|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 June 2004
doi: 10.1242/dev.01179
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


Gene Expression Laboratory, The Salk Institute for Biological Studies, La Jolla, CA 92037, USA
Author for correspondence (e-mail:
pfaff{at}salk.edu)
Accepted 22 March 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Motoneuron, Development, Hb9, Enhancer, Gene regulation, Derepression
| Introduction |
|---|
|
|
|---|
Motoneurons form synapses with muscles and directly mediate the control of
locomotion, whereas a variety of different types of spinal cord interneurons
coordinate and modulate motoneuron activity
(Butt et al., 2002
;
Sharma and Peng, 2001
).
Motoneurons and individual locomotor-interneuron classes emerge from distinct
progenitor cell domains along the dorsoventral axis of the neural tube.
Progenitor cells in each domain are specified by graded sonic hedgehog (Shh)
signaling (Ericson et al.,
1997
), leading to the expression of unique combinations of
homeodomain and basic helix-loop-helix (bHLH) transcription factors
(Briscoe et al., 2000
;
Mizuguchi et al., 2001
;
Novitch et al., 2001
).
These findings have raised the question of how cells interpret small
differences in Shh at progenitor cell boundaries where signaling is close to
the threshold for two alternative differentiation pathways. One mechanism that
contributes to the accurate assignment of cell fate is a process of
cross-inhibitory transcriptional interactions between factors from different
domains (Briscoe et al., 2000
;
Muhr et al., 2001
). Many of
the progenitor factors contain an eh1 motif homologous to the Engrailed
transcription factor (Muhr et al.,
2001
), which serves as a docking site for Gro/TLE corepressors
that recruit histone deacetylases associated with chromatin modifications that
reduce transcription (Chen et al.,
1999
). Interactions with Gro/TLE corepressors not only mediate
cross-repression, but are also necessary for the progenitor factors to specify
which types of neurons are generated
(Briscoe et al., 2000
;
Muhr et al., 2001
). Taken
together, these observations have suggested that gene regulation is controlled
in specific areas of the developing neural tube by cell-type specific
repressors acting to inhibit general activators of transcription
(Muhr et al., 2001
) (reviewed
by Lee and Pfaff, 2001
). Thus,
the genes expressed by neuronal subtypes are predicted to be transcribed
through a process of `derepression', though mechanistic studies of gene
regulation in the neural tube have not directly tested this model.
The transcription factors known to be involved in the early stages of
motoneuron differentiation include the homeodomain proteins Nkx6.1/6.2, Pax6
and Mnr2; and the bHLH proteins Olig1/2 and Ngn2
(Briscoe et al., 2000
;
Ericson et al., 1997
;
Lu et al., 2002
;
Marquardt and Pfaff, 2001
;
Mizuguchi et al., 2001
;
Novitch et al., 2001
;
Scardigli et al., 2001
;
Tanabe et al., 1998
;
Vallstedt et al., 2001
;
Zhou and Anderson, 2002
). As
the progenitor cells for motoneurons depart from the cell cycle and begin to
differentiate, the LIM homeodomain proteins Lhx3/4 and Isl1 become expressed.
This combination of LIM proteins forms a higher-order complex with the LIM
co-factor nuclear LIM interactor (NLI) through cell-type specific
protein-protein interactions that specifies the motoneuron fate
(Thaler et al., 2002
). The
initiation of postmitotic motoneuron differentiation is accompanied by the
downregulation of the progenitor cell factors and the selective expression of
the Hb9 homeodomain protein in these neurons
(Pfaff et al., 1996
;
Tanabe et al., 1998
).
In humans, hereditary mutations of HB9 (HLXB9
Human Gene Nomenclature Database) result in sacral agenesis due to
haploinsufficiency (Ross et al.,
1998
). Null mutants of Hb9 (Hlxb9 Mouse
Genome Informatics) in mice reveal a crucial role for this transcription
factor in motoneuron development (Arber et
al., 1999
; Thaler et al.,
1999
). Mice deficient in Hb9 generate defective motoneurons that
inappropriately express V2 interneuron genes, such as Chx10, and fail
to migrate and extend axons properly. The suppressive function of Hb9 on V2
interneuron genes is presumably required because motoneurons and V2
interneurons have a close developmental relationship and share several
regulatory proteins such as Lhx3 and Lhx4, which contribute to the
specification of both motoneurons and V2 interneurons
(Sharma et al., 1998
;
Tanabe et al., 1998
;
Thaler et al., 2002
).
Consequently, when Hb9 is ectopically expressed in the adjacent population of
V2 interneurons, it blocks the development of these cells
(Tanabe et al., 1998
). Thus,
proper cell fate specification in the spinal cord is dependent upon the
exclusion of Hb9 from the adjacent interneuron populations and its expression
in motoneurons as the cells become postmitotic.
