|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 2 June 2004
doi: 10.1242/dev.01190
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Unité de Biologie Moléculaire du Développement,
Unité INSERM 368, Ecole Normale Supérieure, 46, rue dUlm,
75005 Paris, France
2 Unité de Biologie du Développement, UMR CNRS 7622,
Université Pierre et Marie Curie, 9 quai Saint Bernard, 75005 Paris,
France
* Author for correspondence (e-mail: maunoury{at}wotan.ens.fr)
Accepted 24 March 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Iroquois, iro7, vhnf1 (tcf2), Hindbrain, Boundary, Rhombomere, Neurogenesis
| Introduction |
|---|
|
|
|---|
In the hindbrain, AP patterning involves a segmentation process that leads
to the formation of seven transient bulges called rhombomeres (r) and
establishes the reiterated organisation of cranial nerves. The rhombomeres are
segmental units for neuronal differentiation and gene expression, and
constitute cellular compartments (for reviews, see
Lumsden and Krumlauf, 1996
;
Schneider-Maunoury et al.,
1998
; Moens and Prince,
2002
). Hindbrain segmentation is also crucial for patterning and
migration of the neural crest, thereby influencing face and neck morphogenesis
(for a review, see Trainor and Krumlauf,
2000
), and for the formation of the otic vesicle, the prospective
inner ear (for a review, see Torres and
Giraldez, 1998
).
Rhombomere formation proceeds by successive steps. Before segmentation is
morphologically conspicuous, regulatory genes such as the Hox genes
hoxb1b (Hoxa1) and hoxb1a (Hoxb1),
valentino (mafb Zebrafish Information Network; the
zebrafish orthologue of Mafb), a gene coding for a bZIP transcription
factor, and krx20 (egr2b Zebrafish Information
Network; Egr2), a gene coding for a zinc-finger transcription factor,
are activated in the hindbrain, in distinct territories but with undefined
limits (Wilkinson et al.,
1989
; Murphy and Hill,
1991
; Cordes and Barsh,
1994
) (for reviews, see
Schneider-Maunoury et al.,
1998
; Moens and Prince,
2002
). These transcription factors are involved both in the
formation of different rhombomeres or groups of rhombomeres, and in the
specification of their identity
(Giudicelli et al., 2001
;
McClintock et al., 2001
;
Voiculescu et al., 2001
;
McClintock et al., 2002
;
Giudicelli et al., 2003
)
(reviewed by Morrison, 1998
;
Schneider-Maunoury et al.,
1998
). In a second step, the limits of gene expression sharpen and
later correspond to morphologically conspicuous rhombomere boundaries
(Irving et al., 1996
;
Moens and Prince, 2002
).
Boundary formation is triggered by cell segregation at the interfaces between
adjacent prerhombomeric territories
(Guthrie and Lumsden, 1991
;
Guthrie et al., 1993
;
Wizenmann and Lumsden, 1997
).
This cell-sorting mechanism is mediated by Eph/ephrin interactions
(Xu et al., 1995
;
Xu et al., 1999
). Finally, the
establishment of a specific pattern of gene expression, including Hox genes,
in each rhombomere specifies positional identity along the AP axis and the
fate of neuronal derivatives (Bell et al.,
1999
; Jungbluth et al.,
1999
) (reviewed by Rijli et
al., 1998
; Schneider-Maunoury
et al., 1998
). Inter-rhombomeric signalling is also involved in
rhombomere specification, and in this respect r4 plays an important role in
adjacent rhombomeres (Graham and Lumsden,
1996
; Helmbacher et al.,
1998
; Marin and Charnay,
2000
; Maves et al.,
2002
; Walshe et al.,
2002
).
The mechanisms that lead to the activation of regulatory genes such as
krx20 and val at precise positions along the AP axis and
thereby to the formation of pre-rhombomeric territories during gastrulation
are not well understood. In the posterior hindbrain, the expression of the
homeobox gene vhnf1 (tcf2 Zebrafish Information
Network) is activated at the end of gastrulation, with a rostral limit that
has been shown to lie within prospective r5
(Sun and Hopkins, 2001
;
Wiellette and Sive, 2003
).
val and krx20 are activated at the beginning of
somitogenesis, in prospective r5 and r6, and r3 and r5, respectively
(Wilkinson et al., 1989
;
Cordes and Barsh, 1994
).
Recent studies have shown that, in zebrafish embryos, the activation of
val in r5 and r6 and of krx20 in r5 depends both on
vhnf1 and on FGF3/8 signalling from r4
(Sun and Hopkins, 2001
;
Maves et al., 2002
;
Walshe et al., 2002
;
Wiellette and Sive, 2003
).
However, the mechanisms involved in the establishment of the vhnf1
expression domain, and in particular in the positioning of its anterior limit,
are not known.
We have investigated the function of a zebrafish gene of the Iroquois (Iro)
family, iro7. Iro genes code for homeodomain transcription factors of
the TALE (three amino-acid loop extension) superfamily
(Burglin, 1997
). They are
characterised by a highly conserved, 12 amino acid long domain called the
Irobox (Cavodeassi et al.,
2001
). Iro genes were first described in Drosophila,
where they perform essential functions in the patterning of the eye/antenna
and wing imaginal discs (for reviews, see
Cavodeassi et al., 2001
;
Gomez-Skarmeta and Modolell,
2002
). Vertebrate Iro genes are involved in various embryonic
patterning processes, such as heart, ectoderm and neural tube regionalisation
(for reviews, see Cavodeassi et al.,
2001
; Gomez-Skarmeta and
Modolell, 2002
). They have also been shown to participate in the
activation of proneural gene expression, both in Drosophila and
vertebrates (Gomez-Skarmeta et al.,
1996
; Gomez-Skarmeta et al.,
1998
; Itoh et al.,
2002
).
iro7 is a divergent member of the Iro family. Its closest
relatives are the members of the irx1/irx3 paralogous group,
suggesting that iro7 is an orthologue of these genes that has
diverged after duplication of the teleost genome
(Lecaudey et al., 2001
;
Itoh et al., 2002
).
iro7 shows an AP regionally restricted expression in the neural plate
as early as 70% epiboly. At this stage, it is expressed in a large bilateral
stripe, covering the neural plate and the future neural crest and placodal
regions, and encompassing the prospective midbrain and hindbrain territories
along the AP axis (Lecaudey et al.,
2001
; Itoh et al.,
2002
). Another zebrafish Iro gene, iro1, shows a similar
expression pattern at the same stage, but its caudal limit is anterior to that
of iro7 (Itoh et al.,
2002
). iro7 is necessary for the determination of neurons
of the trigeminal placode, and iro1 and iro7 play partially
redundant roles in the formation of the midbrain-hindbrain boundary
(Itoh et al., 2002
).
