|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 28, 2004
doi: 10.1242/10.1242/dev.01206
1 Department of Cell and Developmental Biology, John Innes Centre, Norwich NR4
7UH, UK
2 Sainsbury Laboratory, John Innes Centre, Norwich NR4 7UH, UK
* Author for correspondence (e-mail: nicholas.harberd{at}bbsrc.ac.uk)
Accepted 1 April 2004
| SUMMARY |
|---|
|
|
|---|
Key words: miR159, GAMYB, Flowering, Photoperiod, Anther
| Introduction |
|---|
|
|
|---|
First identified in barley aleurone cells
(Gubler et al., 1995
), GAMYB
is a GA-specific transcriptional regulator. GAMYB binds specifically to a
GA-response element (GARE) in the 5' regulatory region of GA-activated
genes. Binding of GAMYB to the GARE activates the transcription of genes
encoding the hydrolytic enzymes that release stored nutrients from the
endosperm during seed germination (Cercos
et al., 1999
; Gubler et al.,
1999
). Expression of GAMYB (the gene encoding GAMYB) is
itself up-regulated by GA (Gubler et al.,
1995
). In addition, constitutive expression of GAMYB mimics the
activating effects of GA application on the transcription of genes encoding
hydrolytic enzymes, suggesting that GAMYB plays an important role in the GA
signalling pathway in aleurone cells
(Cercos et al., 1999
). Recent
experiments have shown that transgenic overexpression of GAMYB perturbs the
development of anthers, indicating that GAMYB can function in cells other than
those of the aleurone layer (Murray et
al., 2003
). Furthermore, loss-of-function mutations in the rice
GAMYB gene have recently been shown to abolish GA-mediated induction
of the aleurone hydrolase
-amylase, to retard the growth and
development of stamens and anthers, and to impair microsporogensis
(Kaneko et al., 2004
). These
latter observations provide genetic proof of the involvement of GAMYB in both
aleurone physiology and floral organ development.
Genes encoding proteins closely related in sequence to the barley and rice
GAMYB have been identified in Arabidopsis [AtMYB33, AtMYB65
and AtMYB101 (Gocal et al.,
2001
)]. Amongst these AtGAMYBs, AtMYB33 is the most similar to the
barley GAMYB (Gocal et al.,
2001
). The AtGAMYBs have been suggested to be involved in the
GA-mediated promotion of flowering in SDs, by activation of the floral
meristem identity gene LEAFY
(Blázquez et al., 1998
;
Blázquez and Weigel,
2000
; Gocal et al.,
2001
). Activation of LEAFY is known to be important in
this process because transgenic over-expression of LEAFY restores a
wild-type flowering time to ga1-3 plants grown in SDs
(Blázquez et al., 1998
).
AtMYB33 binds in vitro to a GARE in the LEAFY promoter (a GARE that
has been shown to be essential for GA induction of LEAFY) and fails
to bind to non-functional mutant derivatives of this element. This suggests
that GAMYB plays a key role in LEAFY activation
(Blázquez and Weigel,
2000
; Gocal et al.,
2001
). Another floral integrator gene, SOC1, has recently
been shown to play an important role in the GA promotion of flowering in SD
photoperiods (Moon et al.,
2003
), and it has been suggested that GAMYB and SOC1 both act
upstream of LEAFY (Lee et al.,
2000
; Mouradov et al.,
2002
; Yu et al.,
2002
).
To further our understanding of the role of the AtGAMYBs in the regulation
of floral development we took advantage of the recent identification of a
microRNA (miR159) exhibiting substantial sequence homology with mRNAs encoding
AtMYB33, AtMYB65 and AtMYB101 (Gocal et
al., 2001
; Reinhart et al.,
2002
). MicroRNAs are single-stranded RNA molecules of 20-22
nucleotides that can cause complementarity-dependent cleavage (e.g.
Llave et al., 2002a
) or
translational inhibition (Chen,
2004
; Aukerman and Sakai,
2003
) of target mRNA molecules. More than one hundred distinct
small RNAs have been identified in plants, although only a minority of these
are microRNAs (Llave et al.,
2002b
; Reinhart et al.,
2002
). Most of the predicted targets of these microRNAs are
members of transcription factor gene families involved in developmental
patterning or cell differentiation
(Rhoades et al., 2002
;
Kidner and Martienssen, 2003
).
In this paper we describe experiments showing that miR159 directs the cleavage
of AtMYB33-encoding transcripts (see also
Palatnik et al., 2003
). We
also show that miR159 sequence is evolutionarily conserved, and that miR159
levels are GA-regulated via a mechanism that is evolutionarily conserved
between Arabidopsis and barley and that is dependent on the
GA-promoted opposition of the function of DELLA protein GA-response
repressors. To further investigate the role of miR159 in vivo, we generated
transgenic Arabidopsis plants over-expressing miR159 and examined the
floral developmental phenotypes of these plants. We found that elevated
expression of miR159 resulted in a delay in flowering in SD photoperiods that
was associated with a reduction in the levels of LEAFY transcripts.
In addition, previous experiments in barley and rice have identified a role
for GAMYB in anther development (Murray et
al., 2003
; Kaneko et al.,
2004
). We found that elevated levels of miR159 perturbed anther
development and caused a consequent reduction in floral fertility. These
observations suggest that miR159 modulates GA-mediated developmental
regulation via its effects on GAMYB activity.
| Materials and methods |
|---|
|
|
|---|
Plasmids and construction
The 35S:MYC-MYB33 construct contained a copy of the
AtMYB33 (accession number AF411969) coding sequence. The cDNA was
amplified from total RNA by RT-PCR using gene-specific primers
(AtMYB33: GCATGTTGAGGCACTTGAGTGGAGTC and TCTGGAATCATAACAGGTAATGTCGG)
and cloned into the p35S-2 vector (P. Mullineaux, John Innes Centre). Three
myc epitope tags were inserted in phase, upstream of the AtMYB33
cDNA. After digestion, an EcoRV fragment containing the construction
35S:MYC-MYB33 was inserted into the plant transformation vector
pGreen0029 (P. Mullineaux, John Innes Centre). A mutated version of the
AtMYB33 transgene (35S:MYC-mMYB33) was generated by PCR
using the Quick Change XL site-directed mutagenesis kit (Stratagene). The
mutated mMYB33 primers used were as follows:
GGCAGTGAAGCTGGAATTGCCAAGCTTTCAATATTCAGAAACAAC and
GTTGTTTCTGAATATTGAAAGCTTGGCAATTCCAGCTTCACTGCC. The nucleotide sequence of the
mMYB33 cDNA was as described by Palatnik et al.
