|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 2 June 2004
doi: 10.1242/dev.01174
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Program in Cardiovascular Sciences, Baylor College of Medicine, Houston, TX
77030, USA
2 Center for Cardiovascular Development, Baylor College of Medicine, Houston, TX
77030, USA
3 Departments of Pediatrics (Cardiology), Baylor College of Medicine, Houston,
TX 77030, USA
4 Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030,
USA
5 Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030,
USA
6 Cardiovascular Research and Developmental Biology, The Hospital for Sick
Children, University of Toronto, Toronto M5G 1X8, Canada
7 Department of Molecular and Medical Genetics, University of Toronto, Toronto
M5G 1X8, Canada
* Author for correspondence (e-mail: baldini{at}bcm.tmc.edu)
Accepted 17 March 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Tbx1, Mouse, Outflow tract, DiGeorge syndrome
| Introduction |
|---|
|
|
|---|
Chromosome 22q11.2 deletion (del22q11) causes most cases of
DiGeorge syndrome (DGS), velocardiofacial syndrome, and conotruncal anomaly
face, and it is one of the most common genetic causes of OFT and aortic arch
defects. Modeling del22q11 in mice
(Jerome and Papaioannou, 2001
;
Lindsay et al., 1999
;
Lindsay et al., 2001
;
Merscher et al., 2001
) and
mutational analysis in human patients
(Yagi et al., 2003
), have led
to the identification of Tbx1 as the major player in these syndromes.
Tbx1 is required for segmentation of the embryonic pharynx, for the formation
of the caudal pharyngeal arches and arch arteries, and for growth, alignment
and septation of the OFT in mice. Because of the complexity of the mutant
phenotype, and the close developmental relationship between the pharyngeal
apparatus and OFT, it has not been possible to establish whether Tbx1 has a
specific role in OFT morphogenesis. Here we have addressed this issue using
different genetic approaches in the mouse and we show that even in the
presence of severe developmental abnormalities of the pharynx, the severity of
the OFT phenotype can be ameliorated by a low level of Tbx1
expression. Conversely, conditional ablation of Tbx1 in the
Nkx2.5 domain causes a mild pharyngeal phenotype, but it
recapitulates the severe OFT phenotype observed in
Tbx1/ embryos. Analysis of conditional
mutants supports a dual role of Tbx1 in OFT development, one in
morphogenesis of the AP septum, and one in cell proliferation in the SHF
region. Reduced cell proliferation in the SHF is associated with reduced cell
contribution to the OFT and, consequently, reduced number of muscle cells.
Our data provide an explanation as to why OFT defects may occur independently from other pharyngeal or aortic arch patterning defects in patients with del22q11. We propose that the separation of the aorta and pulmonary arteries requires Tbx1 in the pharyngeal endoderm, whereas proper OFT alignment and truncal valve septation requires Tbx1 function in the SHF.
| Materials and Methods |
|---|
|
|
|---|
MHC-Cre (Agah et al.,
1997
Cell fate mapping in Tbx1 homozygous mutant background was
performed in Df1/Tbx1mcm;R26R embryos. The
Df1 deletion, which includes the Tbx1 gene, was used as the
Tbx1 null allele because our Tbx1+/ allele
includes a lacZ reporter gene that would have confounded the
analysis. Df1/Tbx1 and
Tbx1/ have identical phenotype
(Vitelli et al., 2002b
). All
mouse lines were crossed into a C57BL/6 background in the experiments
described. All embryos (up to E12.5) were staged by counting the number of
somites.
Generation of new mouse lines
The alleles Tbx1neo, Tbx1mcm were
generated by homologous recombination in AB2.2 ES cells, as shown in
Fig. 1A and
Fig. 2A. The allele
Tbx1flox was generated by transfecting a Cre recombinase
expression vector in Tbx1neo/+ ES cells. ES
cells were injected into C57Bl6 blastocysts and chimeric mice were crossed
with C57BL/6 mice to obtain germ line transmission of the mutant alleles.
Cre-induced recombination of the floxed allele causes the excision of exon 5
and generation of the Tbx1
E5 allele
(Fig. 1B). This deletion is
predicted to cause loss of function because exon 5 encodes part of the
conserved T-box domain, and because splicing between exons 4 and 6 in the
mutant allele generates a frame shift from codon 169, and a stop codon after
86 codons. We could not detect exon 5 skipping in the wild-type allele using
reverse-transcription polymerase chain reaction (RT-PCR) on RNA from E10.5
embryos.
|
|
RT-PCR
Total RNA was extracted from whole embryos at E10.5 using Trizol
(Invitrogen). The concentration of RNA samples was measured using a
spectrophotometer, and the concentration of all samples was adjusted to 100
ng/µl. The reverse transcription was followed by 30 cycles of PCR
amplification. The location of the primers is indicated in
Fig. 1A, the sequences are
TTTGTGCCCGTAGATGACAA (forward primer) and AATCGGGGCTGATATCTGTG (reverse
primer).
