|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 2 June 2004
doi: 10.1242/dev.01187
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Waksman Institute, Rutgers University, 190 Frelinghuysen Road, Piscataway, NJ 08854, USA
* Author for correspondence (e-mail: xuemei{at}waksman.rutgers.edu)
Accepted 25 March 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Flower development, HEN3, Cyclin-dependent kinase
| Introduction |
|---|
|
|
|---|
In addition to AG, several genes that act in the control of stamen
and carpel identities and floral determinacy have been identified through
sensitized genetic screens. Recessive mutations in HUA1 and HUA2,
hua1-1 and hua2-1, respectively, were isolated as enhancers of
the weak ag-4 allele (Chen and
Meyerowitz, 1999
). hua1-1 hua2-1 double mutant flowers
show partial carpel-to-sepal and occasional stamen-to-petal transformation,
phenotypes that are indicative of partial loss of class C activity
(Chen et al., 2002
;
Chen and Meyerowitz, 1999
;
Western et al., 2002
). In a
genetic screen in the hua1-1 hua2-1 background, recessive mutations
in HUA ENHANCER1 (HEN1), HEN2, HEN4 and
PAUSED (PSD), were found to enhance the weak floral homeotic
phenotypes of hua1-1 hua2-1 flowers such that stamens are transformed
to petals and carpels are partially transformed to sepals
(Chen et al., 2002
;
Cheng et al., 2003
;
Li and Chen, 2003
;
Western et al., 2002
). The
HUA and HEN genes all appear to directly or indirectly
promote the expression of AG in hua1-1 hua2-1 hen
mutants, AG RNA or protein is of lower abundance than in wild type or
in hua1-1 hua2-1 (Cheng et al.,
2003
; Li and Chen,
2003
). HUA1 and HEN4 physically interact in the nucleus, and
together with HUA2 and HEN2 promote AG expression by preventing the
production of alternative transcripts containing intron sequences
(Cheng et al., 2003
).
HEN1 is required for microRNA accumulation and may modulate
AG expression or activity through regulation of APETALA2, a
class A gene (Park et al.,
2002
; Chen, 2004
)).
In this study, we show that HEN3, which encodes an E-type CDK, also
acts in the AG pathway.
CDKs are a family of serine/threonine protein kinases that control cell
cycle progression, and/or coordinate cell cycle progression with transcription
regulation. For a fully active state, they require both the association with
regulatory subunits, cyclins and the phosphorylation of a conserved threonine
residue by CDK-activating kinases (CAKs) (reviewed by
Kobor and Greenblatt, 2002
;
Morgan, 1997
). Among the nine
known CDKs (CDK1-CDK9) in vertebrates, Cdc2 (CDK1) and CDK2 carry out central
cell cycle functions (reviewed by Morgan,
1997
). CDK4 and CDK6 are thought to integrate developmental
signals and environmental cues into the cell cycle to drive cells through the
G1-S transition. Cyclin D/CDK4 and cyclin D/CDK6 complexes phosphorylate the
retinoblastoma protein (Rb), which renders Rb unable to associate with E2F and
related transcription factors, thus allowing them to activate genes necessary
for S-phase progression (reviewed by
Harbour and Dean, 2000
).
Plants have both Rb-related (RBR) and E2F-related proteins
(de Veylder et al., 2002
;
Huntley et al., 1998
;
Mariconti et al., 2002
;
Xie et al., 1996
), but do not
have orthologs of CDK4 or CDK6 (Dewitte
and Murray, 2003
; Vandepoele
et al., 2002
). Three CDKs, CDK7, CDK8 and CDK9, function in
transcriptional regulation. CDK7 is in the TFIIH complex, where it
phosphorylates the C-terminal domain (CTD) of the largest subunit of RNA
polymerase II to promote transcription elongation
(Kobor and Greenblatt, 2002
).
CDK9/cylin T belongs to the positive transcription elongation factor b
(P-TEFb) complex, which phosphorylates the CTD to promote transcription
elongation (de Falco and Giordano,
2002
).
In mammalian cells, CDK8/cyclin C is a component of RNA polymerase II
holoenzyme and serves as a repressor of transcription through two mechanisms.
It phosphorylates the cyclin H subunit of TFIIH and this leads to the
repression of the ability of TFIIH to activate transcription and the
inhibition of the CTD kinase activity of CDK7
(Akoulitchev et al., 2000
). It
also phosphorylates the CTD of RNA polymerase II prior to the formation of the
preinitiation complex to result in inhibition of transcription
(Liao et al., 1995
;
Rickert et al., 1996
;
Sun et al., 1998
). Although
the developmental functions of CDK8 in higher eukaryotes are currently
unknown, CDK8 proteins from yeast and Dictyostelium appear to act in
cell differentiation in response to nutrient conditions. Srb10p, the yeast
CDK8, regulates filamentous growth in response to nutrient limitation
(Nelson et al., 2003
). The
Dictyostelium CDK8 is required for aggregation, which leads to
sporulation, under starvation (Takeda et
al., 2002
).