(Palatnik et al., 2003
). The
35S:miR159a construct contained a copy of the precursor of miR159
isoform a (Fig. 1A). A fragment
of 228 bp (containing the precursor of 182 bp) was amplified from genomic DNA
by PCR using specific primers (miR159a: GAGAAGGTGAAAGAAGATGTAGAGCTCCC and
CGATAGATCTTGATCTGACGATGGAAG). These primers were designed to anneal
specifically to genomic DNA on either side of the predicted miR159a hairpin
precursor. The amplified fragment was then cloned into the p35S-2 vector, and
an EcoRV fragment containing the construct 35S:miR159a was
then inserted into the pGreen0029 vector. The 35S:GFP construct was
made similarly using GFP-specific primers: CGGCACGACTTCTTCAAGAGCGC and
GTATTCCAACTTGTGGCCGAGG. The resulting constructs were introduced into
Agrobacterium tumefaciens strain GV3101.
|
Transformation of Arabidopsis thaliana
Transformation was performed by floral dipping
(Clough and Bent, 1998
).
A. tumefaciens containing the appropriate constructs were resuspended
in infiltration buffer (0.5x Murashige and Skoog salts, 5% sucrose, 0.5
g/l Mes, 0.05% Silwet L77) at OD600=1. Transformants were selected
by resistance to 50 mg/l of kanamycin sulphate. Plants in
Fig. 5A-C, Figs
6 and
7 were homozygous for the
35S:miR159a transgene (T2 generation); plants in
Fig. 5D,E were from segregating
populations (self-pollination progeny of 35S:miR159a primary
transformants).
|
|
|
32P]dCTP. 20 µg low molecular mass RNA was separated in
a 15% denaturing polyacrylamide gel and subjected to blot-hybridization
analysis. Small RNA (miR159a: TAGAGCTCCCTTCAATCCAAAGA; miR167:
TAGATCATGCTGGCAGCTTCA) probes were labelled with T4 kinase (Gibco-BRL) in the
presence of [
32P]ATP. Since miR159 hybridises with miR-JAW
[a microRNA that is more divergent from miR159 than each of the miR159
isoforms are from each other; Fig.
1A (Palatnik et al.,
2003
Protein isolation and analysis
Agro-infiltrated tobacco leaves were harvested and frozen in liquid
nitrogen. Total protein was extracted and quantified as described by Achard et
al. (Achard et al., 2003
). 20
µg of proteins were separated by 10% SDS-PAGE and transferred to a
nitrocellulose membrane. Immunodetection of the MYC-MYB33 fusion protein was
performed using a 2000-fold dilution of anti-cMYC polyclonal antibodies from
goat (Santa Cruz Biotechnology, CA) and a 2000-fold dilution of
peroxidase-conjugated anti-goat IgG (Santa Cruz Biotechnology, CA).
Immunodetection of GFP was performed using a 2500-fold dilution of anti-GFP
monoclonal antibodies from mouse (Chemicon International, Temecula, CA, USA)
and a 5000-fold dilution of peroxidase-conjugated goat anti-mouse IgG
(SouthernBiotech). Signals were detected by chemiluminescence using the ECL
Western Blotting Analysis System (Amersham Biosciences).
| Results |
|---|
|
|
|---|
MicroRNAs can regulate gene expression by directing cleavage or by
inhibition of translation of target transcripts
(Llave et al., 2002a
;
Chen, 2004
;
Aukerman and Sakai, 2003
). We
tested if miR159 directs the cleavage of GAMYB-like mRNAs (see also
Palatnik et al., 2003
) using
an Agrobacterium-mediated delivery system to co-express miR159 and
MYB33 target mRNA in N. benthamiana leaf tissue
(Llave et al., 2002a
)
(Fig. 2). Four constructs
(35S:miR159a, 35S:MYC-MYB33, 35S:MYC-mMYB33 and 35S:GFP)
were inoculated and expressed (Fig.
2A). Whilst basal levels of endogenous miR159 were detected in
tissues lacking the 35S:miR159a construct, increased levels of miR159
were detected in tobacco leaves inoculated with this construct, indicating
that over-expression and processing of transgenically derived miR159a was
successfully achieved (Fig.
2B). Expression of the 35S:MYC-MYB33 construct resulted
in detectable levels of MYC-MYB33 transcripts (MYC-MYB33a;
Fig. 2B). Co-expression of
35S:MYC-MYB33 with 35S:miR159a resulted in loss of the full
length MYC-MYB33a transcript form, and the appearance of detectable
levels of a smaller transcript (3'-MYB33b) that
hybridized to the MYB33 probe (a 3' probe fragment, see
Materials and methods; Fig.
2B). We attribute this smaller fragment to internal cleavage of
the MYC-MYB33 mRNA directed by miR159 (as previously suggested by
5' RACE-PCR experiments; Palatnik et
al., 2003
). Consistent with this attribution, co-expression of
35S:MYC-mMYB33 (encoding a MYC-mMYB33 transcript that
carries an altered miR159 binding site; see Materials and methods) with
35S:miR159a resulted in detectable transcripts of the
MYC-MYB33a size, but not of the 3'-MYB33b
size.
|
83 kDa was recognised by MYC antibodies in
a sample from leaves expressing 35S:MYC-MYB33 but not in a sample
co-expressing 35S:miR159a and 35S:MYC-MYB33
(Fig. 2C). This peptide was of
the size expected for the MYC-MYB33 fusion protein encoded by
35S:MYC-MYB33. Taken together, these RNA gel-blot and immunoblot
analyses indicate that miR159 can direct the cleavage of transcripts encoding
GAMYB, thus down-regulating GAMYB levels.