Analysis of chimeras
The generation of Tbx1/ mouse ES cells
has been described (Vitelli et al.,
2003
). Tbx1/ and
Tbx1+/ (Lindsay
et al., 2001
) ES cells were injected into wild-type C57BL/6
blastocysts and transferred into pseudopregnant CD1 females. Chimeric embryos
were harvested at E10.5 and were stained with X-gal prior to ethanol fixation
and embedding in paraffin. Histological sections (10 µm) were
counterstained with Nuclear Fast Red.
Histology, X-gal staining and immunohistochemistry
To visualize ß-gal activity, we stained paraformaldehyde-fixed embryos
using the X-gal substrate, according to standard procedures. Stained embryos
were photographed as wholemounts and then embedded in paraffin and cut in 10
µm histological sections. Sections were counterstained with Nuclear Fast
Red. Muscle cells were identified by immunohistochemistry using an
anti-
-smooth muscle actin (sma) monoclonal antibody (Clone 1A4, Sigma).
Cell proliferation was assessed using a BrdU assay. Briefly, pregnant females
were injected with 5 mg/100 g body weight of BrdU and sacrificed 1 hour after
injection to harvest embryos. Embryos were fixed in ethanol, embedded in
paraffin and cut in 7 µm sections. BrdU incorporation was detected on
histological sections using an anti-BrdU monoclonal antibody (Clone # 85-2C8,
Novacastra). The antineurofilament-M (165kD) monoclonal antibody 2H3 was
developed by T. M. Jessell and J. Dodd and was obtained from the Developmental
Studies Hybridoma Bank, University of Iowa.
RNA in situ hybridization
RNA in situ hybridization experiments, with radioactive or nonradioactive
probes, were performed on sectioned or wholemount embryos, respectively,
according to published protocols (Albrecht
et al., 1997
). Labeled probes (sense and antisense) were prepared
by reverse transcription of DNA clones in the presence of
digoxigeninconjugated UTP (Roche) or 35S-UTP (ICN). A Tbx1
probe (Chapman et al., 1996
)
was obtained from V. Papaioannou. Crabp1 transcripts were detected
using the probe described (Giguere et al.,
1990
).
Luciferase assay
A mouse Tbx1 cDNA (Lindsay et
al., 2001
) (Accession # AF326960) was fused with a c-myc tag and
cloned into the pCDNA3.1 expression vector. The Fgf10Luc and
Fgf10MutLuc constructs, and the luciferase assay procedure have been
described (Agarwal et al.,
2003
). Constructs were transfected in COS-7 cells and data were
normalized to a co-transfected ß-Gal expression vector. Experiments were
performed in duplicate and repeated three times.
| Results |
|---|
|
|
|---|
Tbx1 is not required in myocytes or endothelial cells of the OFT
Despite the severity of the OFT phenotype in
Tbx1/ mutants, Tbx1 gene expression
in the OFT is modest (Vitelli et al.,
2002b
). Tbx1 is expressed in endothelial cells (from
E11.5) and in a subpopulation of
-sma-positive cells of the outer wall
of the OFT (Vitelli et al.,
2002b
). Endothelial cells in the conal OFT, transform into
mesenchymal cells of the outflow ridges
(van den Hoff et al., 1999
),
thus, these cells might be important for septation and valvulogenesis.
Therefore, we asked whether Tbx1 is required by endothelial cells for
conal septation. To this end, we used mice carrying a Tbx1
conditional, floxed allele, generated as shown in
Fig. 1B.
Tbx1flox/flox mice were viable and fertile, and were
crossed with Tbx1+/;Tie2:Cre mice. Tie2:Cre
transgenic mice express Cre in endothelial cells and their precursors
(Kisanuki et al., 2001
),
including endothelial cells of the OFT that also express Tbx1 (not
shown). Tbx1flox/; Tie2:Cre fetuses were
analyzed at E18.5 (n=8), but none presented with cardiovascular
abnormalities other than aortic arch defects associated with Tbx1
haploinsufficiency (not shown). Next, we asked whether Tbx1 expressed
in muscle cells of the OFT is required for OFT growth and morphogenesis. To
this end, we crossed Tbx1+/;
MHC:Cre mice
with Tbx1flox/flox mice.
Tbx1flox/;
MHC:Cre fetuses at
E18.5 (n=6) had normal cardiovascular phenotype, apart from the
aortic arch abnormalities characteristic of Tbx1 haploinsufficiency
(not shown).