Studies in transgenic mice have identified a 9 kb upstream region of the
Hb9 promoter that is sufficient to target reporter gene expression to
motoneurons (Arber et al.,
1999
; Thaler et al.,
1999
). We reasoned that this regulatory region of Hb9
could be used as a substrate to characterize the molecular mechanisms
responsible for directing the proper temporal and spatial pattern of gene
expression to specific cell types in the developing nervous system. The
combination of LIM factors Isl1 and Lhx3, together with the bHLH factors
NeuroM and Ngn2 are found to bind to the Hb9 promoter and activate
its transcription (Lee and Pfaff,
2003
). It remains unclear, however, whether the temporal and
spatial pattern of Hb9 is controlled entirely by motoneuron-specific
positive regulators, or whether repressive mechanisms also contribute to its
specific pattern of expression.
We developed an in vivo method for characterizing gene regulation using
electroporation of chick neural tube cells to further characterize the
mechanisms that control gene expression in the developing spinal cord. In
addition to an enhancer located at 7096 to 6896 for activating
high level Hb9 expression in motoneurons, general activator proteins
E2F and Sp1 appear to interact with the proximal segment of the gene from
550 to 1 and promote non-cell-type-specific transcription. The
widespread activity of the general activators of Hb9 are inhibited in
non-motoneuron cells through the use of multiple repressor proteins that
interact with sites located both within and outside the enhancer region. These
studies provide direct support for the hypothesis of Muhr et al.
(Muhr et al., 2001
), which
predicts that progenitor cell transcription factors in the developing spinal
cord regulate cell fate through a derepression mechanism.
| Materials and methods |
|---|
|
|
|---|
NheI proximal-GFP,
NheI proximal-nlacZ, synthetic TATA-GFP, d4GFP
(Clontech) and TK-luciferase (gift of R. Evans). Mutations in the M250
enhancer were introduced using a PCR-based mutagenesis method (Stratagene,
QuikChange), and verified by sequencing. Rat Isl1, Hb9 and Nkx6.1; mouse Lhx3,
Ngn2, Nkx2.2, Pax6, Irx3, Hb9 and E47; chick NeuroM and NeuroD were cloned
into pCS2 (Turner and Weintraub,
1994
In ovo electroporation and immunocytochemistry
Chick embryos (SPAFAS, McIntyre Farms) were incubated in a humidified
chamber and staged according to Hamburger and Hamilton (HH)
(Hamburger and Hamilton,
1951
). DNA constructs were injected into the lumens of HH stage
12-13 chick embryonic spinal cords. Electroporation was performed using a
square wave electroporator (BTX) as described previously
(Nakamura et al., 2000
).
Incubated chicks were harvested and analyzed at HH stage 20-24, fixed in 4%
paraformaldehyde and cryosectioned. Immunohistochemistry was performed as
described previously (Thaler et al.,
1999
) using the following antibodies: mouse anti-MNR2/HB9 (5C10)
(Tanabe et al., 1998
), rabbit
anti-Hb9 (Thaler et al.,
1999
), rabbit anti-Isl1
(Ericson et al., 1992
), rabbit
anti-lacZ (Sigma), mouse anti-Myc (9E10, DSHB) and rabbit anti-GFP
(Molecular Probes).
Generation of transgenic mice
The wild-type Hb9 enhancer (M250) and mutated derivatives were
fused upstream of the
NheI proximal element-GFP or synthetic
TATA-GFP. Restriction enzymes were used to cleave the promoter+reporter
fragments from the plasmids, and the purified DNA was injected into mouse
oocyte pronuclei. After microinjection, the fertilized embryos were
transferred into pseudo-pregnant females and embryos were removed at E11.5 for
analysis. Genotyping was performed by PCR with the GFP primers:
5'-AGAAACCATGGACTTGTACAGCTCGT and 5'-GGTCGCCACCATGGTGAGCAA.
Cell culture and transient transfection assays
293, CV1 and P19 cells were cultured in Dulbecco's modified Eagle medium or
-minimum essential medium supplemented with 10% bovine fetal serum.
Cells were seeded into 48-well plates and transient transfections were
performed using Lipofectamine 2000 (Invitrogen) according to the
manufacturer's instruction. A CMV-ß-galactosidase plasmid was
co-transfected for normalization of transfection efficiency, and empty vectors
were used to equalize the total amount of DNA. Cells were harvested 36 hours
after transfection. Cell extracts were assayed for luciferase activity and the
values were corrected with ß-galactosidase activity. Data are represented
as means of triplicate values obtained from representative experiments. All
transfections were repeated at least three times.
Electrophoretic mobility shift assays (EMSA)
EMSA was performed as previously described
(Lee and Pfaff, 2003
). The
sequence of the sense strands of individual oligonucleotides is shown below.
M3-oligo, CTCTCAGCCTTTCAGTGGAATT; 3'CD-A,
AATAGACCAATTAGCCAGGACTTCCTGCCATTATCTGCTGTAGAC; 3'CD-B,
TAGACTTGGGCATTAGTACGCCCTGATTCACCATAATTTCAAGTCA; 3'CD-C,
AAGTCAGAACACACTAAAAAATTCACTCACCGAGGCATTAAAATGT. The sequence of M50, M100A and
M100C has been described previously (Lee
and Pfaff, 2003
).
| Results |
|---|
|
|
|---|
|
Characterization of an enhancer active in motor neurons
The evolutionarily conserved regions within the Hb9 promoter were
scattered across the 9.2 kb fragment, therefore we began by making a series of
deletions to localize the regulatory elements
(Fig. 1A). Truncating the
distal 8.5 kb segment of the promoter (
NheI, 1386 to
1) disrupted the normal activity of the promoter and resulted in low
levels of GFP expression throughout the neural tube
(Fig. 1D). Further mapping of
the promoter found that a distal 2.5 kb segment from 8129 to
5575 with four areas of high nucleotide conservation was the main
region responsible for directing motoneuron-specific expression of GFP when
fused to the proximal segment of the Hb9 promoter
(Fig. 1A,E).