MiR159 is an evolutionarily conserved sequence
We next investigated the distribution of miR159 in Arabidopsis,
tobacco (Nicotiana benthamiana) and barley. In Arabidopsis,
miR159 accumulated predominantly in young seedlings and flowers, was less
abundant in rosette leaves, cauline leaves or siliques, and was undetectable
in roots (Fig. 3).
Interestingly, miR159 was also clearly detectable in tobacco and barley. As in
Arabidopsis, miR159 accumulated predominantly in the inflorescence
and floral tissues in these species (Fig.
3). These observations indicate that the sequence and
developmental regulation of miR159 is highly conserved, despite the
considerable evolutionary distance that separates Arabidopsis,
tobacco and barley from their last common ancestor.
|
|
We next compared the regulation of miR159 level in Arabidopsis
with its regulation in barley. Barley SLN1 encodes a DELLA protein
(Chandler et al., 2002
;
Fu et al., 2002
), and the
dominant dwarfing sln1-dwarf allele encodes a mutant protein that is
altered in the highly conserved DELLA domain (X. Fu, D. E. Richards and
N.P.H., unpublished) (see also Peng et
al., 1999
; Chandler et al.,
2002
; Itoh et al.,
2002
). The effect of this mutation is analogous to that of the
Arabidopsis gai allele. We found that miR159 levels were reduced in
sln1-dwarf compared to SLN barley
(Fig. 4B). Thus, GA-DELLA
system regulation of miR159 levels is evolutionarily conserved across the
divided lineage that separates Arabidopsis and barley.
Exogenous GA enhances MYB33 transcript levels
We also compared the levels of MYB33 transcripts in the
Arabidopsis GA-signalling mutant lines. MYB33 transcript
levels were not substantially different in wild type, ga1-3, gai or
ga1-3 gai-t6 rga-24 (grown in the absence of exogenous GA;
Fig. 4A). However,
MYB33 transcript levels were consistently higher in all of these
genotypes when grown in the presence of exogenous GA
(Fig. 4A). Since MYB33
is the target of miR159, it might have been expected that there would be an
inverse correlation between miRNA and MYB33 transcript levels. Yet
whilst miR159 levels were reduced in ga1-3 (and restored by GA or
lack of GAI and RGA) there were no detectable differences in MYB33
transcript levels in these various mutant lines. This apparent paradox is
considered further in the Discussion.
MiR159 level modulates photoperiodic control of the floral transition
Recent studies suggest that GA might regulate flowering via GAMYB-dependent
activation of the floral meristem identity gene LEAFY
(Blázquez and Weigel,
2000
; Gocal et al.,
2001
). In Arabidopsis, the GA pathway has a stronger
effect on flowering in SD than it does in LD photoperiods
(Wilson et al., 1992
;
Mouradov et al., 2002
;
Moon et al., 2003
). We
therefore investigated the effect of elevated expression of miR159 on
flowering time in SDs. Four-week-old SD-grown transgenic plants
over-expressing miR159a (homozygous for 35S:miR159a) had leaves that
were smaller and rounder than wild-type control plants
(Fig. 5A). In addition,
SD-grown 35S:miR159a plants exhibited a delay in flowering time
(Fig. 5B). Wild-type plants
bolted then flowered at day 39 (±1.12) whereas transgenic plants
flowered at day 53 (±4.66) (Fig.
5C). A delay in flowering time (of varying severity) was observed
in plants of ten additional independent transgenic lines (each homozygous for
35S:miR159a), and was heritable in the progeny of these plants (data
not shown). 35S:miR159a homozygotes also produced more rosette leaves
than did wild-type controls when grown in SDs (37±2.63 against
23±2.38 for wild type; Fig.
5C). In LD photoperiods the effect of 35S:miR159a was
much less than in SDs, with LD-grown plants over-expressing miR159a flowering
at approximately the same time as wild-type plants (actually 1 day later; data
not shown).
In subsequent experiments, segregation of the late-flowering phenotype was followed in two independent transgenic families that were segregating for 35S:miR159a. Only those plants overexpressing miR159a exhibited late flowering in SDs, whilst segregants expressing normal levels of miR159 flowered at the same time as non-transgenic wild-type controls (Fig. 5D). We next determined the levels of MYB33 transcripts, the targets of miR159, in these plants. MYB33 transcripts were detected at substantially reduced levels in plants over-expressing miR159a (and exhibiting a late flowering phenotype), but were not reduced in segregating plants that expressed normal levels of miR159 (Fig. 5E). In addition, the pattern of MYB33 transcript accumulation correlated with that of LEAFY transcripts. LEAFY transcript levels were reduced in SD-grown 35S:miR159a plants, but not in segregants expressing normal levels of miR159 (Fig. 5E). Taken together, these observations suggest that miR159 directs the cleavage of MYB33 transcripts, that the resultant reduction in MYB33 level reduces LEAFY activity, and that the reduction in LEAFY activity delays SD flowering.
Recent experiments have shown that SUPPRESOR OF OVEREXPRESSION OF
CO1 (SOC1) is also an important component of the GA-dependent
flowering pathway and that integration via SOC1 is necessary for
flowering in SDs (Moon et al.,
2003
). We therefore investigated the relationships between the
GA-DELLA system, miR159, MYB33 and SOC1. To begin with, we
tested whether the DELLA proteins GAI and RGA regulate SOC1
expression. SOC1 transcripts were less abundant in GA-deficient
ga1-3 plants than in wild-type plants. In contrast, similar levels of
SOC1 transcripts were observed in wild-type and ga1-3 plants
treated with exogenous GA (Fig.