Tbx1 is expressed in precursors of OFT cells and its loss of function reduces cell contribution to the OFT
Because Tbx1 is not required in resident, differentiated OFT cells, we
asked whether Tbx1 may be expressed in progenitors of these cells.
Therefore, we analyzed the fate of Tbx1-expressing cells by
generating and establishing in mice an allele of Tbx1, named
Tbx1mcm, in which a Tamoxifen-inducible Cre construct
(Sohal et al., 2001
;
Verrou et al., 1999
) is driven
by the endogenous regulatory elements of Tbx1
(Fig. 2A). The insertion point
of the Cre construct is identical to the one we used for a lacZ
reporter construct shown to recapitulate the developmental expression of
Tbx1 (Lindsay et al.,
2001
; Vitelli et al.,
2002b
). We then crossed Tbx1mcm/+
mice with the R26R reporter line (Soriano,
1999
) to evaluate Cre-induced recombination. Because the Cre
construct that we used encodes a Tamoxifen-inducible recombinase,
Tbx1mcm/+;R26R embryos from mothers that had
not been injected with Tamoxifen showed no blue cells upon X-gal staining
(n=13, not shown). The cell fate of Tbx1-expressing cells
was studied using Tbx1mcm/+;R26R embryos where the
pregnant mothers had been treated with daily injections of Tamoxifen from
E5.5. Hereafter we refer to these embryos, stained with X-gal, as
Tbx1-tracing embryos. The staining intensity was variable but,
overall, Tbx1 tracing resulted in a pattern of X-gal staining that
was very similar to Tbx1 gene expression
(Fig. 2B,C), at the stages
tested (E9.5, E10.5 and E12.5), with two exceptions. First, the ectoderm
lining the lateral aspect of the pharyngeal region showed extensive staining
(Fig. 2C, red arrowheads),
probably because of transient Tbx1 expression in the ectoderm before
E9.5 (E.A.L., unpublished). Second, in the OFT
(Fig. 2E-J), Tbx1
tracing showed extensive contribution to the myocardial wall and endothelium
of the OFT, and some contribution to the myocardium of the right ventricle
(Fig. 2F,H,J) (five embryos
analyzed at E9.5, seven at E10.5, and four at E12.5). In contrast,
Tbx1 expression in the OFT was much more restricted
(Fig. 2E,G,I), indicating that
Tbx1 is expressed transiently in a substantial number of progenitors
of cells fated to the OFT. Contribution of Tbx1-traced cells was
observed at all stages tested but was relatively low at E9.5 (earliest stage
analyzed is 25 somite), suggesting that although this contribution must start
before E9.5, it appears more substantial between E9.5 and E10.5.
Next, we asked whether Tbx1 function is required for the contribution of Tbx1-traced cells to the OFT. We performed cell fate mapping in a Tbx1 null background and observed reduced number of Tbx1-traced cells in the OFT (Fig. 2D,L,M). However, this reduction could be attributed in part to the overall size reduction of the OFT in Tbx1 null mutants. Tbx1-traced cells were observed in the SHF region of Tbx1 homozygous mutant embryos (n=4) (Fig. 2M' arrowhead, compare with lacZ knock-in K' and cell fate mapping in heterozygous background, L'). Thus, Tbx1 loss of function reduces but does not prevent the contribution of Tbx1-traced cells to the OFT and SHF.
Tbx1 is required in Nkx2.5-expressing cells
The data presented so far support the hypothesis that the primary role of
Tbx1 in OFT morphogenesis is performed in progenitors of cells
contributing to the OFT. The induction of naïve mesodermal cells in the
SHF to an OFT myocardial fate is thought to use a molecular circuitry similar
to that used in the primary heart field
(Waldo et al., 2001
).
Consistent with this view, Nkx2.5 is expressed in the SHF
(Kelly et al., 2001
;
Mjaatvedt et al., 2001
;
Waldo et al., 2001
) and it is
required for the development of the OFT
(Lyons et al., 1995
;
Tanaka et al., 1999
). The OFT
of Nkx2.5/ embryos is not canalized
(Lyons et al., 1995
;
Tanaka et al., 1999
) (M.M.,
unpublished), which is an earlier and more severe defect than that of
Tbx1/ animals. Hence, we hypothesize that
Tbx1 function in OFT progenitors is downstream to Nkx2.5 function, and that
deletion of Tbx1 in cells expressing Nkx2.5 is sufficient to
recapitulate the OFT abnormalities found in
Tbx1/ mutants. To test this hypothesis, we
crossed Nkx2.5Cre/+ mice, which carry a Cre gene inserted
into the Nkx2.5 gene (Moses et
al., 2001
), with Tbx1+/ animals, and
then crossed Nkx2.5cre/+;Tbx1+/
mice with Tbx1flox/flox mice. The
external appearance of E18.5
Nkx2.5cre/+;Tbx1flox/ embryos
(hereafter referred to as conditional mutants) was indistinguishable from that
of normal littermates, in particular, they did not have the characteristic
external ear defects or cleft palate observed in
Tbx1/ embryos (not shown). The thymus was
clearly visible but small, with the lobes widely separated
(Fig. 3A,B). The cardiovascular
phenotype included truncus arteriosus of the same type as that seen in
Tbx1/ animals (complete lack of septation
and a single four-leaflet truncal valve communicating exclusively with the
right ventricle, and a large infundibular VSD)
(Fig. 3C-E). The aortic arch
phenotype differed from the Tbx1/ phenotype
because the 6th pharyngeal arch arteries (PAAs) formed, persisted and
connected the outflow to the descending aorta (on the left) and to the right
subclavian artery (on the right) (Fig.