The Arabidopsis genome encodes eight CDKs classified into the A,
B, C and E types, and 30 cyclins classified into the A, B, D and H types,
according to sequence similarity among themselves and with their mammalian
counterparts (Vandepoele et al.,
2002
). Of the four types of CDKs, A and B types have been best
studied in plants. A-type CDKs regulate both the G1-S and G2-M transitions,
whereas B-type CDKs control the G2-M transition
(Hemerly et al., 1995
;
Magyar et al., 1997
;
Porceddu et al., 2001
). CDKAs
have the PSTAIRE cyclin binding motif and are associated with D-type cyclins
(Dewitte and Murray, 2003
;
Vandepoele et al., 2002
). Two
CDKCs in Arabidopsis share a PITAIRE cyclin-binding signature and
other structural characteristics with mammalian CDK9. They interact with
proteins sharing homology with the cyclin partners of CDK9, cyclin T and
cyclin K (Barroco et al.,
2003
). An E-type CDK with a SPTAIRE cyclin-binding motif was first
found in alfalfa (Magyar et al.,
1997
), and later a related sequence was identified in
Arabidopsis (Vandepoele et al.,
2002
). The function of CDKE is unknown.
Here we show that HEN3 encodes the only Arabidopsis E-type CDK. We also show that HEN3 shares significant sequence similarity to CDK8 and, like CDK8, HEN3 exhibits CTD kinase activity. Phenotypic characterization of hen3 mutants demonstrates that HEN3 acts in cell expansion in leaves and cell fate specification in floral meristems. Our studies demonstrate a role of CDK8 in cell differentiation in a multicellular organism.
| Materials and methods |
|---|
|
|
|---|
Map-based cloning of HEN3
hua1-1 hua2-1 hen3-1/+ plants (in the Landsberg ecotype) were
crossed to hua1-1 hua2-1(Col), a line in which the hua1-1
and hua2-1 mutations were introgressed into the Columbia background.
Five hundred and two plants with the hua1-1 hua2-1 hen3-1 phenotypes
in the F2 population were used for mapping. HEN3 was initially mapped
close to HEN4 on chromosome V with the markers used to isolate
HEN4 (Cheng et al.,
2003
). New markers were developed based on the Cereon Genomics
SNPs and used to map HEN3 to a region of
150 kb covered by P1
clones MBK5, MGI19, MLE2 and MBM17 (see Figure S1A at
http://dev.biologists.org/supplemental).
We sequenced 12 candidate genes in this region from hua1-1 hua2-1
hen3-1 plants and found a C-to-T mutation that would result in a stop
codon in At5g63610. Sequencing of At5g63610 from hen3-2 and
hen3-3 plants uncovered separate G-to-A mutations that would result
in R-to-K and G-to-R amino acid substitutions, respectively
(Fig. 4B). A fragment covering
At5g63610 was amplified by PCR with primers MBK5p7 (5'
tggttccgttggagaaattgacataaa 3') and MBK5p8
(5'gttggtggtaaatagataagactggcagg 3') (see Fig. S1A at
http://dev.biologists.org/supplemental),
and cloned into pPZP211 (Hajdukiewicz et
al., 1994
). The resulting plasmid, pHEN3g, was transformed into
hen3-1 and hua1-1 hen3-1 plants and found to rescue the
silique length defects of these plants (see Fig. S1B at
http://dev.biologists.org/supplemental).
To determine whether the clone also rescues the hua1-1 hua2-1 hen3-1
floral homeotic phenotypes, a hua1-1 hen3-1 plant hemizygous for the
HEN3g transgene was crossed to hua2-1 hen3-1. F2 seeds were plated on
Kanamycin medium to select for the HEN3g transgene and Kanamycin resistant F2
plants were transferred to soil and screened to identify those with floral
phenotypes that resembled hua1-1 hua2-1. Three such plants were
obtained from a total of 56 F2 plants. The three plants were then genotyped
for hua1-1 and hua2-1 and confirmed to be homozygous for
both mutations. Therefore, these plants were hua1-1 hua2-1 hen3-1
triple mutants that carried the HEN3g transgene. As they exhibited hua1-1
hua2-1-like floral phenotypes, the transgene rescued the floral homeotic
phenotypes conferred by the hen3-1 mutation.
|
To generate a HEN3-GUS reporter construct, a GUS-NOS cassette was released from pBI121 by EcoRI/BamHI and cloned into pPZP211 to generate pPZP211-GUS. The HEN3-coding region plus 1.5 kb of sequences upstream of the start codon was amplified with primers MBK5p7 and MBK5P10 (5'gaggcgtctggatttgttaggaggt 3') and cloned into pPZP211-GUS. The resulting plasmid pPZP211-HEN3-GUS was transformed into Ler and hen3-1 plants. The construct largely rescued the hen3-1 vegetative defects. The Ler transformants were used to determine the expression profiles of HEN3 by GUS staining.