4A) (see also Moon et al.,
2003
). Two further observations indicated that GA regulates
SOC1 transcript levels via opposition of DELLA repression. First,
SOC1 transcript levels were reduced in gai mutant plants
(compared to wild type) and not restored to wild-type levels by exogenous GA
(Fig. 4A). Thus the
constitutively repressing mutant gai protein confers a reduction in
SOC1 transcript levels. Secondly, SOC1 transcript levels in
ga1-3 plants lacking GAI and RGA (ga1-3 gai-t6 rga-24) were
little different to those in wild-type plants
(Fig. 4A). Thus lack of GAI and
RGA suppressed the effect of ga1-3 on SOC1 transcript
levels, indicating that GA regulates SOC1 levels (and thus flowering
time in SD) by opposition of GAI and RGA function.
How does GA-pathway regulation of SD flowering via SOC1 relate to GA-pathway regulation of flowering via miR159/MYB33? To answer this question we determined SOC1 transcript levels in plants from a family segregating for 35S:miR159a. Late flowering plants contained SOC1 transcript levels that were similar to those of non-transgenic wild-type plants (Fig. 5E). Thus an increase in miR159 level has no downstream effect on SOC1 transcript levels, demonstrating that the SOC1- and miR159/MYB33-dependent signalling pathways through which GA regulates flowering in SD act independently of one another.
Elevated miR159 levels affect anther development
GA and GAMYB are known to be involved in the regulation of anther
development (Murray et al.,
2003
; Cheng et al.,
2004
; Kaneko et al.,
2004
). We next investigated the possible role of miR159 in anther
development. LD-grown 35S:miR159a homozygotes had smaller cauline
leaves than wild-type controls (Fig.
6A). In addition, 35S:miR159a plants had short, sterile
siliques (Fig. 6C,D).
35S:miR159a siliques were
40% of the length of wild-type
siliques and contained no seeds (Fig.
6B; eventually a few fertile siliques were obtained in some
plants). In other respects the development of 35S:miR159a homozygotes
was indistinguishable from that of wild type.
In order to determine the cause of the infertility, the floral development of 35S:miR159a homozygotes was compared with that of wild-type controls. Except for the anthers, the floral organs of 35S:miR159a plants appeared relatively normal. However, the increase in miR159 levels (and decrease in MYB33 transcript levels; Fig. 6E) characteristic of 35S:miR159a plants was associated with a progressive increase in the size of anthers, and with a darkening of anther colour (Fig. 7A-D). In addition, the 35S:miR159a anthers failed to release pollen (Fig. 7D). Since seed-bearing siliques were recovered following cross-fertilization of 35S:miR159a with wild-type pollen (data not shown) it was clear that the infertility of the 35S:miR159a plants was due to male sterility resulting from failure to release pollen. The anther phenotype characteristic of the 35S:miR159a plants was visible from floral developmental stage 10 (Fig. 7E) and was clear until stage 12 (Fig. 7F). Subsequently, the anthers became increasingly dark in colour (Fig. 7B,D). The final stamen lengths in wild-type and 35S:miR159a flowers were indistinguishable (data not shown).
| Discussion |
|---|
|
|
|---|
On the basis of the sequence complementarity between miR159 and transcripts
encoding GAMYB proteins, it seemed possible that miR159 might direct the
cleavage of these transcripts. We tested this possibility, and found that
expression of miR159 in N. benthamiana causes a reduction in the
level of intact MYB33 transcripts and of detectable MYB33 protein. In
addition, expression of miR159 failed to reduce the level of mutant
MYB33 transcripts (mMYB33) carrying an alteration in the
miR159 complementary region. These results are consistent with the previous
observation that MYB33 and MYB65 transcripts are cleaved in
Arabidopsis plants in the centre of the miR159 binding site
(Palatnik et al., 2003
).
Furthermore, whereas overexpression of MYB33 has no obvious effect on
development in Arabidopsis, overexpression of miR159-resistant
mMYB33 transcripts confers dramatic developmental perturbations [e.g.
curly leaves (Palatnik et al.,
2003
)]. These results indicate that miR159-directed cleavage of
MYB33 (and other GAMYB-encoding transcripts)
(Palatnik et al., 2003
) is
developmentally relevant. However, it is also possible that miR159 influences
development via inhibition of translation of GAMYB-encoding transcripts.
We next investigated the levels of miR159 in Arabidopsis and
barley GA-signalling mutant lines. We found that the accumulation of miR159
was positively regulated by GA, and negatively regulated by DELLA proteins
(GAI and RGA in Arabidopsis; SLN in barley;
Fig. 4). Therefore GA regulates
miR159 accumulation via an evolutionarily conserved mechanism that involves
opposition of DELLA function. Recent advances have shown that the DELLA
proteins, although originally identified as components of the GA signalling
pathway, also mediate auxin and ethylene responses
(Achard et al., 2003
;
Fu and Harberd, 2003
). Thus
DELLA proteins may serve as a means of regulating miR159 levels in response to
multiple hormonal signalling inputs. Although it has recently been shown that
specific miRNA levels are hormonally regulated in Drosophila
(Bashirullah et al., 2003
), our
results are, to our knowledge, the first demonstration of hormonal regulation
of microRNA levels in plants.
Since GAMYB has been previously implicated in the regulation of flowering
time in SDs in Arabidopsis
(Blázquez et al., 1998
;
Blázquez and Weigel,
2000
) and of anther development in barley and in rice
(Murray et al., 2003
;
Kaneko et al., 2004
), we
determined if transgenic alteration in miR159 levels would perturb these
developmental aspects. The timing of the floral transition is of considerable
adaptive significance, and hence is subject to multiple interdependent genetic
and environmental controls (Mouradov et
al., 2002
). Genetic and molecular analyses have identified three
distinct genetic floral promotive pathways: the photoperiod pathway, the
autonomous pathway and the GA pathway; the latter being of particular
prominence in SD photoperiods (Simpson and Dean, 2003). Previous data
suggested that the GA pathway promotes flowering in SD via GAMYB-dependent
activation of the floral meristem identity gene LEAFY
(Blázquez et al., 1998
;
Blázquez and Weigel,
2000
). Consistent with these ideas, we found that transgenic
overexpression of miR159a resulted in a reduction in the levels of
MYB33 and of LEAFY transcripts, and a specific delay in
flowering in SDs. Despite causing severe developmental perturbations at the
vegetative rosette stage, expression of miR159-resistant mMYB33
transcripts had no dramatic effect on flowering time in SDs (J. Palatnik and
D. Weigel, personal communication). Similarly, treatment of SD-grown wild-type
plants with GA promotes flowering time by only a few days (P.A. and N.P.H.;
data not shown). Thus, in SD conditions, flowering time is at most slightly
advanced by increases in MYB33 activity (due to mMYB33 transcripts or
GA treatment) but is markedly delayed by decreases in MYB33 activity (due to
overexpression of miR159a).