3D'-E'). In contrast, in
Tbx1/ embryos the 3rd, 4th and 6th PAAs do
not form (Vitelli et al.,
2002b
). Thus, conditional mutants recapitulate the OFT phenotype
but not the aortic arch patterning phenotype of
Tbx1/ mutants, which is considerably milder
in conditional mutants.
|
Conditional deletion of Tbx1 causes ablation of the AP septum
Conditional mutants have normal 3rd and 6th PAAs but have no 4th PAAs, as
visualized by intracardiac ink injection (n=3)
(Fig. 3F,G). This pattern is
also seen in Tbx1+/ embryos, however, the distance
between the 3rd and 6th PAAs is smaller than in wild-type or
Tbx1+/ embryos, suggesting malformations of the 4th
pharyngeal arch and aortic sac. Histological sections showed that the 4th
pharyngeal arches of conditional mutants were small and the 4th PAAs were very
hypoplastic or undetectable (Fig.
4A',B'). Consistent with hypoplasia of the 4th
pharyngeal arch, we observed a reduced number of neural crest-derived cells
migrating through the 4th arch, but a normal pattern in the 3rd and 6th arches
of conditional mutants, as tested by Crabp1 in situ hybridization
(Fig. 4C-F). Immunohistochemistry with an anti-neurofilament M antibody showed the presence
of an apparently normal vagus nerve bundle in the 4th arch, suggesting normal
differentiation of neural crest-derived cells in this arch
(Fig.
4A,A',B,B').
|
Conditional deletion of Tbx1 reduces cell proliferation in the splanchnic mesoderm
Immunohistochemistry with an anti-
-sma antibody showed a thinner and
discontinuous immunoreaction in the OFT myocardial layer of conditional
mutants (Fig.
5A-C,A'-C'). The growth of the myocardial layer of the
OFT relies mainly on cell migration from the SHF because cell proliferation
activity is modest in the OFT, but it is high in the SHF. Thus, a possible
explanation for reduced contribution of cells to the OFT is reduced
proliferation in the SHF. We performed a BrdU assay in embryos with 32 and 29
somites, and results showed that the mitotic index in the SHF and adjacent
splanchnic mesoderm of conditional mutants is reduced by 18% and 19%,
respectively, compared with somite-matched wild-type embryos
(Table 1). In contrast, we
found no significant difference in the myocardial OFT and in tissues where
there is no overlap between Tbx1 expression and
Nkx2.5Cre-induced recombination
(Table 1). This result is
consistent with overlap between Tbx1 expression and
Nkx2.5Cre-driven recombination in the SHF region
(Fig. 6D,G).
|
|
|
Fgf10 is a direct target of Tbx1 in a tissue culture system
The above results suggest that Tbx1 may activate an extracellular signaling
system that regulates cell proliferation in the SHF. To date, no
transcriptional target of Tbx1 has been reported, but it has been shown that
Fgf10 expression is reduced in the SHF of
Tbx1/ mutants, by in situ hybridization
(Kochilas et al., 2002
;
Vitelli et al., 2002c
). It has
been shown that FGF signaling can induce cell proliferation in SHF explants
(Waldo et al., 2001
), so Fgf10
might mediate, at least in part, a cell non-autonomous function of Tbx1 in
this region. Recently, it has been shown that Tbx5 can activate
Fgf10 through a conserved T-box binding element (TBE) located in the
5' region of the Fgf10 gene
(Agarwal et al., 2003
).
Therefore, we asked whether Tbx1 could also activate the Fgf10 gene
via this TBE. To this end, we co-transfected into COS-7 cells a Tbx1
expression vector and an Fgf10 promoterluciferase construct. We
observed up to 20-fold activation of luciferase activity in repeated
experiments, but when we co-transfected the Tbx1 expression vector
with an Fgf10 promoter construct carrying a mutant TBE
(Agarwal et al., 2003
), we
observed no activation (Fig.
