature 418,781 -785.[CrossRef][Medline]
Campbell, G. and Tomlinson, A. (1998). The roles of the homeobox genes aristaless and Distal-less in patterning the legs and wings of Drosophila. Development 125,4483 -4493.[Abstract]
Chen, L., Segal, D., Hukriede, N. A., Podtelejnikov, A. V.,
Bayarsaihan, D., Kennison, J. A., Ogryzko, V. V., Dawid, I. B. and Westphal,
H. (2002). Ssdp proteins interact with the LIM-domain-binding
protein Ldb1 to regulate development. Proc. Natl. Acad. Sci.
USA 99,14320
-14325.
Cohen, B., McGuffin, M. E., Pfeifle, C., Segal, D. and Cohen, S.
M. (1992). apterous, a gene required for imaginal disc
development in Drosophila encodes a member of the LIM family of developmental
regulatory proteins. Genes Dev.
6, 715-729.
Curtiss, J. and Heilig, J. S. (1998). DeLIMiting development. BioEssays 20, 58-69.[CrossRef][Medline]
Dawid, I. B., Breen, J. J. and Toyama, R. (1998). LIM domains: multiple roles as adapters and functional modifiers in protein interactions. Trends Genet. 14,156 -162.[CrossRef][Medline]
de Celis, J. F., Tyler, D. M., de Celis, J. and Bray, S. J. (1998). Notch signalling mediates segmentation of the Drosophila leg. Development 125,4617 -4626.[Abstract]
Fernández-Fúnez, P., Lu, C. H., Rincón-Limas, D. E., García-Bellido, A. and Botas, J. (1998). The relative expression amounts of apterous and its co-factor dLdb/Chip are critical for dorso-ventral compartmentalization in the Drosophila wing. EMBO J. 17,6846 -6853.[CrossRef][Medline]
Galindo, M. I. and Couso, J. P. (2000). Intercalation of cell fates during tarsal development in Drosophila. BioEssays 22,777 -780.[CrossRef][Medline]
Galindo, M. I., Bishop, S. A. and Couso, J. P.
(2002). Leg patterning driven by proximal-distal interactions and
EGFR signaling. Science
297,256
-259.
Gehring, W. J., Affolter, M. and Burglin, T. (1994). Homeodomain proteins. Annu. Rev. Biochem. 63,487 -526.[CrossRef][Medline]
German, M. S., Wang, J., Chadwick, R. B. and Rutter, W. J.
(1992). Synergistic activation of the insulin gene by a LIM-homeo
domain protein and a basic helix-loop-helix protein: building a functional
insulin minienhancer complex. Genes Dev.
6,2165
-2176.
Heitzler, P., Vanolst, L., Biryukova, I. and Ramain, P.
(2003). Enhancer-promoter communication mediated by Chip during
Pannier-driven proneural patterning is regulated by Osa. Genes
Dev. 17,591
-596.
Hobert, O. and Westphal, H. (2000). Functions of LIM-homeobox genes. Trends Genet. 16, 75-83.[CrossRef][Medline]
Johnson, J. D., Zhang, W., Rudnick, A., Rutter, W. J. and German, M. S. (1997). Transcriptional synergy between LIM-homeodomain proteins and basic helix-loop-helix proteins: the LIM2 domain determines specificity. Mol. Cell. Biol. 17,3488 -3496.[Abstract]
Jurata, L. W. and Gill, G. N. (1998). Structure and function of LIM domains. Curr. Top. Microbiol. Immunol. 228,75 -113.[Medline]
Jurata, L. W., Pfaff, S. L. and Gill, G. N.
(1998). The nuclear LIM domain interactor NLI mediates homo- and
heterodimerization of LIM domain transcription factors. J. Biol.
Chem. 273,3152
-3157.