The GA-deficient ga1-3 mutant also either fails to flower or
flowers very late in SD photoperiods
(Wilson et al., 1992
). Yet the
ga1-3 mutant contains reduced, rather than increased, levels of
miR159 (Fig. 4A). Thus
increased levels of mi159 cannot contribute to the late flowering of
ga1-3 in SD photoperiods. Our experiments further investigated the
relationship between GA regulation of SD flowering and miR159 by looking at
levels of transcripts encoding the floral integrator SOC1. GA regulates SD
flowering time both via the GAMYB-LEAFY pathway, and via regulation
of SOC1 expression (Fig.
8) (Moon et al.,
2003
). We therefore investigated the effect of GA-DELLA
signalling, and of overexpression of miR159a, on SOC1 transcript
levels. We showed that GA regulates SOC1 transcript levels by
opposing the negative effects of GAI and RGA
(Fig. 4A). We also showed that
transgenic overexpression of miR159a had no detectable effect on SOC1
transcript levels (Fig. 5E).
Thus GA regulates SOC1 via a DELLA-opposition-dependent pathway that
does not involve GAMYB (or miR159). It seems probable that SD-grown
ga1-3 plants flower late (although miR159 levels are reduced) because
the reduction in SOC1 transcripts, also seen in ga1-3,
overcomes any promotion of flowering resulting from miR159 reductions.
|
Overall, the results obtained from our transgenic overexpression
experiments support the view that miR159 acts in GA signalling to regulate
GAMYB activity, presumably through its ability to direct the cleavage of mRNA
molecules encoding GAMYB proteins. However, our experiments also reveal a
complexity in the relationship between GA signalling, miR159 and GAMYB levels.
The levels of MYB33 transcripts do not obviously differ between
wild-type, GA-deficient (ga1-3) or GA-deficient plants lacking GAI
and RGA (ga1-3 ga-t6 rga-24), despite the fact that miR159 levels
vary between these different genotypes
(Fig. 4A). At first sight this
observation seems puzzling, since the a priori expectation would be
that an increased level of miR159 should result in a reduction in
MYB33 transcript levels. However, the levels of another plant
microRNA, miR39, actually display a positive correlation (rather than the
expected negative correlation) with the levels of its cleavage target
(Llave et al., 2002a
). These
unexpected relationships between microRNA and target transcript levels may
result from a failure of gel-blot analyses to reveal underlying
heterogeneities in the relative cell-specific distributions of microRNAs and
their targets, or may reveal a homeostatic component of microRNA function.
Recent results indicate that miRNAs can work as components in negative
feedback regulatory loops (Xie et al.,
2003
). It is therefore possible that miR159 acts within such a
loop, as a general homeostatic regulator of GAMYB function. An illustrative
example (Fig. 8) of how such
feedback might operate could involve down-regulation of MYB33 activity by
miR159 (as shown in this paper), and compensatory up-regulation of miR159 by
MYB33. Indeed, potential GARE-like sites have been identified in the putative
promoter of the miR159 precursor-encoding gene, suggesting the possibility of
feedback regulation of miR159 by MYB33 (P.A. and N.P.H., data not shown).
Of course the above hypothetical example is but one possible route for regulation of levels of MYB33 activity, and concerns miR159 and MYB33 in isolation. The miR159/MYB33 system is also subject to DELLA-dependent regulation. In this case, the fact that MYB33 transcript levels are indistinguishable in ga1-3 compared with ga1-3 gai-t6 rga-24 could be explained if absence of GAI and RGA increases both MYB33 transcription and miR159 levels. Larger-scale changes to the system (e.g. transgenic overexpression of miR159a) break homeostatic regulation of MYB33 levels and result in detectable changes in phenotype (delayed flowering in SD, perturbed anther development). We therefore propose that miR159 acts as a homeostatic regulator of GAMYB function in GA-regulated plant development. Despite these complexities, the strong evolutionary conservation of both sequence and phytohormonal regulation of miR159 suggests that this microRNA is of adaptive significance to the growth and development of many plant species.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Achard, P., Vriezen, W. H., Van Der Straeten, D. and Harberd, N.
P. (2003). Ethylene regulates Arabidopsis development via the
modulation of DELLA protein growth repressor function. Plant
Cell 15,2816
-2825.
Aukerman, M. J. and Sakai, H. (2003).
Regulation of flowering time and floral organ identity by a microRNA and its
APETALA2-Like target genes. Plant Cell
15,2730
-2741.
Bashirullah, A., Pasquinelli, A. E., Kiger, A. A., Perrimon, N., Ruvkun, G. and Thummel, C. S. (2003). Coordinate regulation of small temporal RNAs at the onset of Drosophila metamorphosis. Dev. Biol. 259,1 -8.[CrossRef][Medline]
Blázquez, M. A., Green, R., Nilsson, O., Sussman, M. R.
and Weigel, D. (1998). Gibberellins promote flowering of
Arabidopsis by activating the LEAFY promoter.
Plant Cell 10,791
-800.
Blázquez, M. A. and Weigel, D. (2000). Integration of floral inductive signals in Arabidopsis.Nature 404,889 -892.[CrossRef][Medline]
Cercos, M., Gomez-Cadenas, A. and Ho, T. H. D. (1999). Hormonal regulation of a cysteine proteinase gene, EPB-1, in barley aleurone layers: cis- and trans-acting elements involved in the coordinated gene expression regulated by gibberellins and abscisic-acid. Plant J. 19,107 -118.[CrossRef][Medline]
Chandler, P. M., Marion-Poll, A., Ellis, M. and Gubler, F.