6C), demonstrating that this binding site is required for
activation. For comparison, the same experiment was performed with a
Tbx5 expression vector with similar results, raising the intriguing
possibility that different T-box transcription factors may share target genes.
In situ hybridization on tissue sections of wild-type embryos showed overlap
between Tbx1 and Fgf10 expression in the SHF region
(Fig. 6D,E). In addition,
Fgf10 expression in this region is reduced or abolished in
conditional mutants (Fig. 6F),
consistent with overlap with Nkx2.5Cre-driven
recombination (Fig. 6G). These
results identify Fgf10 as a candidate mediator of the Tbx1 cell non-autonomous
role in cell proliferation in the SHF.
| Discussion |
|---|
|
|
|---|
Tbx1 has direct roles in OFT morphogenesis
Our data show that Tbx1neo/neo
animals present with severe abnormalities of the pharyngeal apparatus,
including loss of the 3rd-6th pairs of pharyngeal arches and arteries, as in
Tbx1/ embryos. However, the OFT phenotype is
milder in approximately half of the Tbx1neo/neo embryos.
Thus, the OFT mutant phenotype is partially independent of the pharyngeal
phenotype. Conversely, Nkx2.5cre-induced somatic deletion
of Tbx1 recapitulates the OFT phenotype of
Tbx1/ animals, even though the abnormalities
of the pharyngeal apparatus are much milder. Overall, these data clearly
indicate that Tbx1 has specific functions in OFT morphogenesis.
Tbx1 regulates cell contribution to the OFT
Tbx1 is expressed in progenitors as well as in differentiated,
resident myocytes and endothelial cells of the OFT. However, our conditional
deletion experiments indicate that Tbx1 function is not required in myocardial
or endothelial cells. Instead, cell fate mapping experiments indicate that
Tbx1 regulates, but is not required for contribution of myocytes, and
possibly other cell types, to the OFT. Most probably, Tbx1 does not directly
regulate cell proliferation of progenitor cells because in chimeras,
Tbx1/ cells do not have a proliferative
disadvantage in the SHF. Thus, the Tbx1 role in regulating cell contribution
to the OFT will probably be cell non-autonomous. Fgf10 is a candidate mediator
of this function because its expression in the SHF is abolished in
Tbx1/,
Tbx1neo/neo, and conditional mutants,
and Tbx1 can directly activate the Fgf10 promoter in a tissue culture
assay. Interestingly though, Fgf10/ animals
do not have OFT defects, raising the question as to whether Tbx1 also
activates other Fgf genes or other extracellular signaling systems
critical for OFT morphogenesis. Alternatively,
Fgf10/ animals may not have OFT defects
because other Fgf genes compensate for the loss of Fgf10, as
proposed recently (Kelly and Buckingham,
2002
).
Tbx1 has at least two roles in OFT morphogenesis
Consistent with previously discussed data, the OFT of Tbx1
conditional mutants have reduced numbers of
-sma-positive cells. This
correlates well with a significant downregulation of cell proliferation in the
SHF. In contrast, the proliferation of cells of the myocardial layer of the
OFT is not affected in these mutants. Hence, the most probable explanation for
the lower number of
-sma-positive cells in the OFT is a reduced supply
from a pool of precursors, secondary to reduced cell proliferation. It is also
possible that Tbx1 is required to specify a subpopulation of OFT myocyte
precursors because the
-sma phenotype is more obvious in the region
where truncal valve septation is occurring
(Fig. 5B,B'). This is an
intriguing observation because this cell population may have a specialized,
patterning role in truncal valve septation. Interestingly, the
Drosophila homologue of Tbx1, Org-1, is expressed in a
subpopulation of visceral muscle cell precursors, the so-called pioneer cells,
which have patterning activity (Lee et
al., 2003
).
Our data show that Tbx1 has an additional role in OFT morphogenesis because
it is required for the formation of the AP septum in
Tbx1/, Tbx1neo/neo, and
conditional mutants. Because the AP septum is mainly contributed by neural
crest-derived cells, it is possible that this phenotype is caused, at least in
part, by the observed reduced population of migrating neural crest-derived
cells in the 4th pharyngeal arch of conditional mutants. However, this
reduction appears modest, and the conotruncal ridges, which are also populated
by a substantial number of neural crest cells, are only slightly reduced in
size. Therefore, we hypothesize that AP septum aplasia in conditional mutants
is because of defective morphogenesis of the aortic sac. This morphogenetic
defect is consistent with the pharyngeal segmentation defect observed in
Tbx1/ mutants. It has been proposed that the
Tbx1 role in pharyngeal segmentation may be related to its expression
in the pharyngeal endoderm (Baldini,
2002
; Lindsay,
2001
). The AP septum phenotype in conditional mutants correlates
well with overlap of Tbx1 and Nkx2.5Cre-induced
recombination in the pharyngeal endoderm and wall of the aortic sac.