In this paper, we study the formation of the prospective r4/r5 boundary at the end of gastrulation. We show that the position of this boundary is set up by mutual repression between two transcription factors, Iro7 and vHnf1. In addition, iro7 is required for neurogenesis in the rostral hindbrain. Thus, iro7 is involved in two different aspects of the specification of hindbrain neuronal derivatives: AP patterning and neurogenesis.
| Materials and methods |
|---|
|
|
|---|
Constructs
A cDNA encoding full-length vhnf1 was cloned by RT-PCR from total
RNA extracted from six- to eight-somite stage embryos. iro7 and
vhnf1 cDNAs encoding full-length proteins were subcloned into the
CS2+ vector (Rupp et al.,
1994
). The iro7myc expression vector was made by cloning
iro7 cDNA in the CS2+MT vector
(Rupp et al., 1994
). An
inducible form of Iro7 was constructed by fusing the ligand binding domain of
the human glucocorticoid receptor (hGR) (from pCS2mcs-hGR, a gift from U.
Strähle and P. Blader), to the C-terminal end of Iro7. A mutant form of
vhnf1, vhnf1Q139E, was made by introducing a point
mutation in the POU domain using the ExSite PCR-Based Site-Directed
Mutagenesis Kit (Stratagene).
N-iro7 (a gift from A. Chitnis)
codes for a modified Iro7 protein missing the first nine amino acids, thus
preventing its hybridisation with Moz7
(Itoh et al., 2002
).
RNA and morpholino injection
Capped RNAs were transcribed with SP6 RNA polymerase using the mMessage
mMachine Kit (Ambion). An antisense morpholino (Gene-Tools, Inc., Oregon, USA)
was designed to target iro7 (Moz7): 5'
GGCATCCTTACTCCCTGAGCTCTGG 3', as well as a control morpholino (Moz7m):
5' GGgATCgTTAgTCCgTGAcCTCaGG 3', containing six mismatches.
Morpholinos were injected at a concentration of 1 mM. In some RNA injections,
nls-lacZ (75 ng/µl) or GFP (100 ng/µl) RNAs were added
as lineage tracers. The translocation of the Iro7hGR protein into the nucleus
was induced by transferring embryos into medium containing 10 µM
Dexamethasone (Sigma D-4902) at 40% epiboly.
Whole mount in situ hybridisation and immunohistochemistry
In situ hybridisation and immunohistochemistry were performed as previously
described (Hauptmann and Gerster,
1994
). iro7 (HindIII, T7), ngn1
(neurog1 Zebrafish Information Network; EcoRI, T7),
wnt1 (EcoRI, Sp6) (gifts from A. Chitnis), six3
(EcoRI, T3) and vhnf1 (NotI, T7) (gifts from B.
Thisse and C. Thisse), hoxb1a, hoxa2 and hoxb3
(Prince et al., 1998
),
krox20 (Oxtoby and Jowett,
1993
), val (Moens et
al., 1998
), fgf3
(Kudoh et al., 2001
),
fgf8 (Furthauer et al.,
1997
), and pax2.1 (pax2a Zebrafish
Information Network) (Krauss et al.,
1991
) DNAs were used as templates for making RNA probes. For
sectioning, embryos were embedded in resin (JB4, Polysciences). For
immunohistochemistry, the following antibodies were used: mouse
anti-neurofilament 3A10 (DSHB) (Hatta,
1992
) and RMO44 (Zymed 13-0500)
(Popperl et al., 2000
)
antibodies, mouse Islet 39.4D5 (DSHB)
(Ericson et al., 1992
), rabbit
anti-ß-galactosidase (Cappel 55976), rabbit anti-GFP (Molecular Probes
A11122) and rabbit anti-Myc epitope (Upstate Biotechnology 06-549).
In vitro translation
Capped iro7 RNA (20 ng/µl) was translated in vitro in the
presence of increasing concentrations of Moz7 or Moz7m (0.4 µM to 80 µM)
using [35S] methionine in a Rabbit reticulocyte lysate
(Promega).
Statistical analyses
In Fig. 4,
vhnf1 expression domain AP length corresponds to the
distance between the anterior and posterior borders of the vhnf1
expression domain, including the most anterior domain of weaker expression.
P is the probability associated with Students t-test.
The error bars correspond to the standard deviation.
|
| Results |
|---|
|
|
|---|
|
|
In order to better characterise the anterior hindbrain defects, we analysed
the expression of hoxa2, fgf8 and fgf3 at the end of
gastrulation and/or beginning of somitogenesis. hoxa2 is expressed in
future r2 and r3 from the 2 s stage onwards
(Prince et al., 1998
).
fgf8 is expressed in the anterior hindbrain, in a large domain that
resolves at the 1 s stage into domains at the MHB/r1, ventral r2 and r4
(Maves et al., 2002
;
Walshe et al., 2002
).
fgf3 is activated in a transverse stripe in the hindbrain at 90%
epiboly, and is expressed at a high level in r4 at early somite stages
(Maves et al., 2002
;
Walshe et al., 2002
). In
Moz7-injected embryos, the expression domains of hoxa2 in r2-r3
(Fig. 2H), fgf8 in
MHB-r4 (Fig. 2J) and
fgf3 in r4 (Fig. 2L,N)
were reduced in intensity and AP extent when compared with control embryos
(Fig. 2I,K,M,O), but none of
them was totally absent.
iro7 loss of function results in anterior expansion of r5 at the expense of r4
We then investigated the phenotypes caused by the loss of iro7 function at
its posterior expression border. In Moz7 injected embryos stained for
krx20, r3 and r5 were differently affected. Whereas the r3 stripe was
occasionally reduced, consistent with the reduction in size of the anterior
hindbrain, the r5 stripe was always expanded
(Fig. 2F-I;
Fig 3A-D). In addition, the gap
between the r3 and r5 stripes was strongly reduced, suggesting that the r5
domain of krx20 expression [krx20 (r5)] expanded anteriorly
into r4. This phenotype was already detectable at the onset of krx20
expression: whereas the r3 stripe was slightly thinner, the r5 stripe was
stronger and cells expressing krx20 were present in r4
(Fig. 3E-H). To evaluate more
accurately the anterior expansion of r5 and the reduction of r4, we measured
the AP length of r4 and r5 on a batch of flat-mounted 6 s stage embryos. The
anterior expansion of the krx20 (r5) stripe was detected in 100% of
the injected embryos (n=29), when compared to control embryos
(n=11), and covered about half of r4 (mean increase of krx20
(r5) AP length: 40%, P<0.01). Isolated krx20-expressing
cells were often present in r4 (Fig.