To better understand the positive regulation of Hb9 in
motoneurons, we next subdivided the 2.5 kb distal fragment into smaller
segments using a series of 5' and 3' deletions around the
evolutionarily conserved sequences (Fig.
1B). This mapping led to the identification of a 231 nucleotide
sequence (M250, 7121 to 6890) containing two subregions of
extremely high sequence conservation, M50 (7096 to 7051) and
M100 (6997 to 6896). Although neither M50 nor M100 alone were
sufficient to direct motoneuron expression, the combination was active in
motoneurons (Fig. 1B,F)
(Lee and Pfaff, 2003
). As with
the
NheI construct, however, low level GFP expression was also
detected in non-motoneurons, suggesting that elements outside of the M250
region might contribute to the inhibition of Hb9 expression in
non-motoneurons (see below).
To determine whether the proximal 1386 to 1 region of
Hb9 was necessary for M250 function, we replaced this segment with a
minimal 70 nucleotide synthetic TATA element
(Colgan and Manley, 1992
). The
M250+TATA construct was expressed at high levels in motoneurons, whereas the
TATA element alone had little or no activity
(Fig. 1G, data not shown). GFP
expression from the M250+TATA construct was more restricted to motoneurons
than the M250+
NheI construct (compare
Fig. 1F with G). This
difference is probably due to the presence of an element/s for a general
activator/s located within the proximal 1386 to 1 area of the
Hb9 promoter that is not present in constructs with a synthetic TATA
element (see below).
The identification of a compact regulatory region from 7121 to
6890 (M250) in Hb9 that was sufficient to promote reporter
gene expression in chick motoneurons led us to test whether the
cis-elements in the M250 DNA segment were also active in mouse
motoneurons. The linearized M250+
NheI:GFP construct was
injected into mouse oocyte pronuclei, and embryos were examined at E11.5
shortly after motoneurons are postmitotically generated
(Fig. 1H). GFP+
motoneurons were detected in four out of five independent transgenic embryos
(Table 1). Double labeling with
motoneuron and interneuron markers revealed that the highest levels of GFP
were detected in Hb9+, Isl1/2+ motoneurons, although
lower levels of ectopic expression was detected in cells near to but not
overlapping with the V2 interneuron population marked by Lhx3 and Chx10, and
dorsal root ganglion cells flanking the neural tube (see Fig. S1 at
http://dev.biologists.org/supplemental).
Taken together, our findings indicate that M250 is an evolutionarily conserved
regulatory region, which is further supported by the finding that M250 is
active in transgenic mouse motoneurons when linked to a synthetic TATA element
(M250+TATA, data not shown). Because the M250 region of Hb9 from
7121 to 6890 is a module that contributes to cell-type-specific
gene expression in a distance and orientation-independent manner (data not
shown), we conclude that M250 is a motoneuron enhancer (MNE).
However, this enhancer in isolation is not sufficient to restrict gene
expression to only motoneurons (Fig.
1F,H), necessitating the involvement of other regulatory inputs to
control Hb9 expression (see below).
|
E box elements are necessary for Hb9 expression in motor neurons
Examination of the M250 sequence (7121 to 6890) revealed
several candidate binding sites for transcription factors, including two
consensus E box elements for bHLH protein binding (CANNTG) characterized in a
previous study by Lee and Pfaff (Lee and
Pfaff, 2003
) (Fig.
2A). To test the function of these E box elements in vivo, point
mutations were used to alter the sequences
(Fig. 2B). Mutations in the M50
E box had a minimal effect on M250 activity, whereas mutation of the M100 E
box reduced motoneuron expression more dramatically (data not shown). The
combination of M50 and M100 mutations disrupted the normal activity of M250 in
chick motoneurons, as previously reported
(Fig. 2C,D) (Lee and Pfaff, 2003
).
Mutation of the E boxes had two affects on transgene expression: GFP labeling
in motoneurons was markedly reduced, whereas GFP labeling in non-motoneurons
became more apparent (Fig. 2D).
These findings suggest that the E box elements might function to enhance
expression in motoneurons and suppress Hb9 in non-motoneurons. Next,
we tested whether the E box elements were necessary for Hb9
expression in mice. Transgenic mouse embryos with both E boxes mutated
exhibited a dramatic reduction in the level and frequency of reporter gene
expression in motoneurons compared with the wild-type enhancer element
(Fig. 2E,F;
Table 1).
|
|
|
Proximal elements are necessary for enhancer function
Deletions of the Hb9 promoter had two effects on transcription:
they disrupted high-level motoneuron expression, and they led to low level but
widespread ectopic GFP labeling (Fig.