SHF function and congenital heart disease
Presumably, an as yet unknown signal induces naïve splanchnic
mesodermal cells to an OFT myocardial fate. One of the consequences of this
signal is the expression of Nkx2.5, possibly one of the first markers
of specification of this cell population. Nkx2.5 is required for the formation
of a canalized OFT conduit (Lyons et al.,
1995
; Tanaka et al.,
1999
) (M.M., unpublished). However, proper morphogenesis of the
OFT requires sustained contribution of specified cells throughout an extended
period of time (approximately between E9.0 and E11.0) because resident OFT
myocytes have a low proliferative capacity at this stage. We propose that the
function of Tbx1 is to maintain cell contribution to the OFT at a sufficiently
high level to support growth and remodeling of the OFT
(Fig. 6H). This function may be
directed towards the entire population of myocyte precursors, or perhaps more
probable, towards a specific sub-population. Whatever the target cell
population may be, the effect of Tbx1 on cell proliferation is cell
non-autonomous.
Our data provide the first evidence that a genetic defect related to human
congenital heart disease affects directly the function of the SHF. Our data do
not allow us to determine exactly what type of defect is caused by SHF
malfunction. However, on the basis of our observations it is reasonable to
speculate that these may include defects of OFT alignment (also consistent
with results obtained in chick) (Yelbuz et
al., 2002
) and defects of truncal valve septation. Thus, many of
the common heart defects observed in children, including Tetralogy of Fallot,
double outlet right ventricle, some types of ventricular septal defects and
some types of truncus arteriosus, may be caused by SHF malfunction. Therefore,
it is very probable that the definition of genetic pathways regulating SHF
function will lead to other genes involved in congenital heart disease. The
identification of the role of Tbx1 in the SHF is the first step in this
direction.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Agah, R., Frenkel, P. A., French, B. A., Michael, L. H., Overbeek, P. A. and Schneider, M. D. (1997). Gene recombination in postmitotic cells. Targeted expression of Cre recombinase provokes cardiac-restricted, site-specific rearrangement in adult ventricular muscle in vivo. J. Clin. Invest. 100,169 -179.[Medline]
Agarwal, P., Wylie, J. N., Galceran, J., Arkhitko, O., Li, C.,
Deng, C., Grosschedl, R. and Bruneau, B. G. (2003). Tbx5 is
essential for forelimb bud initiation following patterning of the limb field
in the mouse embryo. Development
130,623
-633.
Albrecht, U., Eichele, G., Helms, J. A. and Lu, H. C. (1997). Visualization of gene expression patterns by in situ hybridization. In Molecular and Cellular Methods in Developmental Toxicology (ed. G. P. Daston), pp.23 -48. New York: CRC Press, Inc.
Baldini, A. (2002). DiGeorge syndrome: the use
of model organisms to dissect complex genetics. Hum. Mol.
Genet. 11,2363
-2369.
Biben, C., Weber, R., Kesteven, S., Stanley, E., McDonald, L.,
Elliott, D. A., Barnett, L., Koentgen, F., Robb, L., Feneley, M. et al.
(2000). Cardiac septal and valvular dysmorphogenesis in mice
heterozygous for mutations in the homeobox gene Nkx2-5. Circ.
Res. 87,888
-895.
Bruneau, B. G., Nemer, G., Schmitt, J. P., Charron, F., Robitaille, L., Caron, S., Conner, D. A., Gessler, M., Nemer, M., Seidman, C. E. et al. (2001). A murine model of Holt-Oram syndrome defines roles of the T-box transcription factor Tbx5 in cardiogenesis and disease. Cell 106,709 -721.[CrossRef][Medline]
Chapman, D. L., Garvey, N., Hancock, S., Alexiou, M., Agulnik, S. I., Gibson-Brown, J. J., Cebra-Thomas, J., Bollag, R. J., Silver, L. M. and Papaioannou, V. E. (1996). Expression of the T-box family genes, Tbx1-Tbx5, during early mouse development. Dev. Dyn. 206,379 -390.[CrossRef][Medline]
Giguere, V., Lyn, S., Yip, P., Siu, C. H. and Amin, S.
(1990). Molecular cloning of cDNA encoding a second cellular
retinoic acid- binding protein. Proc. Natl. Acad. Sci.
USA 87,6233
-6237.