3C,G). These cells were mostly localised medially in the neural
plate and then ventrally in the neural tube, often forming a bridge of
krx20-expressing cells between r3 and r5. To check if the expansion
of krx20 (r5) expression was specifically due to the inhibition of
iro7 translation by Moz7, we tried to rescue this phenotype by
injecting
N-iro7, a modified form of iro7 that does
not hybridise with the morpholino. The injection of
N-iro7
together with the morpholino led to a recovery of the size of r5, which was
not statistically different from that of control embryos [mean increase 4.7%
(n=19) compared with 40% (n=29) for Moz7-injected embryos].
The number of isolated krx20-expressing cells in r4 was also
significantly reduced in rescued embryos (data not shown).
|
hoxb1a is activated at 90% epiboly in a broad domain with an
anterior border at the r3/r4 boundary
(Prince et al., 1998
). Shortly
after its activation, hoxb1a expression is upregulated in r4 and
maintained at a high level in this rhombomere
(McClintock et al., 2001
)
(Fig. 3N). In Moz7-injected
embryos, hoxb1a expression was activated normally at 90% epiboly in
the caudal neural plate (data not shown) but was not reinforced in r4 at the
end of gastrulation, as it was in control embryos
(Fig. 3M,N). Later, the AP
extent of the r4 hoxb1a expression domain was reduced when compared
with controls, and coincided with the gap between krx20-expressing
cells in r3 and r5 (Fig. 3O,P).
In this domain, cells lacking hoxb1a expression were frequently
observed ventrally (Fig. 3O,
inset in O). These gaps of hoxb1a expression coincided with the
bridges of krx20-expressing cells in r4 (arrowheads in
Fig. 3O).
In conclusion, the loss of iro7 function leads to an anterior expansion of r5 at the expense of r4: the krx20 (r5) and val expression domains are expanded anteriorly, and the hoxb1a expression domain in r4 is reduced.
iro7 loss-of-function results in an anterior shift of vhnf1 rostral expression limit
Ectopic expression of vhnf1 leads to ectopic activation of
val and krx20 in r4, and to a reduction of hoxb1a
expression in this rhombomere (Sun and
Hopkins, 2001
; Wiellette and
Sive, 2003
), a phenotype very similar to that obtained after Moz7
injection. Therefore, we tested whether knocking-down iro7 had any
effect on vhnf1 expression, by performing double in situ
hybridisation experiments with probes for vhnf1 and iro7. In
Moz7-injected embryos at 95% epiboly to tailbud stages, the vhnf1
expression territory was expanded anteriorly by about one-third, while the
territory expressing iro7 was reduced
(Fig. 4A-E). We conclude from
these experiments that iro7 is necessary for the repression of
vhnf1 in the anterior hindbrain.
Ectopic expression of iro7 results in a repression of vhnf1, val and krx20 expression
As shown above, iro7 is necessary for the repression of
vhnf1 and, probably as a consequence, of val and
krx20. In order to determine whether iro7 was sufficient to
repress vhnf1, val and krx20 in the caudal hindbrain, we
performed iro7 gain-of-function experiments. Injection of RNA coding
for a Myc-tagged Iro7 protein (Iro7myc) led to frequent gastrulation defects
(data not shown), hampering analysis of hindbrain patterning. Therefore, we
also injected RNA coding for an inducible form of Iro7, Iro7hGR, which
translocates into the nucleus upon dexamethasone (Dex) treatment, and treated
the injected embryos with Dex at 40% epiboly. GFP RNA was co-injected
as a tracer. In embryos injected with either iro7myc or
iro7hGR, we observed a repression of vhnf1
(Fig. 5A,B,D), val
(Fig. 5F,H) and krx20
(Fig. 5J,L,M). However, a high
concentration of RNAs (40 ng/µl for iro7myc and 100 ng/µl for
iro7hGR) was necessary to obtain these effects. Immunostaining with
the anti-GFP or anti-Myc antibodies showed that the domain of repression of
vhnf1, val and krx20 always correlated with the injected
regions, although not all injected cells showed a phenotype
(Fig. 5A,D,H,L,M). In a batch
of injected embryos, the proportion of embryos showing a domain of repression
relative to the embryos expressing GFP or Myc in the region of interest was
22/53 for vhnf1, 14/16 for val and 11/15 for krx20.
None of the GFP-injected control embryos showed repression of
vhnf1, val or krx20 expression
(Fig. 5C,E,G,I,K,N). In
addition, krx20 expression was repressed specifically in r5, even
though GFP staining was present in both r3 and r5
(Fig. 5L,M). Together, these
results show that Iro7 is able to repress vhnf1, val and
krx20 expression. However, this repression is not fully penetrant,
suggesting that Iro7 requires co-factors that are either regionally restricted
or present in limiting amounts.
|
|
Knocking down iro7 results in a loss of primary neurons in the anterior hindbrain
We sought to determine whether the patterning defects observed after Moz7
injection had any consequence on hindbrain neuronal derivatives. Two types of
primary neurons are readily identifiable in the hindbrain of early zebrafish
embryos and follow a segmental pattern: reticulospinal (RS) neurons and
motoneurons (Metcalfe et al.,
1986
; Hanneman et al.,
1988
; Chandrasekhar et al.,
1997
). We analysed the pattern of RS neurons by immunostaining
with the anti-neurofilament antibody RMO44
(Fig. 7A,B). This antibody
identifies the hindbrain RS neurons with characteristic shapes and positions,
such as Mauthner neurons in r4, and RoL2 neurons in r2 (arrowhead and arrow,
respectively, in Fig. 7B)
(Popperl et al., 2000
). We
found that r4-derived Mauthner neurons were always lost in Moz7-injected
embryos (empty arrowhead in Fig.
7A), whereas r2-derived RoL2 neurons were in some cases also
affected (empty arrow in Fig.