The HEN3-coding region plus 1.5 kb of sequences upstream of the start codon was cloned into pPZP211-HA to provide an HA tag to the C terminus of HEN3. The resulting plasmid pPZP211-HEN3-HA was transformed into hen3-1 plants and found to largely rescue the silique defects of hen3-1 (Fig. S1B at http://dev.biologists.org/supplemental). These hen3-1 HEN3-HA plants were used to immunoprecipitate HEN3-HA in the protein kinase assay.
RNA filter hybridization and scanning electron microscopy (SEM)
RNA filter hybridization was carried out as described
(Li et al., 2001
). Total RNA
(40 µg) was used to detect AG and AP1 RNAs.
PolyA+ RNA (1 µg) was used to detect HEN3 RNA.
Hybridization signals were quantified with a phosphorimager.
SEM was carried out as described previously
(Chen et al., 2002
).
Protein expression in E. coli
The C-terminal domain (CTD) of the largest subunit of RNA polymerase II
from Arabidopsis (Dietrich et
al., 1990
) was amplified by RT-PCR using primers CTDp1
(5'-CCTGGATCCAGTCCTACTTCTCCCGGTTACAGT-3') and CTDp2
(5'-CCTGGATCCTGGATTGCCAATTCTCACTCTCTT-3'). The amplified CTD
fragment was cloned into the E. coli expression vector pRSETA to
generate pRSETA-CTD. The His-tagged CTD polypeptide was expressed in the
E. coli strain BL21DE3pLysS and purified according to
manufacturers instruction (Qiagen).
Histone H1 was purchased from Roche (CAT#0223549). His-GFP was produced with the Rapid Translation System from Roche (CAT#3186148).
Kinase assay
Kinase assay was carried out according to the method reported by Cockcroft
et al. (Cockcroft et al.,
2000
). Briefly, 10 g of inflorescences was ground in liquid
nitrogen and suspended in 50 ml of extraction buffer [50 mM Tris-HCl (pH 7.5),
75 mM NaCl, 15 mM EGTA, 15 mM MgCl2, 1 mM NaF, 0.2 mM sodium
orthovanadate, 2 mM Napyrophosphate, 60 mM glycerol 2-phosphate, 1 mM DTT,
0.1% Tween 20, 1xprotease inhibitor mix (Roche, #1697498)]. The
suspension was filtered through one layer of cheesecloth and two layers of
miracloth and centrifuged at 1900 g for 20 minutes at 4°C.
The supernatant was transferred to a new tube and centrifuged again. Finally,
40 ml of supernatant was added to 160 µl of 50% anti-HA (or anti-protein C
as a control)-coupled matrix slurry and incubated with gentle rotation at
4°C for 1 hour. The beads were precipitated by centrifugation at 120
g for 10 minutes, washed three times with wash buffer (50 mM
Tris-HCl pH 7.5, 250 mM NaCl, 5 mM EDTA, 5 mM NaF, 0.1% Tween 20, 0.5 mM
PMSF), two times with kinase buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 15 mM
EGTA, 1 mM DTT) and resuspended in 20 µl of assay buffer (50 mM Tris-HCl pH
7.5, 100 mM NaCl, 10 mM MgCl2, 10 mM MnCl2, 1 mM DTT,
0.5 mM PMSF, 0.5 µg/µl purified His-CTD, 2 µCi
[
-32P]ATP). The reaction mixture was incubated at room
temperature for 25 minutes. His-GFP protein was used as a negative control,
while histone H1 was used as a potential alternative substrate. The reaction
was stopped by adding SDS-PAGE loading buffer and boiling for 5 minutes.
Samples were analyzed by SDS-PAGE.
| Results |
|---|
|
|
|---|
|
|
|
Mutations in HEN1, HEN2, HEN4 and PSD all resulted in
reduced AG expression in the hua1-1 hua2-1 background
(Cheng et al., 2003
;
Li and Chen, 2003
), which was
consistent with the floral homeotic phenotypes caused by these mutations. The
hen3 mutations lead to more severe loss-of-C-function phenotypes when
compared with the other hen mutations. We performed RNA filter
hybridization to determine whether the hen3-1 mutation also results
in reduced AG RNA levels in the hua1-1 hua2-1 background.