Hayashi, S. and McMahon, A. P. (2002). Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse. Dev. Biol. 244,305 -318.[CrossRef][Medline]
Jerome, L. A. and Papaioannou, V. E. (2001). DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1.Nat. Genet. 27,286 -291.[CrossRef][Medline]
Jiang, X., Rowitch, D. H., Soriano, P., McMahon, A. P. and Sucov, H. M. (2000). Fate of the mammalian cardiac neural crest. Development 127,1607 -1616.[Abstract]
Kelly, R. G. and Buckingham, M. E. (2002). The anterior heart-forming field: voyage to the arterial pole of the heart. Trends Genet. 18,210 -216.[CrossRef][Medline]
Kelly, R. G., Brown, N. A. and Buckingham, M. E. (2001). The arterial pole of the mouse heart forms from Fgf10-expressing cells in pharyngeal mesoderm. Dev. Cell 1,435 -440.[CrossRef][Medline]
Kirby, M. L. and Waldo, K. L. (1995). Neural
crest and cardiovascular patterning. Circ. Res.
77,211
-215.
Kisanuki, Y. Y., Hammer, R. E., Miyazaki, J., Williams, S. C., Richardson, J. A. and Yanagisawa, M. (2001). Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev. Biol. 230,230 -242.[CrossRef][Medline]
Kochilas, L., Merscher-Gomez, S., Lu, M. M., Potluri, V., Liao, J., Kucherlapati, R., Morrow, B. and Epstein, J. A. (2002). The role of neural crest during cardiac development in a mouse model of DiGeorge syndrome. Dev. Biol. 251,157 -166.[CrossRef][Medline]
Lee, H. H., Norris, A., Weiss, J. B. and Frasch, M. (2003). Jelly belly protein activates the receptor tyrosine kinase Alk to specify visceral muscle pioneers. Nature 425,507 -512.[CrossRef][Medline]
Li, J., Chen, F. and Epstein, J. A. (2000). Neural crest expression of Cre recombinase directed by the proximal Pax3 promoter in transgenic mice. Genesis 26,162 -164.[CrossRef][Medline]
Lindsay, E. A. (2001). Chromosomal microdeletions: dissecting del22q11 syndrome. Nat. Rev. Genet. 2,858 -868.[CrossRef][Medline]
Lindsay, E. A., Botta, A., Jurecic, V., Carattini-Rivera, S., Cheah, Y.-C., Rosenblatt, H. M., Bradley, A. and Baldini, A. (1999). Congenital heart disease in mice deficient for the DiGeorge syndrome region. Nature 401,379 -383.[CrossRef][Medline]
Lindsay, E. A., Vitelli, F., Su, H., Morishima, M., Huynh, T., Pramparo, T., Jurecic, V., Ogunrinu, G., Sutherland, H. F., Scambler, P. J. et al. (2001). Tbx1 haploinsufficieny in the DiGeorge syndrome region causes aortic arch defects in mice. Nature 410,97 -101.[CrossRef][Medline]
Lyons, I., Parsons, L. M., Hartley, L., Li, R., Andrews, J. E.,
Robb, L. and Harvey, R. P. (1995). Myogenic and morphogenetic
defects in the heart tubes of murine embryos lacking the homeobox gene Nkx2-5.
Genes Dev. 9,1654
-1666.
Merscher, S., Funke, B., Epstein, J. A., Heyer, J., Puech, A., Min Lu, M. M., Xavier, R. J., Demay, M. B., Russell, R. G., Factor, S. et al. (2001). TBX1 is responsible for cardiovascular defects in Velo-Cardio-Facial/DiGeorge syndrome. Cell 104,619 -629.[CrossRef][Medline]
Mjaatvedt, C. H., Nakaoka, T., Moreno-Rodriguez, R., Norris, R. A., Kern, M. J., Eisenberg, C. A., Turner, D. and Markwald, R. R. (2001). The outflow tract of the heart is recruited from a novel heart-forming field. Dev. Biol. 238,97 -109.[CrossRef][Medline]
Moses, K. A., DeMayo, F., Braun, R. M., Reecy, J. L. and Schwartz, R. J. (2001). Embryonic expression of an Nkx2-5/Cre gene using ROSA26 reporter mice. Genesis 31,176 -180.[CrossRef][Medline]
Phillips, M. T., Kirby, M. L. and Forbes, G.
(1987). Analysis of cranial neural crest distribution in the
developing heart using quail-chick chimeras. Circ.
Res. 60,27
-30.
Sohal, D. S., Nghiem, M., Crackower, M. A., Witt, S. A.,
Kimball, T. R., Tymitz, K. M., Penninger, J. M. and Molkentin, J. D.
(2001). Temporally regulated and tissue-specific gene
manipulations in the adult and embryonic heart using a tamoxifen-inducible Cre
protein. Circ. Res. 89,20
-25.