7A), although with a lower penetrance. We did not detect any
modification in the pattern of RS neurons caudally to r4
(Fig. 7A,B). To confirm this
phenotype, we used two earlier markers of the Mauthner neurons: the
anti-neurofilament antibody 3A10, which stains strongly Mauthner neurons at 30
hpf (Furley et al., 1990
)
(Fig. 7D), and val,
which is expressed in Mauthner neurons at 20 hpf in addition to r5, r6 and
associated neural crest cells (Moens et
al., 1998
) (Fig.
7F). These two markers confirmed the total loss of Mauthner
neurons in iro7 morphants (empty arrowheads in
Fig. 7C,E). In total,
r4-derived Mauthner cells were lost in 94% of the Moz7-injected embryos
(n=119).
|
We wondered whether these defects in the pattern of primary neurons could
be the result of a downregulation of proneural gene expression. Indeed, recent
data showed that iro7 is involved in the formation of the trigeminal
ganglion and in the expression of the proneural gene ngn1 in the
trigeminal placode; moreover, iro7 ectopic expression is able to
activate ngn1 expression ectopically
(Itoh et al., 2002
).
Consistently, we found that Moz7 injection led to a reduction of ngn1
expression in the anterior hindbrain region at the onset of somitogenesis
(Fig. 7M-P). In r4, the
proneural clusters that give rise to RS interneurons (dorsal clusters, r4 RS)
and to motoneurons (ventral clusters, r4 Mn) were absent after Moz7 injection
(Fig. 7, compare M,O with N,P)
(96% of the injected embryos, n=23).
In conclusion, the knockdown of iro7 leads to an overall reduction in the number of primary neurons derived from the r2 to r4 region, with a more pronounced effect in r4. Moz7 injection also leads to a loss or strong downregulation of ngn1 expression, strongly suggesting that the reduction of RS and motoneuronal populations is due to a function of iro7 in the activation of proneural gene expression in the anterior hindbrain.
| Discussion |
|---|
|
|
|---|
iro7 is required to set up the position of the r4/r5 boundary
Although hindbrain segmentation has been extensively studied, the
mechanisms underlying its early AP patterning and, in particular, those
involved in the formation and positioning of early pre-rhombomeric territories
and of their boundaries are still poorly understood. In zebrafish, the first
boundaries to appear morphologically are the r3/r4 and the r4/r5 boundary
(Maves et al., 2002
). Until
now, the posterior border of the domain expressing hoxb1a at a high
level (prospective r4) was the first evidence of the future r4/r5 boundary.
iro7 is expressed from 70% epiboly in a transversal stripe in the
neural plate (Lecaudey et al.,
2001
; Itoh et al.,
2002
) and we demonstrate in this paper that its posterior
expression border corresponds to the future r4/r5 boundary. Thus, the
posterior border of the iro7 expression domain represents an early
limit in the developing hindbrain at the position of the r4/r5 boundary, in a
way similar to hoxb1b (Hoxa1), whose anterior expression
border prefigures the r3/r4 boundary at mid-gastrulation
(Murphy and Hill, 1991
;
Prince et al., 1998
;
McClintock et al., 2001
).
Slightly later, vhnf1 expression is activated in the posterior neural
plate and is required for the expression of val in r5 and r6 and of
krx20 in r5 (Sun and Hopkins,
2001
). We show that iro7 and vhnf1 have strictly
complementary expression domains between 95% epiboly and 2 s. Thereby,
vhnf1 is the earliest gene expressed in the caudal neural plate in a
domain adjacent to that of iro7 expression. Altogether, these results
make iro7 and vhnf1 good candidates to set up the
prospective r4/r5 boundary by mutual repression.
In this paper, we demonstrate that vhnf1, val and krx20
(r5) expression territories are expanded anteriorly in iro7
morphants, and that ectopic expression of iro7 represses vhnf1,
val and krx20 expression in the posterior hindbrain. Thus,
iro7 is indeed required to set up the position of the r4/r5 boundary
by repressing vhnf1 expression anteriorly. In iro7 ectopic
expression experiments, the repression of vhnf1, val and
krx20 expression by iro7 is not fully penetrant, suggesting
that Iro7 requires co-factors that are either regionally restricted or present
in limiting amount. Consistent with this hypothesis, Iroquois proteins belong
to the TALE superfamily of transcription factors and other members of this
group, such as Meis and Pbx proteins, form multimeric complexes
(Ferretti et al., 2000
;
Choe et al., 2002
).
We propose that the prospective r4/r5 boundary is set up at the end of gastrulation/beginning of somitogenesis by mutual repression between two homeodomain transcription factors, Iro7 and vHnf1. However, the expression domains of these two genes are only transiently complementary, between the 95% epiboly and 2 s stages. Therefore, the maintenance of the boundary may later involve mutual repression between Iro7 and transcription factors such as Val, Krx20 and Hoxb3, which are downstream of vhnf1 and remain expressed in r5. According to this hypothesis, iro7 represses val and krx20 more efficiently than vhnf1. In addition, the initial positioning of this boundary is likely to depend mainly on iro7. Indeed, iro7 expression is established before vhnf1 expression reaches its definitive anterior limit, and therefore cannot depend totally on vhnf1. Consistently, in vhnf1 mutants, the posterior expansion of iro7 expression domain is limited to the length of one rhombomere. Other factors, such as retinoids, could be involved in positioning the iro7 posterior boundary early on. According to this hypothesis, we observed a repression of iro7 expression after treatment with retinoic acid (data not shown). Therefore, the main function of vhnf1 repressive activity on iro7 could be to refine the r4/r5 boundary.
iro7 is a divergent member of the Iro family, more closely related
to the amniote irx1/3 group of paralogues. irx3 is expressed
in the mouse neural plate during gastrulation
(Bosse et al., 1997
;
Bellefroid et al., 1998
). At
the beginning of somitogenesis, the caudal limit of the irx3
expression domain corresponds to the anterior limit of vhnf1
expression and to the prospective r4/r5 boundary (S.S.M., V.L. and S.
Cereghini, unpublished). Thus, mutual repression between Iro and vHnfl
transcription factors and its involvement in the establishment of the r4/r5
boundary may constitute a conserved mechanism among vertebrates.