(2002). Mutants at the Slender1 locus of barley cv
Himalaya. Molecular and physiological characterization. Plant
Physiol. 129,181
-190.
Chen, X. (2004). A microRNA as a translational
repressor of APETALA2 in Arabidopsis flower development.
Science 303,2022
-2025.
Cheng, H., Qin, L., Lee, S., Fu, X., Richards, D. E., Cao, D.,
Luo, D., Harberd, N. P. and Peng, J. (2004).
Gibberellin regulates Arabidopsis floral development via suppression
of DELLA protein function. Development
131,1055
-1064.
Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16,735 -743.[CrossRef][Medline]
Dill, A. and Sun, T.-p. (2001). Synergistic
derepression of gibberellin signaling by removing RGA and GAI function in
Arabidopsis thaliana. Genetics
159,777
-785.
Emery, J. F., Floyd, S. K., Alvarez, J., Eshed, Y., Hawker, N. P., Izhaki, A., Baum, S. F. and Bowman, J. L. (2003). Radial patterning of Arabidopsis shoots by class III HD-ZIP and KANADI genes. Curr. Biol. 13,1768 -1774.[CrossRef][Medline]
Fu, X., Richards, D. E., Ait-ali, T., Hynes, L. W., Ougham, H.,
Peng, J. and Harberd, N. P. (2002). Gibberellin-mediated
proteasome-dependent degradation of the barley DELLA protein SLN1 repressor.
Plant Cell 14,3191
-3200.
Fu, X. and Harberd, N. P. (2003). Auxin promotes Arabidopsis root growth by modulating gibberellin response. Nature 421,740 -743.[CrossRef][Medline]
Gocal, G. F. W., Sheldon, C. C., Gubler, F., Moritz, T.,
Bagnall, D. J., MacMillan, C. P., Li, S. F., Parish, R. W., Dennis, E.
S., Weigel, D. and King, R. W. (2001). GAMYB-like
genes, flowering, and gibberellin signalling in Arabidopsis. Plant
Physiol. 127,1682
-1693.
Gubler, F., Kalla, R., Roberts, J. K. and Jacobsen, J. V. (1995). Gibberellin-regulated expression of a myb gene in barley aleurone cells: evidence for Myb transactivation of a high-pI alpha-amylase gene promoter. Plant Cell 7,1879 -1891.[Abstract]
Gubler, F., Raventos, D., Keys, M., Watts, R., Mundy, J. and Jacobsen, J. V. (1999). Target genes and regulatory domains of the GAMYB transcriptional activator in cereal aleurone. Plant J. 17,1 -9.[CrossRef][Medline]
Hamilton, A., Voinnet, O., Chappell, L. and Baulcombe, D. (2002). Two classes of short interfering RNA in RNA silencing. EMBO J. 17,4671 -4679.[CrossRef]
Harberd, N. P. (2003). Relieving DELLA
restraint. Science 299,1853
-1854.
Itoh, H., Ueguchi-Tanaka, M., Sato, Y., Ashikari, M. and
Matsuoka, M. (2002). The gibberellin signaling pathway is
regulated by the appearance and disappearance of SLENDER RICE1 in nuclei.
Plant Cell 14,57
-70.
Kaneko, M., Inukai, Y., Ueguchi-Tanaka, M., Itoh, H., Izawa,
T., Kobayashi, Y., Hattori, T., Miyao, A., Hirochika, H., Ashikari, M.
and Matsuoka, M. (2004). Loss-of-function mutations of the
rice GAMYB gene impair
-amylase expression in aleurone and
flower development. Plant Cell
16, 33-44.
Kidner, C. A. and Martienssen, R. A. (2003). Macro effects of microRNAs in plants. Trends Genet. 19, 13-16.[CrossRef][Medline]
King, K. E., Moritz, T. and Harberd, N. P.
(2001). Gibberellins are not required for normal stem growth in
Arabidopsis thaliana in the absence of GAI and RGA.
Genetics 159,767
-776.
Koornneef, M. and van der Veen, J. H. (1980). Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) Heynh. Theor. Appl. Genet. 58,257 -263.[CrossRef]
Koornneef, M., Elgersma, A., Hanhart, C. J., van Loenen-Martinet, E. P., van Rijn, L. and Zeevaart, J. A. D. (1985). A gibberellin insensitive mutant of Arabidopsis thaliana. Physiol. Plant 65,33 -39.
Lee, H., Suh, S. S., Park, E., Cho, E., Ahn, J. H., Kim, S. G.,
Lee, J. S., Kwon, Y. M. and Lee, I. (2000). The
AGAMOUS-LIKE 20 MADS domain protein integrates floral inductive pathways in
Arabidopsis. Genes Dev.
14,2366
-2376.
Llave, C., Xie, Z., Kasschau, K. D. and Carrington, J. C.
(2002a). Cleavage of Scarecrow-like mRNA targets
directed by a class of Arabidopsis miRNA.
Science 297,2053
-2056.
Llave, C., Kasschau, K. D., Rector, M. A. and Carrington, J.
C. (2002b). Endogenous and silencing-associated small RNAs in
plants. Plant Cell 14,1605
-1619.
McGinnis, K. M., Thomas, S. G., Soule, J. D., Strader, L. C.,
Zale, J. M., Sun, T.-p. and Steber, C. M. (2003). The
Arabidopsis SLEEPY1 gene encodes a putative F-box subunit of an SCF
E3 ubiquitin ligase. Plant Cell
15,1120
-1130.
Moon, J., Suh, S. S., Lee, H., Choi, K. R., Hong, C. B., Paek, N. C., Kim, S. G. and Lee, I. (2003). The SOC1 MADS-box gene integrates vernalization and gibberellin signals for flowering in Arabidopsis. Plant J. 35,613 -623.[CrossRef][Medline]
Mouradov, A., Cremer, F. and Coupland G.
(2002). Control of flowering time: Interacting pathways as a
basis for diversity. Plant Cell
14,S111
-S130.