Three AG RNAs, RNA1, RNA2 and AG mRNA, can be detected in
hua1-1 hua2-1 and hua1-1 hua2-1 hen3-1 flowers
(Fig. 3A). RNA1 and RNA2 are
second intron-containing AG RNAs that cannot generate the full-length
AG protein (Cheng et al.,
2003
). Although mutations in HEN2, HEN4, HUA1 and
HUA2 lead to increased abundance of RNA1 and RNA2, and a concomitant
decrease in abundance of AG mRNA
(Cheng et al., 2003
),
hen3-1 resulted in an increase in abundance in both the
intron-containing RNAs and the mRNA in the hua1-1 hua2-1 background
(Fig. 3A). The abundance of
AP1 (Fig. 3A) and
AP2 (not shown) was also increased in hua1-1 hua2-1 hen3-1
flowers relative to hua1-1 hua2-1 flowers.
|
HEN3 encodes CDKE
To begin to understand the molecular functions of HEN3, we cloned
this gene with a map-based approach (see Materials and methods; Fig. S1). The
predicted HEN3 (At5g63610) protein shares significant sequence similarity to
plant and animal cyclin-dependent protein kinases
(Fig. 4A,B), and was classified
as an E-type CDK with a SPTAIRE cyclin binding motif in the kinase domain
(Joubes et al., 2000
;
Vandepoele et al., 2002
). HEN3
and related proteins from alfalfa and rice are currently the only members of
the E class of plant CDKs (Fig.
4C), for which no cellular or developmental functions are known.
Class E CDKs appear to be more related to CDK8 throughout the kinase domain
than any other CDKs in metazoans (Fig.
4C). In vertebrates, CDK8, in association with cyclin C,
phosphorylates the CTD of the largest subunit of RNA polymerase II
(Liao et al., 1995
;
Rickert et al., 1996
).
Interestingly, HEN3 contains a SPTAIRE cyclin binding motif that differs from
the SMSACRE motif from CDK8 but resembles the PSTAIRE motif from plant CDKAs
(Fig. 4B). Plant CDKAs are more
closely related to human CDK1 (cdc2), CDK2 and CDK3 than to CDK8
(Fig. 4C).
To test whether HEN3 possesses protein kinase activity, we generated
transgenic lines in which HEN3 was tagged with the HA epitope in a
translational fusion under the control of the HEN3 promoter. The
HEN3-HA transgene was able to rescue the hen3-1 silique
(Fig. S1B at
http://dev.biologists.org/supplemental)
and stem elongation defect (not shown), suggesting that the fusion protein was
functional. We then immunoprecipitated HEN3-HA from these plants using an
anti-HA monoclonal antibody and performed a kinase assay using E.
coli produced, 6xHis-tagged Arabidopsis CTD,
6xHis-GFP and human Histone H1 as substrates. Anti-HA, but not the
control anti-protein C immunoprecipitate, was able to phosphorylate
6xHis-CTD, but not 6xHis-GFP or human Histone H1
(Fig. 5A). Anti-HA
immunoprecipitates from non-transformed plants did not result in CTD
phosphorylation (Fig. 5B). It
has previously been shown that the Arabidopsis CDKA/cyclin D complex
and a tobacco CDK2a/cyclin D3 complex were able to phosphorylate the maize RBR
in vitro (Boniotti and Gutierrez,
2001
; Nakagami et al.,
1999
). The HEN3-HA immunoprecipitate was unable to phosphorylate
the maize RBR (not shown). Therefore, CDKE has distinct substrate specificity
from that of CDKA. It should be noted that the hen3-1 mutation
deletes part of the kinase domain and the hen3-2 and hen3-3
mutations are in amino acids that are conserved among many CDKs
(Fig. 4B and data not shown).
Therefore, it is likely that the kinase activity of HEN3 is compromised or
abolished in these mutants.
|
RNA filter hybridization showed that HEN3 RNA was present in leaves, stems, roots (not shown) and inflorescences (Fig. 3C). HEN3 RNA was more abundant in ag-3 inflorescences (Fig. 3C). This may suggest that HEN3 is negatively regulated by AG. However, the increased HEN3 RNA abundance in ag-3 inflorescences may simply be due to a higher amount of proliferating tissue in ag-3 flowers.
HEN3 is required for cell expansion in leaves
We observed that all three hen3 alleles resulted in the reduction
of leaf size (Fig. 6A-C). This
and the fact that HEN3 encodes a CDK raised the question of whether HEN3 plays
a direct role in cell division. Therefore, we sought to determine whether the
reduction in leaf size in hen3 mutants was due to reduced cell number
or cell size. We measured the area of the fully expanded fifth leaf in
wild-type and the three hen3 mutants. The most severe hen3-2
allele caused a nearly 50% reduction in leaf size
(Fig. 6D). We next performed
scanning electron microscopy to examine leaf adaxial epidermal cells in the
four genotypes. Although leaf epidermal cells from the same leaf can vary
greatly in cell size in all genotypes (hence the large standard error), the
hen3 mutants had, on average, smaller cells than wild type
(Fig. 6E). In the same unit
area in a leaf, the hen3 mutants had more epidermal cells
(Fig. 6F). Taking into account
the differences in leaf size, these genotypes have roughly the same number of
cells in the fifth leaves. Therefore, it appears that the reduction in leaf
size caused by hen3 mutations is due to reduced cell expansion rather
than cell division. Consistent with this, we did not observe any differences
in the morphology of the SAM or leaf primordia between Ler and
hen3-1 in longitudinal sections or by SEM (Fig. S2 at
http://dev.biologists.org/supplemental).