Setting up the r4 signalling centre
Establishing boundaries by mutual repression between two transcription
factors expressed in adjacent territories is a common theme in early brain
patterning. In several cases, these boundaries act as secondary signalling
centres (Araki and Nakamura,
1999
; Matsunaga et al.,
2000
; Kobayashi et al.,
2002
) (reviewed by Rhinn and
Brand, 2001
; Wurst and
Bally-Cuif, 2001
). Iroquois genes have been implicated in boundary
formation both in Drosophila and vertebrates: in Drosophila,
Iro genes act as dorsal selector genes in the eye/antenna imaginal disc and
are involved in the formation of the DV organiser that prefigures the future
equator in the adult eye (McNeill et al.,
1997
; Cavodeassi et al.,
1999
; Yang et al.,
1999
; Cavodeassi et al.,
2000
). In the chick forebrain, Irx3 is involved in the positioning
of the zona limitans intrathalamica by mutual repression with Six3, another
homeodomain transcription factor
(Kobayashi et al., 2002
). Our
results show that iro7, despite its divergence, has a function
similar to that of the other members of the family in positioning the r4/r5
boundary by mutual repression with another transcription factor.
Recent data suggest the presence of a novel signalling centre within the
hindbrain, acting across the r4/r5 boundary
(Maves et al., 2002
;
Walshe et al., 2002
). In
zebrafish embryos, fgf3 and fgf8 are both expressed early in
r4 and are required for the expression of krx20 and val in
r5 and r5-r6, respectively (Maves et al.,
2002
; Walshe et al.,
2002
). Fgf3/8 signalling from r4 is also essential to the
formation of the otic vesicle (Kwak et
al., 2002
; Leger and Brand,
2002
; Maroon et al.,
2002
). The knockdown of iro7 leads to a partial
mis-specification of r4 but does not result in a reduction of val and
krx20 expression level. On the contrary, val expression
domain in r5/r6 and krx20 expression domain in r5 are expanded
anteriorly. This shows that the r4 signalling centre is still functional,
despite the reduction of r4 in iro7 morphants. Examination of
fgf3 and fgf8 expression in Moz7-injected embryos showed
that the level of expression of these two genes in r4 is reduced, especially
at early stages, but that their expression is not abolished. This result
suggests that a reduced amount of Fgf3/8 signalling is sufficient to allow
val and krx20 expression. It is consistent with the data
obtained previously (Wiellette and Sive,
2003
), showing that vhnf1 ectopic expression leads to
ectopic activation of val and krx20, even though it
represses fgf8 expression in r4. Although FGF signalling in
iro7 morphants is sufficient to activate val and
krx20 expression, it may be too low for a correct specification of
the otic vesicle, which is reduced and presents an abnormal rounded shape in
Moz7-injected embryos.
What are the respective roles of iro7 and the r4 signalling centre in setting up the r4/r5 boundary? FGFs and iro7 have antagonistic functions on val and krx20 activation. However, both signals act at different levels of the molecular hierarchy. FGFs are necessary to activate val and krx20 expression in the vhnf1 expressing territory, and are not involved in vhnf1 activation. iro7 is involved in repressing val and krx20 expression but, at least in part, as a consequence of vhnf1 repression. Thereby, iro7 is involved in an earlier step that is the positioning of the boundary. Nothing is known about the molecular cues involved in vhnf1 activation in the posterior neural plate. An interesting hypothesis would be that these cues are also present in future r4, and that iro7 is required to repress the activation of vhnf1 in this rhombomere.
A dual role for iro7 in the anterior hindbrain
In this paper, we show that the anterior hindbrain is significantly reduced
in the absence of Iro7. At the end of gastrulation, the anterior hindbrain
markers gbx1 (not shown) and fgf8 are expressed both at a
weaker level and in a reduced domain. Slightly later, the expression
territories of hoxa2 in r2-r3, hoxb2 in r3-r4 (not shown)
and krx20 in r3 are also reduced, but none of them is totally absent.
Therefore, the absence of iro7 leads to an overall reduction of the
anterior hindbrain but without any obvious mis-specification within this
region.
We also demonstrate here that the knockdown of iro7 leads to a
strong reduction in the ngn1-expressing proneural clusters in the
anterior hindbrain, especially in r4, whereas the more caudal proneural
clusters are not affected. Moreover, iro7 knockdown affects specific
primary neuronal populations. The nuclei of the facial (VIIth) nerve and, to
lesser extent of the trigeminal (Vth) nerve, are reduced, while the r4-derived
Mauthner cells are always lost and the r2-derived RoL2 are also occasionally
absent. Thus, in the absence of the Iro7 protein, neurogenesis is affected in
the rostral hindbrain. Accordingly, iro7 was previously shown to be
necessary for the formation of the trigeminal ganglia
(Itoh et al., 2002
).
The defects we observed in the differentiation of some neuronal subtypes
could result from a change in AP specification or from a direct effect of
iro7 on neurogenesis. We favour the second hypothesis for several
reasons. First, the absence of r4 proneural clusters and of Mauthner neurons
is unlikely to result only from the reduction of r4. Mauthner cells are indeed
lost in 100% of the Moz7-injected embryos, although the transformation of r4
into r5 is never total and its extent is slightly variable from one embryo to
the other. Second, we also observed a reduction of ngn1 expression in
r2 clusters, as well as an occasional loss of r2-derived RS neurons. As we
mentioned above, the iro7 knock-down leads to a reduction in size but
not to a misspecification of the anterior hindbrain, so the neuronal defects
in this region are likely to be linked to a role of iro7 in
neurogenesis. Third, no ectopic r5-specific RS neurons were observed, a
phenotype that would be expected if the loss of Mauthner cells was due to a
pure change in AP identity. Finally, ectopic expression of iro7
activates ngn1 and, in the neurectoderm, this activation has been
proposed to result from a function of Iro7 as a transcriptional activator
(Itoh et al., 2002
). Thus, the
activation of ngn1 expression by Iro7 may be direct.
In conclusion, we propose that iro7 has a dual function in the
hindbrain: it is required for the positioning of the r4/r5 boundary by
repressing vhnf1, and for neurogenesis in the anterior hindbrain,
possibly by direct activation of ngn1 expression. This dual function
is consistent with the successive roles found for Iro genes in the
Drosophila wing imaginal disc
(Gomez-Skarmeta et al., 1996
;
Leyns et al., 1996
;
Grillenzoni et al., 1998
;
Diez del Corral et al., 1999
;
Calleja et al., 2002
). Like its
Drosophila cognate genes, iro7 is required for successive
steps of the patterning of an embryonic territory.
| ACKNOWLEDGMENTS |
|---|
N-iro7 construct; to V. Prince for the gift of the Hox probes;
and to B. Thisse and C. Thisse for providing us with the six3 and
vhnf1 probes, and the full-length iro7. We thank F.