Murray, F., Kalla, R., Jacobsen, J. V. and Gubler, F. (2003). A role for HvGAMYB in anther development. Plant J. 33,481 -491.[CrossRef][Medline]
Palatnik, J. F., Allen, E., Wu, X., Schommer, C., Schwab, R., Carrington, J. C. and Weigel, D. (2003). Control of leaf morphogenesis by microRNAs. Nature 425,257 -263.[CrossRef][Medline]
Park, W., Li, J., Song, R., Messing, J. and Chen, X. (2002). CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana. Curr. Biol. 12,1484 -1495.[CrossRef][Medline]
Peng, J., Carol, P., Richards, D. E., King, K. E., Cowling, R.
J., Murphy, G. P. and Harberd, N. P. (1997). The
Arabidopsis GAI gene defines a signalling pathway that negatively
regulates gibberellin response. Genes Dev.
11,3194
-3205.
Peng, J., Richards, D. E., Hartley, N. M., Murphy, G. P., Devos, K. M., Flintham, J. E., Beales, J., Fish, L. J., Worland, A. J., Pelica, F., Sudhakar, D., Christou, P., Snape, J. W., Gale, M. D. and Harberd, N. P. (1999). "Green revolution" genes encode mutant gibberellin response modulators. Nature 400,256 -261.[CrossRef][Medline]
Reinhart, B. J., Weinstein, E. G., Rhoades, M. W., Bartel, B.
and Bartel, D. P. (2002). MicroRNAs in plants.
Genes Dev. 16,1616
-1626.
Rhoades, M. W., Reinhart, B. J., Lim, L. P., Burge, C. B., Bartel, B. and Bartel, D. P. (2002). Prediction of plant microRNA targets. Cell 110,513 -520.[CrossRef][Medline]
Richards, D. E., King, K. E., Ait-ali, T. and Harberd, N. P. (2001). How gibberellin regulates plant growth and development: A molecular genetic analysis of gibberellin signalling. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52,67 -88.[CrossRef][Medline]
Sasaki, A., Itoh, H., Gomi, K., Ueguchi-Tanaka, M., Ishiyama,
K., Kobayashi, M., Jeong, D. H., An, G., Kitano, H., Ashikari, M. and
Matsuoka, M. (2003). Accumulation of phosphorylated repressor
for gibberellin signaling in an F-box mutant. Science
299,1896
-1898.
Simpson, G. G. and Dean, C. (2002).
Arabidopsis, the Rosetta stone of flowering time?
Science 296,285
-289.
Wilson, R. N., Heckman, J. W. and Sommerville, C. R.
(1992). Gibberellin is required for flowering in Arabidopsis
thaliana under short days. Plant Physiol.
100,403
-408.
Xie, Z., Kasschau, K. D. and Carrington, J. C. (2003). Negative feedback regulation of Dicer-Like1 in Arabidopsis by microRNA-guided mRNA degradation. Curr. Biol. 13,784 -789.[CrossRef][Medline]
Yu, H., Xu, Y., Tan, E. L. and Kumar, P. P.
(2002). AGAMOUS-LIKE 24, a dosage-dependent mediator of the
flowering signals. Proc. Natl. Acad. Sci. USA
99,16336
-16341.
Related articles in Development:
This article has been cited by other articles:
![]() |
P. Tedder, E. Zubko, D. R. Westhead, and P. Meyer Small RNA analysis in Petunia hybrida identifies unusual tissue-specific expression patterns of conserved miRNAs and of a 24mer RNA RNA, June 1, 2009; 15(6): 1012 - 1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Alves-Junior, S. Niemeier, A. Hauenschild, M. Rehmsmeier, and T. Merkle Comprehensive prediction of novel microRNA targets in Arabidopsis thaliana Nucleic Acids Res., May 5, 2009; (2009) gkp272v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Mutasa-Gottgens and P. Hedden Gibberellin as a factor in floral regulatory networks J. Exp. Bot., May 1, 2009; 60(7): 1979 - 1989. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Abreu and S. Munne-Bosch Salicylic acid deficiency in NahG transgenic lines and sid2 mutants increases seed yield in the annual plant Arabidopsis thaliana J. Exp. Bot., March 1, 2009; 60(4): 1261 - 1271. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, L. Wei, X. Zou, Y. Tao, Z. Liu, and Y. Zheng Submergence-responsive MicroRNAs are Potentially Involved in the Regulation of Morphological and Metabolic Adaptations in Maize Root Cells Ann. Bot., October 1, 2008; 102(4): 509 - 519. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Moxon, R. Jing, G. Szittya, F. Schwach, R. L. Rusholme Pilcher, V. Moulton, and T. Dalmay Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening Genome Res., October 1, 2008; 18(10): 1602 - 1609. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. M. Ehrenreich and M. D. Purugganan Sequence Variation of MicroRNAs and Their Binding Sites in Arabidopsis Plant Physiology, April 1, 2008; 146(4): 1974 - 1982. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Allen, J. Li, M. I. Stahle, A. Dubroue, F. Gubler, and A. A. Millar From the Cover: Genetic analysis reveals functional redundancy and the major target genes of the Arabidopsis miR159 family PNAS, October 9, 2007; 104(41): 16371 - 16376. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Jung, Y.-H. Seo, P. J. Seo, J. L. Reyes, J. Yun, N.-H. Chua, and C.-M. Park The GIGANTEA-Regulated MicroRNA172 Mediates Photoperiodic Flowering Independent of CONSTANS in Arabidopsis PLANT CELL, September 1, 2007; 19(9): 2736 - 2748. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Weiss and N. Ori Mechanisms of Cross Talk between Gibberellin and Other Hormones Plant Physiology, July 1, 2007; 144(3): 1240 - 1246. [Full Text] [PDF] |
||||
![]() |