Kojima, T., Sato, M. and Saigo, K. (2000). Formation and specification of distal leg segments in Drosophila by dual Bar homeobox genes, BarH1 and BarH2. Development 127,769 -778.[Abstract]
Lilly, B., OKeefe, D. D., Thomas, J. B. and Botas, J. (1999). The LIM homeodomain protein dLim1 defines a subclass of neurons within the embryonic ventral nerve cord of Drosophila. Mech. Dev. 88,195 -205.[CrossRef][Medline]
Lundgren, S. E., Callahan, C. A., Thor, S. and Thomas, J. B. (1995). Control of neuronal pathway selection by the Drosophila LIM homeodomain gene apterous. Development 121,1769 -1773.[Abstract]
Milan, M. and Cohen, S. S. (1999). Regulation of LIM homeodomain activity in vivo: a tetramer of dLDB and Apterous confers activity and capacity for regulation by dLMO. Mol. Cell 4,267 -273.[CrossRef][Medline]
Milan, M. and Cohen, S. M. (2000). Temporal regulation of apterous activity during development of the Drosophila wing. Development 127,3069 -3078.[Abstract]
Milan, M., Diaz-Benjumea, F. J. and Cohen, S. M.
(1998). Beadex encodes an LMO protein that regulates Apterous
LIM-homeodomain activity in Drosophila wing development: a model for LMO
oncogene function. Genes Dev.
12,2912
-2920.
Morcillo, P., Rosen, C., Baylies, M. K. and Dorsett, D.
(1997). Chip, a widely expressed chromosomal protein required for
segmentation and activity of a remote wing margin enhancer in Drosophila.
Genes Dev. 11,2729
-2740.
Nakano, T., Murata, T., Matsuo, I. and Aizawa, S. (2000). OTX2 directly interacts with LIM1 and HNF-3beta. Biochem. Biophys. Res. Commun. 267, 64-70.[CrossRef][Medline]
OKeefe, D. D., Thor, S. and Thomas, J. B. (1998). Function and specificity of LIM domains in Drosophila nervous system and wing development. Development 125,3915 -3923.[Abstract]
Perea-Gomez, A., Shawlot, W., Sasaki, H., Behringer, R. R. and Ang, S. L. (1999). HNF3B and Lim1 interact in the visceral endoderm to regulate primitive streak formation and anterior-posterior polarity in the mouse embryo. Development 126,4499 -4511.[Abstract]
Pueyo, J. I., Galindo, M. I., Bishop, S. A. and Couso, J. P. (2000). Proximal-distal leg development in Drosophila requires the apterous gene and the Lim1 homologue dlim1. Development 127,5391 -5402.[Abstract]
Qu, S., Niswender, K. D., Ji, Q., van der Meer, R., Keeney, D., Magnuson, M. A. and Wisdom, R. (1997). Polydactyly and ectopic ZPA formation in Alx-4 mutant mice. Development 124,3999 -4008.[Abstract]
Ramain, P., Khechumian, R., Khechumian, K., Arbogast, N., Ackermann, C. and Heitzler, P. (2000). Interactions between Chip and the Achaete/Scute-Daughterless heterodimers are required for Pannier-driven proneural patterning. Mol. Cell 6, 781-790.[CrossRef][Medline]
Rauskolb, C. (2001). The establishment of segmentation in the Drosophila leg. Development 128,4511 -4521.
Rauskolb, C. and Irvine, K. D. (1999). Notch-mediated segmentation and growth control of Drosophila leg. Dev. Biol. 210,339 -350.[CrossRef][Medline]
Rincón-Limas, D. E., Lu, C. H., Canal, I., Calleja, M.,
Rodríguez-Esteban, C., Izpisúa-Belmonte, J. C. and Botas, J.
(1999). Conservation of the expression and function of apterous
orthologs in Drosophila and mammals. Proc. Natl. Acad. Sci.
USA 96,2165
-2170.
Rincon-Limas, D. E., Lu, C. H., Canal, I. and Botas, J. (2000). The level of DLDB/CHIP controls the activity of the LIM homeodomain protein Apterous: evidence for a functional tetramer complex in vivo. EMBO J. 19,2602 -2614.[CrossRef][Medline]
Rodríguez-Esteban, C., Schwabe, J. W., Peña, J. D., Rincón-Limas, D. E., Magallón, J., Botas, J. and Belmonte, J. C. (1998). Lhx2, a vertebrate homologue of apterous, regulates vertebrate limb outgrowth. Development 125,3925 -3934.[Abstract]
Schmeichel, K. L. and Beckerle, M. C. (1994). The LIM domain is a modular protein-binding interface. Cell 79,211 -219.[CrossRef][Medline]
Shawlot, W., Wakamiya, M., Kwan, K. M., Kania, A., Jessell, T. M. and Behringer, R. R. (1999). Lim1 is required in both primitive streak-derived tissues and visceral endoderm for head formation in the mouse. Development 126,4925 -4932.[Abstract]
Shoresh, M., Orgad, S., Shmueli, O., Werczberger, R., Gelbaum,
D., Abiri, S. and Segal, D. (1998). Overexpression Beadex
mutations and loss-of-function heldup-a mutations in Drosophila affect the
3' regulatory and coding components, respectively, of the Dlmo gene.