1D). This ectopic labeling appeared to be dependent on sequences
within the proximal 1386 to 1 segment of Hb9, as
replacement of this region with a synthetic TATA element preserved the
motoneuron labeling but eliminated the ectopic expression (compare
Fig. 1F with 1G). To examine
the `general' activators of Hb9, we optimized the reporter-labeling
to more easily monitor transcription. We found that using immunocytochemistry
to detect nlacZ was more sensitive than GFP fluorescence (compare
Fig. 1D with
Fig. 5D).
|
BamHI),
which contained the majority of conserved domains, resulted in the ectopic
expression of nlacZ along the entire dorsoventral axis of the neural
tube (Fig. 5A-C). Constructs
with further 5' deletions of Hb9 continued to express
nlacZ throughout the neural tube
(Fig. 5A,D,E). Thus, the
550 to 1 segment of Hb9 appears to contain binding
sites for general-activators capable of promoting the widespread activation of
the gene (Fig. 5I). This region
of Hb9 contains potential binding sites for several transcription
factors, including Sp1 and E2F (Fig.
5J). To test directly whether E2F and Sp1 could enhance gene
expression, CV1 cells were transfected with expression constructs encoding
these transcription factors along with an Hb9-luciferase reporter. We
found that both E2F and Sp1 activated transcription alone and in combination,
suggesting these factors contribute to the general activation of Hb9
via the proximal region of its promoter
(Fig. 5K). Next, we examined the role of general activators in contributing to the transcription of Hb9 in motoneurons. We found that the enhancer contained within the 2.5 kb distal fragment (8129 to 5575) appears to function more efficiently in the context of the general-activators that bind to the 550 to 1 proximal region (Fig. 5F,H). Consequently, deletion of the most proximal region of Hb9 markedly reduced the level of reporter expression in motoneurons (compare Fig. 5G with 5H). These findings indicate that general activators interacting with the proximal region of Hb9 facilitate enhancer function.
Repressors suppress Hb9 in non-motor neurons
As the basal promoter from 550 to 1 is capable of driving
transcription in many cell types, we considered the possibility that
repressors might be involved in extinguishing Hb9 expression in
non-motoneurons. We focused on the distal region from 9189 to
3533 deleted from the
BamHI clone, as the loss of this
segment unmasked the activity of the general activators
(Fig. 5C). The 1 kb distal
fragment from 9189 to 8124 was insufficient to restrict
Hb9 expression to motoneurons
(Fig. 6A-C), whereas both the
4.6 kb (8129 to 3533) and 2.5 kb (8129 to 5579)
fragments markedly suppressed the ectopic expression of nlacZ in
non-motoneurons (Fig. 6D,E).
Two observations suggested that repressors interact at multiple sites within
Hb9. First, the 4.6 kb construct appeared to suppress ectopic
reporter expression better than the 2.5 kb segment of Hb9
(Fig. 6D,E), and second, both
5' and 3' deletions of the 2.5 kb fragment resulted in a marked
increase in the level of ectopic expression (data not shown). Thus, repressors
acting at multiple sites both within and outside the enhancer region at
7121 to 6890 appear to fine-tune the pattern of Hb9
expression (Fig. 6F).
|
50-500 fold by
Nkx2.2 and Irx3, whereas Pax6 and Nkx6.1 were significantly less active
(Fig. 7A). These findings
suggest that progenitor cell factors such as Nkx2.2 and Irx3 expressed by
non-motoneuron cells suppress the expression of Hb9.
|
| Discussion |
|---|
|
|
|---|
|
The general activation of Hb9 via the proximal promoter occurs in
dividing cells, postmitotic neurons, and neural crest derivatives such as the
dorsal root ganglia (data not shown). The precise role of general
transcription factors such as E2F, Sp1 and their related family members needs
to be further examined; however, it is interesting that these two proteins
interact to promote transcription
(Karlseder et al., 1996
). Our
findings raise the question of why a motoneuron-specific gene such as
Hb9 receives transcriptional inputs from non-specific factors? A
general feature of cell specific gene regulation is that many activators
appear to be insufficient to promote maximal levels of transcription, known as
`activator insufficiency' (Barolo and
Posakony, 2002
). In support of this, Hb9 enhancer
function was facilitated by the proximal 550 to 1 segment of the
gene which mediates interactions with general activators.
The coordinated use of general activators with enhancer-factors to promote
high level gene expression, however, raises the problem of how to prevent
inappropriate expression of the gene in non-motoneurons. The strategy used to
block the general activators of Hb9 from promoting leaky expression
in non-motoneurons is based on transcriptional repression. The repressors we
identified, Nkx2.2 and Irx3, represent transcription factors implicated in the
development of progenitor cells (Briscoe et
al., 2000
; Briscoe et al.,
1999
). The binding sites for repressors appear to be more widely
dispersed, and fall both within and outside of the enhancer region
(Fig. 8B). This organization
may facilitate the function of both short and long range types of
transcriptional repression that are mediated by different types of
co-repressors such as Gro/TLE and CtBP
(Zhang and Levine, 1999
).