Soriano, P. (1999). Generalized lacZ expression with the ROSA26 Cre reporter strain [letter]. Nat. Genet. 21,70 -71.[CrossRef][Medline]
Tanaka, M., Chen, Z., Bartunkova, S., Yamasaki, N. and Izumo, S. (1999). The cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple genes essential for heart development. Development 126,1269 -1280.[Abstract]
van den Hoff, M. J., Moorman, A. F., Ruijter, J. M., Lamers, W. H., Bennington, R. W., Markwald, R. R. and Wessels, A. (1999). Myocardialization of the cardiac outflow tract. Dev. Biol. 212,477 -490.[CrossRef][Medline]
Verrou, C., Zhang, Y., Zurn, C., Schamel, W. W. and Reth, M. (1999). Comparison of the tamoxifen regulated chimeric Cre recombinases MerCreMer and CreMer. Biol. Chem. 380,1435 -1438.[CrossRef][Medline]
Vitelli, F., Lindsay, E. A. and Baldini, A. (2002a). Genetic dissection of the DiGeorge syndrome phenotype. Cold Spring Harbor Symp. Quant. Biol. LXVII,327 -332.
Vitelli, F., Morishima, M., Taddei, I., Lindsay, E. A. and
Baldini, A. (2002b). Tbx1 mutation causes multiple
cardiovascular defects and disrupts neural crest and cranial nerve migratory
pathways. Hum. Mol. Genet.
11,915
-922.
Vitelli, F., Taddei, I., Morishima, M., Meyers, E. N., Lindsay,
E. A. and Baldini, A. (2002c). A genetic link between Tbx1
and fibroblast growth factor signaling. Development
129,4605
-4611.
Vitelli, F., Viola, A., Morishima, M., Pramparo, T., Baldini, A.
and Lindsay, E. (2003). TBX1 is required for inner ear
morphogenesis. Hum. Mol. Genet.
12,2041
-2048.
Waldo, K. L., Kumiski, D. H., Wallis, K. T., Stadt, H. A., Hutson, M. R., Platt, D. H. and Kirby, M. L. (2001). Conotruncal myocardium arises from a secondary heart field. Development 128,3179 -3188.
Yagi, H., Furutani, Y., Hamada, H., Sasaki, T., Asakawa, S., Minoshima, S., Ichida, F., Joo, K., Kimura, M., Imamura, S.-i. et al. (2003). Role of TBX1 in human del22q11.2 syndrome. Lancet 362,1366 -1373.[CrossRef][Medline]
Yelbuz, T. M., Waldo, K. L., Kumiski, D. H., Stadt, H. A.,
Wolfe, R. R., Leatherbury, L. and Kirby, M. L. (2002).
Shortened outflow tract leads to altered cardiac looping after neural crest
ablation. Circulation
106,504
-510.
Related articles in Development:
This article has been cited by other articles:
![]() |
E. J. Park, Y. Watanabe, G. Smyth, S. Miyagawa-Tomita, E. Meyers, J. Klingensmith, T. Camenisch, M. Buckingham, and A. M. Moon An FGF autocrine loop initiated in second heart field mesoderm regulates morphogenesis at the arterial pole of the heart Development, November 1, 2008; 135(21): 3599 - 3610. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Kirby Pulmonary Atresia or Persistent Truncus Arteriosus: Is It Important to Make the Distinction and How Do We Do It? Circ. Res., August 15, 2008; 103(4): 337 - 339. [Full Text] [PDF] |
||||
![]() |
D Obler, A L Juraszek, L B Smoot, and M R Natowicz Double outlet right ventricle: aetiologies and associations J. Med. Genet., August 1, 2008; 45(8): 481 - 497. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Theveniau-Ruissy, M. Dandonneau, K. Mesbah, O. Ghez, M.-G. Mattei, L. Miquerol, and R. G. Kelly The del22q11.2 Candidate Gene Tbx1 Controls Regional Outflow Tract Identity and Coronary Artery Patterning Circ. Res., July 18, 2008; 103(2): 142 - 148. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-L. Laugwitz, A. Moretti, L. Caron, A. Nakano, and K. R. Chien Islet1 cardiovascular progenitors: a single source for heart lineages? Development, January 15, 2008; 135(2): 193 - 205. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang and A. Baldini In vivo response to high-resolution variation of Tbx1 mRNA dosage Hum. Mol. Genet., January 1, 2008; 17(1): 150 - 157. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. S. Hakim, L. A. DiMichele, J. T. Doherty, J. W. Homeister, H. E. Beggs, L. F. Reichardt, R. J. Schwartz, J. Brackhan, O. Smithies, C. P. Mack, et al. Conditional Deletion of Focal Adhesion Kinase Leads to Defects in Ventricular Septation and Outflow Tract Alignment Mol. Cell. Biol., August 1, 2007; 27(15): 5352 - 5364. [Abstract] [Full Text] [PDF] |
||||
![]() |