Bouallague for fish care; S. Cereghini, M. Itoh and A. Chitnis for fruitful
discussions and for sharing unpublished material and data; L. Bally-Cuif for
fruitful discussions and warm support; and P. Charnay, C. Vesque, S. Cereghini
and J. Ghislain for critical reading of the manuscript. This work was
supported by funds from the INSERM, FRM, ARC and MENRT. V.L. was supported by
a fellowship from MENRT. | REFERENCES |
|---|
|
|
|---|
Araki, I. and Nakamura, H. (1999). Engrailed defines the position of dorsal di-mesencephalic boundary by repressing diencephalic fate. Development 126,5127 -5135.[Abstract]
Bell, E., Wingate, R. J. and Lumsden, A.
(1999). Homeotic transformation of rhombomere identity after
localized Hoxb1 misexpression. Science
284,2168
-2171.
Bellefroid, E. J., Kobbe, A., Gruss, P., Pieler, T., Gurdon, J. B. and Papalopulu, N. (1998). Xiro3 encodes a Xenopus homolog of the Drosophila Iroquois genes and functions in neural specification. EMBO J. 17,191 -203.[CrossRef][Medline]
Bosse, A., Zulch, A., Becker, M. B., Torres, M., Gomez-Skarmeta, J. L., Modolell, J. and Gruss, P. (1997). Identification of the vertebrate Iroquois homeobox gene family with overlapping expression during early development of the nervous system. Mech. Dev. 69,169 -181.[CrossRef][Medline]
Burglin, T. R. (1997). Analysis of TALE
superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel
domain conserved between plants and animals. Nucleic Acids
Res. 25,4173
-4180.
Calleja, M., Renaud, O., Usui, K., Pistillo, D., Morata, G. and Simpson, P. (2002). How to pattern an epithelium: lessons from achaete-scute regulation on the notum of Drosophila. Gene 292,1 -12.[CrossRef][Medline]
Cavodeassi, F., Diez del Corral, R., Campuzano, S. and Dominguez, M. (1999). Compartments and organising boundaries in the Drosophila eye: the role of the homeodomain Iroquois proteins. Development 126,4933 -4942.[Abstract]
Cavodeassi, F., Modolell, J. and Campuzano, S. (2000). The Iroquois homeobox genes function as dorsal selectors in the Drosophila head. Development 127,1921 -1929.[Abstract]
Cavodeassi, F., Modolell, J. and Gomez-Skarmeta, J. L.
(2001). The Iroquois family of genes: from body building to
neural patterning. Development
128,2847
-2855.
Chandrasekhar, A., Moens, C. B., Warren, J. T., Jr, Kimmel, C. B. and Kuwada, J. Y. (1997). Development of branchiomotor neurons in zebrafish. Development 124,2633 -2644.[Abstract]
Choe, S. K., Vlachakis, N. and Sagerstrom, C. G.
(2002). Meis family proteins are required for hindbrain
development in the zebrafish. Development
129,585
-595.
Cordes, S. P. and Barsh, G. S. (1994). The mouse segmentation gene kr encodes a novel basic domain-leucine zipper transcription factor. Cell 79,1025 -1034.[CrossRef][Medline]
Diez del Corral, R., Aroca, P., Gomez-Skarmeta, J. L.,
Cavodeassi, F. and Modolell, J. (1999). The Iroquois
homeodomain proteins are required to specify body wall identity in Drosophila.
Genes Dev. 13,1754
-1761.
Ericson, J., Thor, S., Edlund, T., Jessell, T. M. and Yamada,
T. (1992). Early stages of motor neuron differentiation
revealed by expression of homeobox gene Islet-1.
Science 256,1555
-1560.
Ferretti, E., Marshall, H., Popperl, H., Maconochie, M., Krumlauf, R. and Blasi, F. (2000). Segmental expression of Hoxb2 in r4 requires two separate sites that integrate cooperative interactions between Prep1, Pbx and Hox proteins. Development 127,155 -166.[Abstract]
Furley, A. J., Morton, S. B., Manalo, D., Karagogeos, D., Dodd, J. and Jessell, T. M. (1990). The axonal glycoprotein TAG-1 is an immunoglobulin superfamily member with neurite outgrowth-promoting activity. Cell 61,157 -170.[CrossRef][Medline]
Furthauer, M., Thisse, C. and Thisse, B. (1997). A role for FGF-8 in the dorsoventral patterning of the zebrafish gastrula. Development 124,4253 -4264.[Abstract]
Giudicelli, F., Taillebourg, E., Charnay, P. and
Gilardi-Hebenstreit, P. (2001). Krox-20 patterns the
hindbrain through both cell-autonomous and non cell-autonomous mechanisms.
Genes Dev. 15,567
-580.