Ectopic expression of Nkx2.2 and Irx3 suppress motoneuron differentiation in
vivo (Briscoe et al., 2000
;
Briscoe et al., 1999
;
Muhr et al., 2001
). Our
finding that Nkx2.2 and Irx3 inhibit Hb9 transcription in 293 cells
is consistent with the possibility that these transcription factors bind
directly to the Hb9 promoter, as indirect gene regulation is likely
to be less permissive in these non-neuronal cells, though further analyses are
required to establish this definitively. If Nkx2.2 and Irx3 act directly to
suppress Hb9, a remaining question is whether the co-repressors that
these transcription factors recruit function by modulating the activity of the
positive-acting factors in the enhancer and proximal promoter and/or by
modifying histones to suppress transcription
(Kuo and Allis, 1998
).
Although Irx3 is found to inhibit Hb9 expression, this may occur
in a context-dependent fashion because Irx3 is also detected in some
postmitotic motoneurons (Cohen et al.,
2000
). One possibility is that the function of Irx3 is
developmentally regulated as progenitor cells differentiate. In this scenario,
Irx3 would repress Hb9 in dividing cells but not postmitotic
motoneurons. Alternatively, Irx3 may function constitutively as a repressor,
but the activity of the motoneuron-specific factors acting via the enhancer
may be sufficient to overcome the repressive activity of Irx3. As Hb9 levels
vary in different motor column subtypes
(Arber et al., 1999
;
Tanabe et al., 1998
;
Thaler et al., 1999
), it is
possible that Irx3 levels contribute to this finer level of Hb9
regulation among motor subtypes.
Although the repressor factors identified in this study are known to be
expressed in the progenitor cells of the neural tube, it is less clear what
prevents Hb9 expression in postmitotic interneurons. One possibility
is that the repressors in the progenitor cells for interneurons imprint the
gene with stable modifications that persist postmitotically. Alternatively, a
new set of repressor proteins might function in interneurons (XR,
Fig. 8B), such as the
postmitotic interneuron factors Chx10, En1 and Evx1/2 which interact with the
Gro/TLE class of co-repressors (Han and
Manley, 1993
; Jaynes and
O'Farrell, 1991
; Liu et al.,
1994
). Although the underlying basis for repressing Hb9
in postmitotic interneurons is poorly defined, the suppression of the general
activators for Hb9 present in both progenitor cells and interneurons
suggests that transcriptional derepression is a mechanism that can operate
within progenitor cells and postmitotic neurons.
A neuronal subtype enhancer
Although transcriptional repression is necessary to prevent Hb9
from becoming transcribed in non-motoneurons, high level expression in
motoneurons is facilitated by a 231 nucleotide enhancer region
(MNE) located from 7121 to 6890. Thus, derepression
is not the only mechanism that operates to control Hb9 expression.
The core sequences within the enhancer are conserved between mouse, rat and
human, and function in both mouse and chick embryos
(Lee and Pfaff, 2003
). Results
shown here, in combination with those from a previous study
(Lee and Pfaff, 2003
),
demonstrate that point mutations within two E box elements for bHLH factors
and four ATTA elements that bind homeodomain factors disrupt normal
Hb9 expression. The sequential expression of Ngn2, NeuroM and NeuroD
in developing motoneurons suggests that the composition of the enhancesome
complex involved in activating and maintaining Hb9 expression changes
as these cells develop.
In this report, we have defined an in vivo method for characterizing gene
regulation that should be applicable for the analysis of other promoters in
the embryonic spinal cord (Timmer et al.,
2001
). High level Hb9 expression in motoneurons appears
to be facilitated by two types of activators those that establish a
neuron-specific enhancer-complex and general activators that function in a
non-cell-type-specific manner. Our findings are consistent with the
possibility that the two types of activators function cooperatively via a
mechanism termed activator insufficiency
(Barolo and Posakony, 2002
).
This regulatory strategy, however, necessitates the use of repressors to
prevent the inappropriate activation of Hb9. Thus, in motoneurons,
derepression of the activators is necessary to permit Hb9
expression.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
* Present address: Psychiatric Genomics, 19 Firstfield Rd., Gaithersburg, MD
20878, USA ![]()
Present address: Department of Molecular Neurobiology, Institute of
Development, Aging and Cancer, Tohoku University, Seiryo-machi 4-1, Aoba-ku,
Sendai 980-8575, Japan ![]()
| REFERENCES |
|---|
|
|
|---|
Arber, S., Han, B., Mendelsohn, M., Smith, M., Jessell, T. M.
and Sockanathan, S. (1999). Requirement for the
homeobox gene Hb9 in the consolidation of motor neuron identity.
Neuron 23,659
-674.[CrossRef][Medline]
Barolo, S. and Posakony, J. W. (2002). Three
habits of highly effective signaling pathways: principles of transcriptional
control by developmental cell signaling. Genes Dev.
16,1167
-1181.
Briscoe, J. and Ericson, J. (2001).
Specification of neuronal fates in the ventral neural tube. Curr.
Opin. Neurobiol. 11,43
-49.[CrossRef][Medline]
Briscoe, J., Pierani, A., Jessell, T. M. and Ericson, J.
(2000). A homeodomain protein code specifies progenitor cell
identity and neuronal fate in the ventral neural tube.