In situ hybridization showed that histone H4, a gene known to be expressed in
a cell cycle-dependent manner, was expressed similarly in wild-type and
hen3-1 SAMs, and leaf primordia (see Fig. S2 at
http://dev.biologists.org/supplemental).
|
| Discussion |
|---|
|
|
|---|
The cyclin partner of HEN3, a CDK8 homolog in plants, remains to be
determined. Intriguingly, HEN3 contains a cyclin-binding motif that is very
similar to that of CDKA, which interacts with D-type cyclins that are thought
to integrate inputs from developmental and environmental signals into the cell
cycle (Meijer and Murray,
2000
; Riou-Khamlichi et al.,
1999
). Therefore, it may be predicted that HEN3 partners with
D-type cyclins, although CDK8 partners with cyclin C. No C-type cyclins from
Arabidopsis have been described, but the genome appears to contain at
least two C-type cyclins (At5g48630 and At5g48640). In addition, a rice C-type
cyclin has been reported (Yamaguchi et
al., 2000
). At5g48640 did not interact with HEN3 in a yeast
two-hybrid assay (W. Wang and X. Chen, unpublished). By contrast, a yeast
two-hybrid screen using HEN3 as the bait resulted in the isolation of three
D-type cyclins that can interact with HEN3 in yeast (W.W. and X.C.,
unpublished).
Developmental roles of HEN3
HEN3 RNA and protein (HEN3-GUS) are present in proliferating
tissue, where cells need to coordinate developmental events such as cell
division, expansion and fate specification. HEN3 seems to be required
for cell expansion in leaves and cell fate specification in floral meristems.
Although a direct role of HEN3 in cell division is not obvious from
the hen3 mutant phenotypes, its mammalian homolog CDK8 controls cell
proliferation through negative regulation of TFIIH transcription activity
(Akoulitchev et al., 2000
). We
speculate that HEN3 can be a potential link between cell division and
cell fate specification in the floral meristem. For example, key regulators of
cell division and cell fate specification may be coordinately regulated by
HEN3 through either transcriptional regulation or phosphorylation,
thus linking cell division control to cell fate specification. Alternatively,
HEN3 activity may be regulated by the cell cycle, which ensures that
the function of HEN3 in cell fate specification is integrated with
cell division. Although HEN3 RNA or HEN3-GUS does not accumulate in a
cell cycle-dependent manner, HEN3 activity may be regulated by the cell cycle
through its partner cyclins.
How might HEN3 be involved in cell expansion? Plant cell expansion
can be influenced by many processes, such as cell wall relaxation or
reorganization, endoreduplication, cytoskeleton remodeling and hormone
signaling (reviewed by Clouse and Sasse,
1998
; Cosgrove,
1993
; Sugimoto-Shirasu and
Roberts, 2003
; Wasteneys and
Galway, 2003
). HEN3 may directly or indirectly affect the
expression or function of genes in any of these processes.
How HEN3 acts in the AG pathway is currently unknown. Our
previous work showed that HUA1, HUA2, HEN2, and HEN4 prevent
transcription termination within the second intron of AG. Mutations
in these genes result in reduced abundance of AG mRNA and increased
abundance of AG RNA1 and RNA2, transcripts that terminate in the
second intron. HEN3 is able to phosphorylate the CTD, which regulates
transcription elongation and coordinates RNA processing with transcription
elongation. Therefore, it is plausible that HEN3 is also involved in
alternative transcript production from AG. However, the
hen3-1 mutation leads to increased accumulation of not only
AG RNA1 and RNA2 but also AG mRNA. This can be best
explained by a role of HEN3 in repressing transcription, as has been
demonstrated for mammalian and yeast CDK8 proteins. One possible explanation
for the loss of C-function phenotypes caused by hen3 mutations is
that the hen3 mutations lead to higher levels of RNAs from class A
genes than from AG, such that A function wins over C function during
flower development. Alternatively, HEN3 may play an indirect role in organ
identity through its primary function in cell division or cell elongation. It
is conceivable that missing cells or altered timing of cell elongation in
organ primordia may influence their identities. However, we have not observed
gross differences in developing organ primordia between wild-type and
hen3 mutants. Finally, HEN3 may regulate class A or C
proteins by phosphorylation. A recent study showed that the budding yeast
cdc28 kinase, a key cell cycle regulator, phosphorylates not only proteins
that drive cell cycle events but also other regulatory proteins to supposedly
orchestrate global gene expression throughout the cell cycle
(Ubersax et al., 2003
).