Genetics 150,283
-299.
Thaler, J. P., Lee, S., Jurata, L. W., Gill, G. N. and Pfaff, S. L. (2002). LIM factor Lhx3 contributes to the specification of motor neuron and interneuron identity through cell-type-specific protein-protein interactions. Cell 110,237 -249.[CrossRef][Medline]
Thor, S. and Thomas, J. B. (1997). The Drosophila islet gene governs axon pathfinding and neurotransmitter identity. Neuron 18,397 -409.[CrossRef][Medline]
Thor, S., Andersson, S. G., Tomlinson, A. and Thomas, J. B. (1999). A LIM-homeodomain combinatorial code for motor-neuron pathway selection. Nature 397, 76-80.[CrossRef][Medline]
Torigoi, E., Bennani-Baiti, I. M., Rosen, C., Gonzalez, K.,
Morcillo, P., Ptashne, M. and Dorsett, D. (2000). Chip
interacts with diverse homeodomain proteins and potentiates Bicoid activity in
vivo. Proc. Natl. Acad. Sci. USA
97,2686
-2691.
Tsuji, T., Sato, A., Hiratani, I., Taira, M., Saigo, K. and Kojima, T. (2000). Requirements of Lim1, a Drosophila LIM-homeobox gene, for normal leg and antennal development. Development 127,4315 -4323.[Abstract]
van Meyel, D. J., OKeefe, D. D., Jurata, L. W., Thor, S., Gill, G. N. and Thomas, J. B. (1999). Chip and Apterous physically interact to form a functional complex during Drosophila development. Mol. Cell 4, 259-265.[CrossRef][Medline]
van Meyel, D. J., OKeefe, D. D., Thor, S., Jurata, L. W., Gill, G. N. and Thomas, J. B. (2000). Chip is an essential cofactor for Apterous in the regulation of axon guidance in Drosophila. Development 127,1823 -1831.[Abstract]
van Meyel, D. J., Thomas, B. J. and Agulnick, A. D.
(2003). Ssdp proteins bind to LIM-interacting co-factors and
regulate the activity of LIM-homeodomain protein complexes in vivo.
Development 130,1915
-1925.
Varela-Echavarría, A., Pfaff, S. L. and Guthrie, S. (1996). Differential expression of LIM homeobox genes among motor neuron subpopulations in the developing chick brain stem. Mol. Cell. Neurosci. 8,242 -257.[CrossRef][Medline]
Weihe, U., Milan, M. and Cohen, S. M. (2001). Regulation of Apterous activity in Drosophila wing development. Development 128,4615 -4622.
Zeng, C., Justice, N. J., Abdelilah, S., Chan, Y. M., Jan, L. Y.
and Jan, Y. N. (1998). The Drosophila LIM-only gene, dLMO, is
mutated in Beadex alleles and might represent an evolutionarily conserved
function in appendage development. Proc. Natl. Acad. Sci.
USA 95,10637
-10642.
This article has been cited by other articles:
![]() |
C. T. Fulp, G. Cho, E. D. Marsh, I. M. Nasrallah, P. A. Labosky, and J. A. Golden Identification of Arx transcriptional targets in the developing basal forebrain Hum. Mol. Genet., December 1, 2008; 17(23): 3740 - 3760. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Xu, X. Meng, Y. Cai, H. Liang, L. Nagarajan, and S. J. Brandt Single-stranded DNA-binding proteins regulate the abundance of LIM domain and LIM domain-binding proteins Genes & Dev., April 15, 2007; 21(8): 942 - 955. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Enkhmandakh, A. V. Makeyev, and D. Bayarsaihan The role of the proline-rich domain of Ssdp1 in the modular architecture of the vertebrate head organizer PNAS, August 1, 2006; 103(31): 11631 - 11636. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Melkman and P. Sengupta Regulation of chemosensory and GABAergic motor neuron development by the C. elegans Aristaless/Arx homolog alr-1 Development, April 15, 2005; 132(8): 1935 - 1949. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||