Giudicelli, F., Gilardi-Hebenstreit, P., Mechta-Grigoriou, F., Poquet, C. and Charnay, P. (2003). Novel activities of Mafb underlie its dual role in hindbrain segmentation and regional specification. Dev. Biol. 253,150 -162.[CrossRef][Medline]
Gomez-Skarmeta, J. L., del Corral, R. D., de la Calle-Mustienes, E., Ferre-Marco, D. and Modolell, J. (1996). Araucan and caupolican, two members of the novel iroquois complex, encode homeoproteins that control proneural and vein-forming genes. Cell 85, 95-105.[CrossRef][Medline]
Gomez-Skarmeta, J. L., Glavic, A., de la Calle-Mustienes, E., Modolell, J. and Mayor, R. (1998). Xiro, a Xenopus homolog of the Drosophila Iroquois complex genes, controls development at the neural plate. EMBO J. 17,181 -190.[CrossRef][Medline]
Gomez-Skarmeta, J. L. and Modolell, J. (2002). Iroquois genes: genomic organization and function in vertebrate neural development. Curr. Opin. Genet. Dev. 12,403 -408.[CrossRef][Medline]
Graham, A. and Lumsden, A. (1996). Interactions between rhombomeres modulate Krox-20 and follistatin expression in the chick embryo hindbrain. Development 122,473 -480.[Abstract]
Grillenzoni, N., van Helden, J., Dambly-Chaudiere, C. and Ghysen, A. (1998). The iroquois complex controls the somatotopy of Drosophila notum mechanosensory projections. Development 125,3563 -3569.[Abstract]
Guthrie, S. and Lumsden, A. (1991). Formation and regeneration of rhombomere boundaries in the developing chick hindbrain. Development 112,221 -229.[Abstract]
Guthrie, S., Prince, V. and Lumsden, A. (1993). Selective dispersal of avian rhombomere cells in orthotopic and heterotopic grafts. Development 118,527 -538.[Abstract]
Hanneman, E., Trevarrow, B., Metcalfe, W. K., Kimmel, C. B. and Westerfield, M. (1988). Segmental pattern of development of the hindbrain and spinal cord of the zebrafish embryo. Development 103,49 -58.[Abstract]
Hatta, K. (1992). Role of the floor plate in axonal patterning in the zebrafish CNS. Neuron 9, 629-642.[CrossRef][Medline]
Hauptmann, G. and Gerster, T. (1994). Two-color whole-mount in situ hybridization to vertebrate and Drosophila embryos. Trends Genet. 10,266 .[CrossRef][Medline]
Helmbacher, F., Pujades, C., Desmarquet, C., Frain, M., Rijli, F. M., Chambon, P. and Charnay, P. (1998). Hoxa1 and Krox-20 synergize to control the development of rhombomere 3. Development 125,4739 -4748.[Abstract]
Higashijima, S., Hotta, Y. and Okamoto, H.
(2000). Visualization of cranial motor neurons in live transgenic
zebrafish expressing green fluorescent protein under the control of the
islet-1 promoter/enhancer. J. Neurosci.
20,206
-218.
Irving, C., Nieto, M. A., DasGupta, R., Charnay, P. and Wilkinson, D. G. (1996). Progressive spatial restriction of Sek-1 and Krox-20 gene expression during hindbrain segmentation. Dev. Biol. 173,26 -38.[CrossRef][Medline]
Itoh, M., Kudoh, T., Dedekian, M., Kim, C. H. and Chitnis, A. B. (2002). A role for iro1 and iro7 in the establishment of an anteroposterior compartment of the ectoderm adjacent to the midbrain-hindbrain boundary. Development 129,2317 -2327.
Jungbluth, S., Bell, E. and Lumsden, A. (1999). Specification of distinct motor neuron identities by the singular activities of individual Hox genes. Development 126,2751 -2758.[Abstract]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Kobayashi, D., Kobayashi, M., Matsumoto, K., Ogura, T.,
Nakafuku, M. and Shimamura, K. (2002). Early subdivisions in
the neural plate define distinct competence for inductive signals.
Development 129,83
-93.
Krauss, S., Johansen, T., Korzh, V. and Fjose, A. (1991). Expression of the zebrafish paired box gene pax[zf-b] during early neurogenesis. Development 113,1193 -1206.[Abstract]
Krauss, S., Maden, M., Holder, N. and Wilson, S. W. (1992). Zebrafish pax[b] is involved in the formation of the midbrain-hindbrain boundary. Nature 360, 87-89.[CrossRef][Medline]
Kudoh, T., Tsang, M., Hukriede, N. A., Chen, X., Dedekian, M.,
Clarke, C. J., Kiang, A., Schultz, S., Epstein, J. A., Toyama, R. et al.
(2001). A gene expression screen in zebrafish embryogenesis.
Genome Res. 11,1979
-1987.
Kwak, S. J., Phillips, B. T., Heck, R. and Riley, B. B. (2002). An expanded domain of fgf3 expression in the hindbrain of zebrafish valentino mutants results in mis-patterning of the otic vesicle. Development 129,5279 -5287.
Larsen, C. W., Zeltser, L. M. and Lumsden, A.
(2001). Boundary formation and compartition in the avian
diencephalon. J. Neurosci.
21,4699
-4711.
Lecaudey, V., Thisse, C., Thisse, B. and Schneider-Maunoury, S. (2001). Sequence and expression pattern of ziro7, a novel, divergent zebrafish iroquois homeobox gene. Mech. Dev. 109,383 -388.[CrossRef][Medline]
Leger, S. and Brand, M. (2002). Fgf8 and Fgf3 are required for zebrafish ear placode induction, maintenance and inner ear patterning. Mech. Dev. 119,91 -108.[CrossRef][Medline]
Leyns, L., Gomez-Skarmeta, J. L. and Dambly-Chaudiere, C. (1996). iroquois: a prepattern gene that controls the formation of bristles on the thorax of Drosophila. Mech. Dev. 59, 63-72.[CrossRef][Medline]
Lumsden, A. and Krumlauf, R. (1996). Patterning
the vertebrate neuraxis. Science
274,1109
-1115.
Marin, F. and Charnay, P. (2000). Hindbrain patterning: FGFs regulate Krox20 and mafB/kr expression in the otic/preotic region. Development 127,4925 -4935.[Abstract]
Maroon, H., Walshe, J., Mahmood, R., Kiefer, P., Dickson, C. and
Mason, I. (2002). Fgf3 and Fgf8 are required together for
formation of the otic placode and vesicle. Development
129,2099
-2108.
Matsunaga, E., Araki, I. and Nakamura, H. (2000). Pax6 defines the dimesencephalic boundary by repressing En1 and Pax2. Development 127,2357 -2365.[Abstract]
Maves, L., Jackman, W. and Kimmel, C. B. (2002). FGF3 and FGF8 mediate a rhombomere 4 signaling activity in the zebrafish hindbrain. Development 129,3825 -3837.
McClintock, J. M., Carlson, R., Mann, D. M. and Prince, V.
E. (2001). Consequences of Hox gene duplication in the
vertebrates: an investigation of the zebrafish Hox paralogue group 1 genes.
Development 128,2471
-2484.
McClintock, J. M., Kheirbek, M. A. and Prince, V. E. (2002). Knockdown of duplicated zebrafish hoxb1 genes reveals distinct roles in hindbrain patterning and a novel mechanism of duplicate gene retention. Development 129,2339 -2354.
McNeill, H., Yang, C. H., Brodsky, M., Ungos, J. and Simon, M.
A. (1997). mirror encodes a novel PBX-class homeoprotein that
functions in the definition of the dorsal-ventral border in the Drosophila
eye. Genes Dev. 11,1073
-1082.