Another study demonstrated that Srb10, the budding yeast homolog of CDK8,
regulates yeast filamentous growth in response to nutrient conditions by
phosphorylating, and thus regulating, Ste12, a transcription factor required
for filamentous growth (Nelson et al.,
2003
). It is possible that HEN3 acts as a class C gene by
phosphorylating either class C or class A proteins.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Akoulitchev, S., Chuikov, S. and Reinberg, D. (2000). TFIIH is negatively regulated by cdk8-containing mediator complexes. Nature 407,102 -106.[CrossRef][Medline]
Barroco, R. M., de Veylder, L., Magyar, Z., Engler, G., Inze, D. and Mironov, V. (2003). Novel complexes of cyclin-dependent kinases and a cyclin-like protein from Arabidopsis thaliana with a function unrelated to cell division. Cell. Mol. Life Sci. 60,401 -412.[CrossRef][Medline]
Boniotti, M. B. and Gutierrez, C. (2001). A cell-cycle-regulated kinase activity phosphorylates plant retinoblastoma protein and contains, in Arabidopsis, a CDKA/cyclin D complex. Plant J. 28,341 -350.[CrossRef][Medline]
Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M.
(1989). Genes directing flower development in Arabidopsis.Plant Cell 1,37
-52.
Chen, X. (2004). A microRNA as a translational
repressor of APETALA2 in Arabidopsis flower development.
Science 303,2022
-2025.
Chen, X. and Meyerowitz, E. M. (1999). HUA1 and HUA2 are two members of the floral homeotic AGAMOUS pathway. Mol. Cell 3, 349-360.[CrossRef][Medline]
Chen, X., Liu, J., Cheng, Y. and Jia, D.
(2002). HEN1 functions pleiotropically in
Arabidopsis development and acts in C function in the flower.
Development 129,1085
-1094.
Cheng, Y., Kato, N., Wang, W., Li, J. and Chen, X. (2003). Two RNA binding proteins, HEN4 and HUA1, act in the processing of AGAMOUS pre-mRNA in Arabidopsis thaliana.Dev. Cell 4,53 -66.[CrossRef][Medline]
Clark, S. E., Running, M. P. and Meyerowitz, E. M. (1993). CLAVATA1, a regulator of meristem and flower development in Arabidopsis. Development 119,397 -418.[Abstract]
Clouse, S. D. and Sasse, J. M. (1998). Brassinosteroids: essential regulators of plant growth and development. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49,427 -451.[CrossRef]
Cockcroft, C. E., den Boer, B. G., Healy, J. M. and Murray, J. A. (2000). Cyclin D control of growth rate in plants. Nature 405,575 -579.[CrossRef][Medline]
Coen, E. S. and Meyerowitz, E. M. (1991). The war of the whorls: genetic interactions controlling flower development. Nature 353,31 -37.[CrossRef][Medline]
Cosgrove, D. J. (1993). Wall extensibility: its nature, measurement and relationship to plant cell growth. New Phytol. 124,1 -23.[CrossRef][Medline]
de Falco, G. and Giordano, A. (2002). CDK9: from basal transcription to cancer and AIDS. Cancer Biol. Ther. 1,342 -347.[Medline]
de Veylder, L., Beeckman, T., Beemster, G. T., de Almeida Engler, J., Ormenese, S., Maes, S., Naudts, M., van Der Schueren, E., Jacqmard, A., Engler, G. et al. (2002). Control of proliferation, endoreduplication and differentiation by the Arabidopsis E2Fa-DPa transcription factor. EMBO J. 21,1360 -8.[CrossRef][Medline]
Dewitte, W. and Murray, J. A. (2003). The plant cell cycle. Annu. Rev. Plant Biol. 54,235 -264.[CrossRef][Medline]
Dietrich, M. A., Prenger, J. P. and Guilfoyle, T. J. (1990). Analysis of the genes encoding the largest subunit of RNA polymerase II in Arabidopsis and soybean. Plant Mol. Biol. 15,207 -223.[Medline]
Gustafson-Brown, C., Savidge, B. and Yanofsky, M. F. (1994). Regulation of the Arabidopsis floral homeotic gene APETALA1. Cell 76,131 -143.[CrossRef][Medline]
Hajdukiewicz, P., Svab, Z. and Maliga, P. (1994). The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol. Biol. 25,989 -994.[CrossRef][Medline]
Harbour, J. W. and Dean, D. C. (2000). Rb function in cell-cycle regulation and apoptosis. Nat. Cell Biol. 2,E65 -E67.[CrossRef][Medline]
Hemerly, A., Engler Jde, A., Bergounioux, C., van Montagu, M., Engler, G., Inze, D. and Ferreira, P. (1995). Dominant negative mutants of the Cdc2 kinase uncouple cell division from iterative plant development. EMBO J. 14,3925 -3936.[Medline]
Huntley, R., Healy, S., Freeman, D., Lavender, P., de Jager, S., Greenwood, J., Makker, J., Walker, E., Jackman, M., Xie, Q. et al. (1998). The maize retinoblastoma protein homologue ZmRb-1 is regulated during leaf development and displays conserved interactions with G1/S regulators and plant cyclin D (CycD) proteins. Plant Mol. Biol. 37,155 -169.[CrossRef][Medline]
Joubes, J., Chevalier, C., Dudits, D., Heberle-Bors, E., Inze, D., Umeda, M. and Renaudi, J. P. (2000). CDK-related protein kinases in plants. Plant Mol. Biol. 43,607 -620.[CrossRef][Medline]
Kobor, M. S. and Greenblatt, J. (2002). Regulation of transcription elongation by phosphorylation. Biochim. Biophys. Acta 1577,261 -275.[Medline]
Laux, T., Mayer, K. F., Berger, J. and Jurgens, G. (1996). The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development 122, 87-96.[Abstract]
Lenhard, M., Bohnert, A., Jurgens, G. and Laux, T. (2001). Termination of stem cell maintenance in Arabidopsis floral meristems by interactions between WUSCHEL and AGAMOUS. Cell 105,805 -814.[CrossRef][Medline]
Li, J. and Chen, X. (2003). PAUSED, a putative
exportin-t, acts pleiotropically in Arabidopsis development but is
dispensable for viability. Plant Physiol.