X. M. Xu, A. Rose, S. Muthuswamy, S. Y. Jeong, S. Venkatakrishnan, Q. Zhao, and I. Meier NUCLEAR PORE ANCHOR, the Arabidopsis Homolog of Tpr/Mlp1/Mlp2/Megator, Is Involved in mRNA Export and SUMO Homeostasis and Affects Diverse Aspects of Plant Development PLANT CELL, May 1, 2007; 19(5): 1537 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Achard, M. Baghour, A. Chapple, P. Hedden, D. Van Der Straeten, P. Genschik, T. Moritz, and N. P. Harberd The plant stress hormone ethylene controls floral transition via DELLA-dependent regulation of floral meristem-identity genes PNAS, April 10, 2007; 104(15): 6484 - 6489. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Jaeger, A. Graf, and P. A. Wigge The control of flowering in time and space J. Exp. Bot., October 1, 2006; 57(13): 3415 - 3418. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Cao, H. Cheng, W. Wu, H. M. Soo, and J. Peng Gibberellin Mobilizes Distinct DELLA-Dependent Transcriptomes to Regulate Seed Germination and Floral Development in Arabidopsis Plant Physiology, October 1, 2006; 142(2): 509 - 525. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wu and R. S. Poethig Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3 Development, September 15, 2006; 133(18): 3539 - 3547. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Taganov, M. P. Boldin, K.-J. Chang, and D. Baltimore NF-{kappa}B-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses PNAS, August 15, 2006; 103(33): 12481 - 12486. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lee, S. Lee, K.-Y. Yang, Y.-M. Kim, S.-Y. Park, S. Y. Kim, and M.-S. Soh Overexpression of PRE1 and its Homologous Genes Activates Gibberellin-dependent Responses in Arabidopsis thaliana Plant Cell Physiol., May 1, 2006; 47(5): 591 - 600. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Alvarez, I. Pekker, A. Goldshmidt, E. Blum, Z. Amsellem, and Y. Eshed Endogenous and Synthetic MicroRNAs Stimulate Simultaneous, Efficient, and Localized Regulation of Multiple Targets in Diverse Species PLANT CELL, May 1, 2006; 18(5): 1134 - 1151. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Maher, L. Stein, and D. Ware Evolution of Arabidopsis microRNA families through duplication events Genome Res., April 1, 2006; 16(4): 510 - 519. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kawakatsu, J.-I. Itoh, K. Miyoshi, N. Kurata, N. Alvarez, B. Veit, and Y. Nagato PLASTOCHRON2 Regulates Leaf Initiation and Maturation in Rice PLANT CELL, March 1, 2006; 18(3): 612 - 625. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Achard, H. Cheng, L. De Grauwe, J. Decat, H. Schoutteten, T. Moritz, D. Van Der Straeten, J. Peng, and N. P. Harberd Integration of Plant Responses to Environmentally Activated Phytohormonal Signals Science, January 6, 2006; 311(5757): 91 - 94. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.C. BAULCOMBE Short Silencing RNA: The Dark Matter of Genetics? Cold Spring Harb Symp Quant Biol, January 1, 2006; 71(0): 13 - 20. [Abstract] [PDF] |
||||
![]() |
R. J. Johnston Jr., S. Chang, J. F. Etchberger, C. O. Ortiz, and O. Hobert From the Cover: MicroRNAs acting in a double-negative feedback loop to control a neuronal cell fate decision PNAS, August 30, 2005; 102(35): 12449 - 12454. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Williams, S. P. Grigg, M. Xie, S. Christensen, and J. C. Fletcher Regulation of Arabidopsis shoot apical meristem and lateral organ formation by microRNA miR166g and its AtHD-ZIP target genes Development, August 15, 2005; 132(16): 3657 - 3668. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lu, Y.-H. Sun, R. Shi, C. Clark, L. Li, and V. L. Chiang Novel and Mechanical Stress-Responsive MicroRNAs in Populus trichocarpa That Are Absent from Arabidopsis PLANT CELL, August 1, 2005; 17(8): 2186 - 2203. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Xie, E. Allen, N. Fahlgren, A. Calamar, S. A. Givan, and J. C. Carrington Expression of Arabidopsis MIRNA Genes Plant Physiology, August 1, 2005; 138(4): 2145 - 2154. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Chellappan, R. Vanitharani, and C. M. Fauquet MicroRNA-binding viral protein interferes with Arabidopsis development PNAS, July 19, 2005; 102(29): 10381 - 10386. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lauter, A. Kampani, S. Carlson, M. Goebel, and S. P. Moose microRNA172 down-regulates glossy15 to promote vegetative phase change in maize PNAS, June 28, 2005; 102(26): 9412 - 9417. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Axtell and D. P. Bartel Antiquity of MicroRNAs and Their Targets in Land Plants PLANT CELL, June 1, 2005; 17(6): 1658 - 1673. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Mallory, D. P. Bartel, and B. Bartel MicroRNA-Directed Regulation of Arabidopsis AUXIN RESPONSE FACTOR17 Is Essential for Proper Development and Modulates Expression of Early Auxin Response Genes PLANT CELL, May 1, 2005; 17(5): 1360 - 1375. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-S. Guo, Q. Xie, J.-F. Fei, and N.-H. Chua MicroRNA Directs mRNA Cleavage of the Transcription Factor NAC1 to Downregulate Auxin Signals for Arabidopsis Lateral Root Development PLANT CELL, May 1, 2005; 17(5): 1376 - 1386. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Millar and F. Gubler The Arabidopsis GAMYB-Like Genes, MYB33 and MYB65, Are MicroRNA-Regulated Genes That Redundantly Facilitate Anther Development PLANT CELL, March 1, 2005; 17(3): 705 - 721. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Moon, H. Lee, M. Kim, and I. Lee Analysis of Flowering Pathway Integrators in Arabidopsis Plant Cell Physiol., February 1, 2005; 46(2): 292 - 299. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Gustafson, E. Allen, S. Givan, D. Smith, J. C. Carrington, and K. D. Kasschau ASRP: the Arabidopsis Small RNA Project Database Nucleic Acids Res., January 1, 2005; 33(suppl_1): D637 - D640. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.C.P. TIMMERMANS, M.T. JUAREZ, and T.L. PHELPS-DURR A Conserved microRNA Signal Specifies Leaf Polarity Cold Spring Harb Symp Quant Biol, January 1, 2004; 69(0): 409 - 418. [Abstract] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||