Metcalfe, W. K., Mendelson, B. and Kimmel, C. B. (1986). Segmental homologies among reticulospinal neurons in the hindbrain of the zebrafish larva. J. Comp. Neurol. 251,147 -159.[CrossRef][Medline]
Moens, C. B., Cordes, S. P., Giorgianni, M. W., Barsh, G. S. and Kimmel, C. B. (1998). Equivalence in the genetic control of hindbrain segmentation in fish and mouse. Development 125,381 -391.[Abstract]
Moens, C. B. and Prince, V. E. (2002). Constructing the hindbrain: Insights from the zebrafish. Dev. Dyn. 224,1 -17.[CrossRef][Medline]
Morrison, A. D. (1998). 1 + 1=r4 and much much more. BioEssays 20,794 -797.[CrossRef][Medline]
Murphy, P. and Hill, R. E. (1991). Expression of the mouse labial-like homeobox-containing genes, Hox 2.9 and Hox 1.6, during segmentation of the hindbrain. Development 111, 61-74.[Abstract]
Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene knockdown in zebrafish. Nat. Genet. 26,216 -220.[CrossRef][Medline]
Oxtoby, E. and Jowett, T. (1993). Cloning of
the zebrafish krox-20 gene (krx-20) and its expression during hindbrain
development. Nucleic Acids Res.
21,1087
-1095.
Popperl, H., Rikhof, H., Chang, H., Haffter, P., Kimmel, C. B. and Moens, C. B. (2000). lazarus is a novel pbx gene that globally mediates hox gene function in zebrafish. Mol. Cell 6,255 -267.[CrossRef][Medline]
Prince, V. E., Moens, C. B., Kimmel, C. B. and Ho, R. K. (1998). Zebrafish hox genes: expression in the hindbrain region of wild-type and mutants of the segmentation gene, valentino. Development 125,393 -406.[Abstract]
Rhinn, M. and Brand, M. (2001). The midbrainhindbrain boundary organizer. Curr. Opin. Neurobiol. 11,34 -42.[CrossRef][Medline]
Rijli, F. M., Gavalas, A. and Chambon, P. (1998). Segmentation and specification in the branchial region of the head: the role of the Hox selector genes. Int. J. Dev. Biol. 42,393 -401.[Medline]
Rupp, R. A., Snider, L. and Weintraub, H.
(1994). Xenopus embryos regulate the nuclear localization of
XMyoD. Genes Dev. 8,1311
-1323.
Schneider-Maunoury, S., Gilardi-Hebenstreit, P. and Charnay, P. (1998). How to build a vertebrate hindbrain. Lessons from genetics. C. R. Acad. Sci. Iii 321,819 -834.[Medline]
Sun, Z. and Hopkins, N. (2001). vhnf1, the
MODY5 and familial GCKD-associated gene, regulates regional specification of
the zebrafish gut, pronephros, and hindbrain. Genes
Dev. 15,3217
-3229.
Torres, M. and Giraldez, F. (1998). The development of the vertebrate inner ear. Mech. Dev. 71, 5-21.[CrossRef][Medline]
Trainor, P. A. and Krumlauf, R. (2000). Patterning the cranial neural crest: hindbrain segmentation and Hox gene plasticity. Nat. Rev. Neurosci. 1, 116-124.[Medline]
Voiculescu, O., Taillebourg, E., Pujades, C., Kress, C., Buart, S., Charnay, P. and Schneider-Maunoury, S. (2001). Hindbrain patterning: Krox20 couples segmentation and specification of regional identity. Development 128,4967 -4978.
Walshe, J., Maroon, H., McGonnell, I. M., Dickson, C. and Mason, I. (2002). Establishment of Hindbrain Segmental Identity Requires Signaling by FGF3 and FGF8. Curr. Biol. 12,1117 -1123.[CrossRef][Medline]
Westerfield, M. (1994). The Zebrafish Book, 2.1 edn. Eugene, OR: University of Oregon Press.
Wiellette, E. L. and Sive, H. (2003). vhnf1 and
Fgf signals synergize to specify rhombomere identity in the zebrafish
hindbrain. Development
130,3821
-3829.
Wilkinson, D. G., Bhatt, S., Chavrier, P., Bravo, R. and Charnay, P. (1989). Segment-specific expression of a zinc-finger gene in the developing nervous system of the mouse. Nature 337,461 -464.[CrossRef][Medline]
Wizenmann, A. and Lumsden, A. (1997). Segregation of rhombomeres by differential chemoaffinity. Mol. Cell Neurosci. 9,448 -459.
Wurst, W. and Bally-Cuif, L. (2001). Neural plate patterning: upstream and downstream of the isthmic organizer. Nat. Rev. Neurosci. 2,99 -108.[CrossRef][Medline]
Xu, Q., Alldus, G., Holder, N. and Wilkinson, D. G. (1995). Expression of truncated Sek-1 receptor tyrosine kinase disrupts the segmental restriction of gene expression in the Xenopus and zebrafish hindbrain. Development 121,4005 -4016.[Abstract]
Xu, Q., Mellitzer, G., Robinson, V. and Wilkinson, D. G. (1999). In vivo cell sorting in complementary segmental domains mediated by Eph receptors and ephrins. Nature 399,267 -271.[CrossRef][Medline]
Yang, C. H., Simon, M. A. and McNeill, H. (1999). mirror controls planar polarity and equator formation through repression of fringe expression and through control of cell affinities. Development 126,5857 -5866.[Abstract]
This article has been cited by other articles:
![]() |
S. Scholpp, I. Foucher, N. Staudt, D. Peukert, A. Lumsden, and C. Houart Otx1l, Otx2 and Irx1b establish and position the ZLI in the diencephalon Development, September 1, 2007; 134(17): 3167 - 3176. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Hernandez, A. P. Putzke, J. P. Myers, L. Margaretha, and C. B. Moens Cyp26 enzymes generate the retinoic acid response pattern necessary for hindbrain development Development, January 1, 2007; 134(1): 177 - 187. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Villa-Cuesta and J. Modolell Mutual repression between msh and Iro-C is an essential component of the boundary between body wall and wing in Drosophila Development, September 15, 2005; 132(18): 4087 - 4096. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. O. Sirbu, L. Gresh, J. Barra, and G. Duester Shifting boundaries of retinoic acid activity control hindbrain segmental gene expression Development, June 1, 2005; 132(11): 2611 - 2622. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||