Cell 101,435
-445.[CrossRef][Medline]
Briscoe, J., Sussel, L., Serup, P., Hartigan-O'Connor, Jessell,
T. M., Rubenstein, J. L. R. and Ericson, J. (1999).
Homeobox gene Nkx2.2 and specification of neuronal identity by graded sonic
hedgehog signalling. Nature
398,622
-627.[CrossRef][Medline]
Broihier, H. T. and Skeath, J. B. (2002).
Drosophila homeodomain protein dHb9 directs neuronal fate via crossrepressive
and cell-nonautonomous mechanisms. Neuron
35, 39-50.[CrossRef][Medline]
Butt, S. J., Lebret, J. M. and Kiehn, O.
(2002). Organization of left-right coordination in the mammalian
locomotor network. Brain Res. Rev.
40,107
-117.[CrossRef][Medline]
Chen, G., Fernandez, J., Mische, S. and Courey, A. J.
(1999). A functional interaction between the histone deacetylase
Rpd3 and the corepressor groucho in Drosophila development. Genes
Dev. 13,2218
-2230.
Cohen, D. R., Cheng, C. W., Cheng, S. H. and Hui, C. C.
(2000). Expression of two novel mouse Iroquois homeobox genes
during neurogenesis. Mech. Dev.
91,317
-321.[CrossRef][Medline]
Colgan, J. and Manley, J. L. (1992). TFIID can
be rate limiting in vivo for TATA-containing, but not TATA-lacking, RNA
polymerase II promoters. Genes Dev.
6, 304-315.
Ericson, J., Rashbass, P., Schedl, A., Brenner-Morton, S.,
Kawakami, A., van Heyningen, V., Jessell, T. M. and Briscoe, J.
(1997). Pax6 controls progenitor cell identity and neuronal fate
in response to graded Shh signaling. Cell
90,169
-180.[CrossRef][Medline]
Ericson, J., Thor, S., Edlund, T., Jessell, T. M. and Yamada,
T. (1992). Early stages of motor neuron differentiation
revealed by expression of homeobox gene Islet-1.
Science 256,1555
-1560.
Ferrier, D. E., Brooke, N. M., Panopoulou, G. and Holland, P.
W. (2001). The Mnx homeobox gene class defined by HB9, MNR2
and amphioxus AmphiMnx. Dev. Genes Evol.
211,103
-107.[CrossRef][Medline]
Goulding, M., Lanuza, G., Sapir, T. and Narayan, S.
(2002). The formation of sensorimotor circuits. Curr.
Opin. Neurobiol. 12,508
-515.[CrossRef][Medline]
Hamburger, V. and Hamilton, H. (1951). A series
of normal stages in the development of chick embryo. J.
Morphol. 88,49
-92.[CrossRef]
Han, K. and Manley, J. L. (1993).
Transcriptional repression by the Drosophila even-skipped protein: definition
of a minimal repression domain. Genes Dev.
7, 491-503.
Jaynes, J. B. and O'Farrell, P. H. (1991).
Active repression of transcription by the engrailed homeodomain protein.
EMBO J. 10,1427
-1433.[Medline]
Jessell, T. M. (2000). Neuronal specification
in the spinal cord: inductive signals and transcriptional codes.
Nat. Rev. Genet. 1,20
-29.[CrossRef][Medline]
Jurata, L. W., Pfaff, S. L. and Gill, G. N.
(1998). The nuclear LIM domain interactor NLI mediates homo- and
heterodimerization of LIM domain transcription factors. J. Biol.
Chem. 273,3152
-3157.
Karlseder, J., Rotheneder, H. and Wintersberger, E.
(1996). Interaction of Sp1 with the growth- and cell
cycle-regulated transcription factor E2F. Mol. Cell
Biol. 16,1659
-1667.[Abstract]
Kuo, M. H. and Allis, C. D. (1998). Roles of
histone acetyltransferases and deacetylases in gene regulation.
BioEssays 20,615
-626.[CrossRef][Medline]
Lee, S. K. and Pfaff, S. L. (2001).
Transcriptional networks regulating neuronal identity in the developing spinal
cord. Nat. Neurosci Suppl.
4,1183
-1191.[CrossRef]
Lee, S. K. and Pfaff, S. L. (2003).
Synchronization of neurogenesis and motor neuron specification by direct
coupling of bHLH and homeodomain transcription factors.
Neuron 38,731
-745.[CrossRef][Medline]
Li, X., Zhao, X., Fang, Y., Jiang, X., Duong, T., Fan, C.,
Huang, C. C. and Kain, S. R. (1998). Generation of
destabilized green fluorescent protein as a transcription reporter.
J. Biol. Chem. 273,34970
-34975.
Liu, I. S., Chen, J. D., Ploder, L., Vidgen, D., van der Kooy,
D., Kalnins, V. I. and McInnes, R. R. (1994).
Developmental expression of a novel murine homeobox gene (Chx10): evidence for
roles in determination of the neuroretina and inner nuclear layer.