132,1913
-1924.
Li, J., Jia, D. and Chen, X. (2001).
HUA1, a regulator of stamen and carpel identities in
Arabidopsis, codes for a nuclear RNA binding protein.
Plant Cell 13,2269
-2281.
Liao, S. M., Zhang, J., Jeffery, D. A., Koleske, A. J., Thompson, C. M., Chao, D. M., Viljoen, M., van Vuuren, H. J. and Young, R. A. (1995). A kinase-cyclin pair in the RNA polymerase II holoenzyme. Nature 374,193 -196.[CrossRef][Medline]
Lohmann, J. U., Hong, R. L., Hobe, M., Busch, M. A., Parcy, F., Simon, R. and Weigel, D. (2001). A molecular link between stem cell regulation and floral patterning in Arabidopsis.Cell 105,793 -803.[CrossRef][Medline]
Magyar, Z., Meszaros, T., Miskolczi, P., Deak, M., Feher, A., Brown, S., Kondorosi, E., Athanasiadis, A., Pongor, S., Bilgin, M. et al. (1997). Cell cycle phase specificity of putative cyclin-dependent kinase variants in synchronized alfalfa cells. Plant Cell 9,223 -235.[Abstract]
Mandel, M. A., Gustafson-Brown, C., Savidge, B. and Yanofsky, M. F. (1992). Molecular characterization of the Arabidopsis floral homeotic gene APETALA1.Nature 360,273 -277.[CrossRef][Medline]
Mariconti, L., Pellegrini, B., Cantoni, R., Stevens, R.,
Bergounioux, C., Cella, R. and Albani, D. (2002). The E2F
family of transcription factors from Arabidopsis thaliana. Novel and
conserved components of the retinoblastoma/E2F pathway in plants.
J. Biol. Chem. 277,9911
-9919.
Mayer, K. F., Schoof, H., Haecker, A., Lenhard, M., Jurgens, G. and Laux, T. (1998). Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell 95,805 -815.[CrossRef][Medline]
Meijer, M. and Murray, J. A. H. (2000). The role and regulation of D-type cyclins in the plant cell cycle. Plant Mol. Biol. 43,621 -633.[CrossRef][Medline]
Meyerowitz, E. M., Bowman, J. L., Brockman, L. L., Drews, G. N., Jack, T., Sieburth, L. E. and Weigel, D. (1991). A genetic and molecular model for flower development in Arabidopsis thaliana.Development Suppl.157 -167.
Morgan, D. O. (1997). Cyclin-dependent kinases: engines, clocks, and microprocessors. Annu. Rev. Cell Dev. Biol. 13,261 -91.[CrossRef][Medline]
Nakagami, H., Sekine, M., Murakami, H. and Shinmyo, A. (1999). Tobacco retinoblastoma-related protein phosphorylated by a distinct cyclin-dependent kinase complex with Cdc2/cyclin D in vitro. Plant J. 18,243 -252.[CrossRef][Medline]
Nelson, C., Goto, S., Lund, K., Hung, W. and Sadowski, I. (2003). Srb10/Cdk8 regulates yeast filamentous growth by phosphorylating the transcription factor Ste12. Nature 421,187 -190.[CrossRef][Medline]
Oelgeschlager, T. (2002). Regulation of RNA polymerase II activity by CTD phosphorylation and cell cycle control. J. Cell Physiol. 190,160 -169.[CrossRef][Medline]
Park, W., Li, J., Song, R., Messing, J. and Chen, X. (2002). CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana. Curr. Biol. 12,1484 -1495.[CrossRef][Medline]
Pelaz, S., Ditta, G. S., Baumann, E., Wisman, E. and Yanofsky, M. F. (2000). B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature 405,200 -203.[CrossRef][Medline]
Porceddu, A., Stals, H., Reichheld, J. P., Segers, G., de
Veylder, L., Barroco, R. P., Casteels, P., van Montagu, M., Inze, D. and
Mironov, V. (2001). A plant-specific cyclin-dependent kinase
is involved in the control of G2/M progression in plants. J. Biol.
Chem. 276,36354
-36360.
Rickert, P., Seghezzi, W., Shanahan, F., Cho, H. and Lees, E. (1996). Cyclin C/CDK8 is a novel CTD kinase associated with RNA polymerase II. Oncogene 12,2631 -2640.[Medline]
Riou-Khamlichi, C., Huntley, R., Jacqmard, A. and Murray, J.
A. (1999). Cytokinin activation of Arabidopsis cell
division through a D-type cyclin. Science
283,1541
-1544.
Schoof, H., Lenhard, M., Haecker, A., Mayer, K. F., Jürgens, G. and Laux, T. (2000). The stem cell population of Arabidopsis shoot meristems is maintained by a regulatory loop between the CLAVATA and WUSCHEL genes. Cell 100,635 -644.[CrossRef][Medline]
Sugimoto-Shirasu, K. and Roberts, K. (2003). "Big it up": endoreduplication and cell-size control in plants. Curr. Opin. Plant Biol. 6, 544-553.[CrossRef][Medline]
Sun, X., Zhang, Y., Cho, H., Rickert, P., Lees, E., Lane, W. and Reinberg, D. (1998). NAT, a human complex containing Srb polypeptides that functions as a negative regulator of activated transcription. Mol. Cell 2, 213-222.[CrossRef][Medline]
Takeda, K., Saito, T. and Ochiai, H. (2002). A novel Dictyostelium Cdk8 is required for aggregation, but is dispensable for growth. Develop. Growth Differ. 44,213 -223.[CrossRef][Medline]
Ubersax, J. A., Woodbury, E. L., Quang, P. N., Paraz, M., Blethrow, J. D., Shah, K., Shokat, K. M. and Morgan, D. O. (2003). Targets of the cyclin-dependent kinase Cdk1. Nature 425,859 -864.[CrossRef][Medline]
Vandepoele, K., Raes, J., de Veylder, L., Rouze, P., Rombauts,
S. and Inze, D. (2002). Genome-wide analysis of core cell
cycle genes in Arabidopsis. Plant Cell
14,903
-916.
Wasteneys, G. O. and Galway, M. E. (2003). Remodeling the cytoskeleton for growth and form: an overview with some new views. Annu. Rev. Plant Biol. 54,691 -722.[CrossRef][Medline]
Western, T. L., Cheng, Y., Jun, L. and Chen, X.
(2002). HUA ENHANCER2, a putative DExH-box RNA helicase,
maintains homeotic B and C gene expression in Arabidopsis.Development 129,1569
-1581.
Xie, Q., Sanz-Burgos, A. P., Hannon, G. J. and Gutierrez, C. (1996). Plant cells contain a novel member of the retinoblastoma family of growth regulatory proteins. EMBO J. 15,4900 -4908.[Medline]
Yamaguchi, M., Fabian, T., Sauter, M., Bhalerao, R. P., Schrader, J., Sandberg, G., Umeda, M. and Uchimiya, H. (2000). Activation of CDK-activating kinase is dependent on interaction with H-type cyclins in plants. Plant J. 24, 11-20.[CrossRef][Medline]
Yanofsky, M. F., Ma, H., Bowman, J. L., Drews, G. N., Feldmann, K. A. and Meyerowitz, E. M. (1990). The protein encoded by the Arabidopsis homeotic gene AGAMOUS resembles transcription factors. Nature 346, 35-39.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
T. Westerling, E. Kuuluvainen, and T. P. Makela Cdk8 Is Essential for Preimplantation Mouse Development Mol. Cell. Biol., September 1, 2007; 27(17): 6177 - 6182. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Gonzalez, A. J. Bowen, T. S. Carroll, and R. S. Conlan The Transcription Corepressor LEUNIG Interacts with the Histone Deacetylase HDA19 and Mediator Components MED14 (SWP) and CDK8 (HEN3) To Repress Transcription Mol. Cell. Biol., August 1, 2007; 27(15): 5306 - 5315. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Cui, B. Fan, J. Scholz, and Z. Chen Roles of Arabidopsis Cyclin-Dependent Kinase C Complexes in Cauliflower Mosaic Virus Infection, Plant Growth, and Development PLANT CELL, April 1, 2007; 19(4): 1388 - 1402. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Umeda, A. Shimotohno, and M. Yamaguchi Control of Cell Division and Transcription by Cyclin-dependent Kinase-activating Kinases in Plants Plant Cell Physiol., September 1, 2005; 46(9): 1437 - 1442. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||