Neuron 13,377
-393.[CrossRef][Medline]
Lu, Q. R., Sun, T., Zhu, Z., Ma, N., Garcia, M., Stiles, C. D.
and Rowitch, D. H. (2002). Common developmental
requirement for Olig function indicates a motor neuron/oligodendrocyte
connection. Cell 109,75
-86.[CrossRef][Medline]
Marquardt, T. and Pfaff, S. L. (2001). Cracking
the transcriptional code for cell specification in the neural tube.
Cell 106,651
-654.[CrossRef][Medline]
Mizuguchi, R., Sugimori, M., Takebayashi, H., Kosako, H., Nagao,
M., Yoshida, S., Nabeshima, Y., Shimamura, K. and Nakafuku, M.
(2001). Combinatorial roles of olig2 and neurogenin2 in the
coordinated induction of pan-neuronal and subtype-specific properties of
motoneurons. Neuron 31,757
-771.[CrossRef][Medline]
Muhr, J., Andersson, E., Persson, M. and Jessell, T. M.
(2001). Groucho-mediated transcriptional repression establishes
progenitor cell pattern and neuronal fate in the ventral neural tube.
Cell 104,861
-873.[CrossRef][Medline]
Nakamura, H., Watanabe, Y. and Funahashi, J.
(2000). Misexpression of genes in brain vesicles by in ovo
electroporation. Dev. Growth Differ.
42,199
-201.[CrossRef][Medline]
Nakashima, K., Takizawa, T., Ochiai, W., Yanagisawa, M.,
Hisatsune, T., Nakafuku, M., Miyazono, K., Kishimoto, T., Kageyama, R.
and Taga, T. (2001). BMP2-mediated alteration in the
developmental pathway of fetal mouse brain cells from neurogenesis to
astrocytogenesis. Proc. Natl. Acad. Sci. USA
98,5868
-5873.
Novitch, B. G., Chen, A. I. and Jessell, T. M.
(2001). Coordinate regulation of motor neuron subtype identity
and pan-neuronal properties by the bHLH repressor Olig2.
Neuron 31,773
-789.[CrossRef][Medline]
O'Leary, D. D. and Nakagawa, Y. (2002).
Patterning centers, regulatory genes and extrinsic mechanisms controlling
arealization of the neocortex. Curr. Opin. Neurobiol.
12, 14-25.[CrossRef][Medline]
Pfaff, S. L., Mendelsohn, M., Stewart, C. L., Edlund, T. and
Jessell, T. M. (1996). Requirement for LIM homeobox gene Isl1
in motor neuron generation reveals a motor neuron-dependent step in
interneuron differentiation. Cell
84,309
-320.[CrossRef][Medline]
Ross, A. J., Ruiz-Perez, V., Wang, Y., Hagan, D. M., Scherer,
S., Lynch, S. A., Lindsay, S., Custard, E., Belloni, E., Wilson, D. I.
et al. (1998). A homeobox gene, HLXB9, is the major locus for
dominantly inherited sacral agenesis. Nat. Genet.
20,358
-361.[CrossRef][Medline]
Roztocil, T., Matter-Sadzinski, L., Alliod, C., Ballivet, M. and
Matter, J. M. (1997). NeuroM, a neural
helix-loop-helix transcription factor, defines a new transition stage in
neurogenesis. Development
124,3263
-3272.[Abstract]
Rubenstein, J. L. and Rakic, P. (1999). Genetic
control of cortical development. Cereb. Cortex
9, 521-523.
Saffer, J. D., Jackson, S. P. and Annarella, M. B.
(1991). Developmental expression of Sp1 in the mouse.
Mol. Cell Biol. 11,2189
-2199.
Saha, M. S., Miles, R. R. and Grainger, R. M.
(1997). Dorsal-ventral patterning during neural induction in
Xenopus: assessment of spinal cord regionalization with xHB9, a marker for the
motor neuron region. Dev. Biol.
187,209
-223.[CrossRef][Medline]
Scardigli, R., Schuurmans, C., Gradwohl, G. and Guillemot,
F. (2001). Crossregulation between Neurogenin2 and pathways
specifying neuronal identity in the spinal cord.
Neuron 31,203
-217.[CrossRef][Medline]
Sharma, K. and Peng, C. Y. (2001). Spinal motor
circuits: merging development and function. Neuron
29,321
-324.[CrossRef][Medline]
Sharma, K., Sheng, H. Z., Lettieri, K., Li, H., Karavanov, A.,
Potter, S., Westphal, H. and Pfaff, S. L. (1998). LIM
homeodomain factors Lhx3 and Lhx4 assign subtype identities for motor neurons.
Cell 95,817
-828.[CrossRef][Medline]
Shirasaki, R. and Pfaff, S. L. (2002).
Transcriptional codes and the control of neuronal identity. Annu.
Rev. Neurosci. 25,251
-281.[CrossRef][Medline]
Sommer, L., Ma, Q. and Anderson, D. J. (1996).
neurogenins, a novel family of atonal-related bHLH transcription factors, are
putative mammalian neuronal determination genes that reveal progenitor cell
heterogeneity in the developing CNS and PNS. Mol. Cell.
Neurosci. 8,221
-241.[CrossRef][Medline]
Tanabe, Y., William, C. and Jessell, T. M.
(1998). Specification of motor neuron identity by the MNR2
homeodomain protein. Cell
95, 67-80.[CrossRef][Medline]
Thaler, J., Harrison, K., Sharma, K., Lettieri, K., Kehrl, J.
and Pfaff, S. L. (1999). Active suppression of
interneuron programs within developing motor neurons revealed by analysis of
homeodomain factor HB9. Neuron
23,675
-687.[CrossRef][Medline]
Thaler, J. P., Lee, S. K., Jurata, L. W., Gill, G. N. and Pfaff,
S. L. (2002). LIM factor Lhx3 contributes to the
specification of motor neuron and interneuron identity through
cell-type-specific protein-protein interactions. Cell
110,237
-249.[CrossRef][Medline]
Timmer, J., Johnson, J. and Niswander, L.
(2001). The use of in ovo electroporation for the rapid analysis
of neural-specific murine enhancers. Genesis
29,123
-132.[CrossRef][Medline]
Turner, D. L. and Weintraub, H. (1994).
Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal
cells to a neural fate. Genes Dev.
8,1434
-1447.
Vallstedt, A., Muhr, J., Pattyn, A., Pierani, A., Mendelsohn,
M., Sander, M., Jessell, T. M. and Ericson, J. (2001).
Different levels of repressor activity assign redundant and specific roles to
Nkx6 genes in motor neuron and interneuron specification.
Neuron 31,743
-755.[CrossRef][Medline]
Vult von Steyern, F., Martinov, V., Rabben, I., Nja, A., de
Lapeyriere, O. and Lomo, T. (1999). The homeodomain
transcription factors Islet 1 and HB9 are expressed in adult alpha and gamma
motoneurons identified by selective retrograde tracing. Eur. J.
Neurosci. 11,2093
-2102.[CrossRef][Medline]
Zhang, H. and Levine, M. (1999). Groucho and
dCtBP mediate separate pathways of transcriptional repression in the
Drosophila embryo. Proc. Natl. Acad. Sci USA
96,535
-540.
Zhao, J., Nornes, H. O. and Neuman, T. (1995).
Expression of Rb, E2F1, cdc2, and D, and B cyclins in developing spinal cord.
Neurosci. Lett. 190,49
-52.[CrossRef][Medline]
Zhou, Q. and Anderson, D. J. (2002). The bHLH
transcription factors OLIG2 and OLIG1 couple neuronal and glial subtype
specification. Cell 109,61
-73.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M.-R. Song, Y. Sun, A. Bryson, G. N. Gill, S. M. Evans, and S. L. Pfaff Islet-to-LMO stoichiometries control the function of transcription complexes that specify motor neuron and V2a interneuron identity Development, September 1, 2009; 136(17): 2923 - 2932. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-J. Kao, E. Palmesino, and A. Kania Src Family Kinases Are Required for Limb Trajectory Selection by Spinal Motor Axons J. Neurosci., April 29, 2009; 29(17): 5690 - 5700. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-J. Ji, G. Periz, and S. Sockanathan Nolz1 is induced by retinoid signals and controls motoneuron subtype identity through distinct repressor activities Development, January 15, 2009; 136(2): 231 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Gallarda, D. Bonanomi, D. Muller, A. Brown, W. A. Alaynick, S. E. Andrews, G. Lemke, S. L. Pfaff, and T. Marquardt Segregation of Axial Motor and Sensory Pathways via Heterotypic Trans-Axonal Signaling Science, April 11, 2008; 320(5873): 233 - 236. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Briscoe and B. G Novitch Regulatory pathways linking progenitor patterning, cell fates and neurogenesis in the ventral neural tube Phil Trans R Soc B, January 12, 2008; 363(1489): 57 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Guillemot Spatial and temporal specification of neural fates by transcription factor codes Development, November 1, 2007; 134(21): 3771 - 3780. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Etchberger, A. Lorch, M. C. Sleumer, R. Zapf, S. J. Jones, M. A. Marra, R. A. Holt, D. G. Moerman, and O. Hobert The molecular signature and cis-regulatory architecture of a C. elegans gustatory neuron Genes & Dev., July 1, 2007; 21(13): 1653 - 1674. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Von Stetina, R. M. Fox, K. L. Watkins, T. A. Starich, J. E. Shaw, and D. M. Miller III UNC-4 represses CEH-12/HB9 to specify synaptic inputs to VA motor neurons in C. elegans Genes & Dev., February 1, 2007; 21(3): 332 - 346. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Mizuhara, T. Nakatani, Y. Minaki, Y. Sakamoto, and Y. Ono Corl1, a Novel Neuronal Lineage-specific Transcriptional Corepressor for the Homeodomain Transcription Factor Lbx1 J. Biol. Chem., February 4, 2005; 280(5): 3645 - 3655. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-K. Lee, B. Lee, E. C. Ruiz, and S. L. Pfaff Olig2 and Ngn2 function in opposition to modulate gene expression in motor neuron progenitor cells Genes & Dev., January 15, 2005; 19(2): 282 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schwander, R. Shirasaki, S. L. Pfaff, and U. Muller {beta}1 Integrins in Muscle, But Not in Motor Neurons, Are Required for Skeletal Muscle Innervation J. Neurosci., September 15, 2004; 24(37): 8181 - 8191. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||