spacer gif spacer gif spacer gif spacer gif ARCHIVE ANNOUNCEMENT! spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online June 28, 2004
doi: 10.1242/10.1242/dev.01206


Development 131, 3357-3365 (2004)
Published by The Company of Biologists 2004


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Development
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Achard, P.
Right arrow Articles by Harberd, N. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Achard, P.
Right arrow Articles by Harberd, N. P.

Modulation of floral development by a gibberellin-regulated microRNA

Patrick Achard1, Alan Herr2, David C. Baulcombe2 and Nicholas P. Harberd1,*

1 Department of Cell and Developmental Biology, John Innes Centre, Norwich NR4 7UH, UK
2 Sainsbury Laboratory, John Innes Centre, Norwich NR4 7UH, UK

* Author for correspondence (e-mail: nicholas.harberd{at}bbsrc.ac.uk)

Accepted 1 April 2004


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Floral initiation and floral organ development are both regulated by the phytohormone gibberellin (GA). For example, in short-day photoperiods, the Arabidopsis floral transition is strongly promoted by GA-mediated activation of the floral meristem-identity gene LEAFY. In addition, anther development and pollen microsporogenesis depend on GA-mediated opposition of the function of specific members of the DELLA family of GA-response repressors. We describe the role of a microRNA (miR159) in the regulation of short-day photoperiod flowering time and of anther development. MiR159 directs the cleavage of mRNA encoding GAMYB-related proteins. These proteins are transcription factors that are thought to be involved in the GA-promoted activation of LEAFY, and in the regulation of anther development. We show that miR159 levels are regulated by GA via opposition of DELLA function, and that both the sequence of miR159 and the regulation of miR159 levels by DELLA are evolutionarily conserved. Finally, we describe the phenotypic consequences of transgenic over-expression of miR159. Increased levels of miR159 cause a reduction in LEAFY transcript levels, delay flowering in short-day photoperiods, and perturb anther development. We propose that miR159 is a phytohormonally regulated homeostatic modulator of GAMYB activity, and hence of GAMYB-dependent developmental processes.

Key words: miR159, GAMYB, Flowering, Photoperiod, Anther


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Gibberellin (GA) promotes a variety of plant developmental processes by overcoming the repressive effects of the DELLA proteins, a family of nuclear repressors of GA response (Richards et al., 2001Go). Recent experiments have indicated that GA overcomes repression by DELLA by targeting the DELLA proteins for destruction in the 26S proteasome (Fu et al., 2002Go; McGinnis et al., 2003Go; Sasaki et al., 2003Go). One consequence of this is that lack of DELLA proteins can suppress the phenotypic effects of GA deficiency. For example, the gibberellin-deficient Arabidopsis ga1-3 mutant flowers very late in short-day (SD) photoperiods (Wilson et al., 1992Go; King et al., 2001Go), and this phenotype is largely suppressed in ga1-3 mutants that also lack the DELLA proteins GAI and RGA (Dill and Sun, 2001Go; King et al., 2001Go; Cheng et al., 2004Go). ga1-3 mutant flowers also exhibit retarded anther development, whilst normal development is restored in ga1-3 mutants that lack the DELLA proteins RGA, RGL1 and RGL2 (Cheng et al., 2004Go). Thus GA regulates floral development in a manner analogous to the way in which it promotes growth: the restraining effects of DELLA proteins are overcome by GA, most likely via SCF complex E3 ubiquitin ligase-dependent targeting of DELLAs for destruction in the proteasome (Fu et al., 2002Go; Sasaki et al., 2003Go; McGinnis et al., 2003Go; Harberd, 2003Go).

First identified in barley aleurone cells (Gubler et al., 1995Go), GAMYB is a GA-specific transcriptional regulator. GAMYB binds specifically to a GA-response element (GARE) in the 5' regulatory region of GA-activated genes. Binding of GAMYB to the GARE activates the transcription of genes encoding the hydrolytic enzymes that release stored nutrients from the endosperm during seed germination (Cercos et al., 1999Go; Gubler et al., 1999Go). Expression of GAMYB (the gene encoding GAMYB) is itself up-regulated by GA (Gubler et al., 1995Go). In addition, constitutive expression of GAMYB mimics the activating effects of GA application on the transcription of genes encoding hydrolytic enzymes, suggesting that GAMYB plays an important role in the GA signalling pathway in aleurone cells (Cercos et al., 1999Go). Recent experiments have shown that transgenic overexpression of GAMYB perturbs the development of anthers, indicating that GAMYB can function in cells other than those of the aleurone layer (Murray et al., 2003Go). Furthermore, loss-of-function mutations in the rice GAMYB gene have recently been shown to abolish GA-mediated induction of the aleurone hydrolase {alpha}-amylase, to retard the growth and development of stamens and anthers, and to impair microsporogensis (Kaneko et al., 2004Go). These latter observations provide genetic proof of the involvement of GAMYB in both aleurone physiology and floral organ development.

Genes encoding proteins closely related in sequence to the barley and rice GAMYB have been identified in Arabidopsis [AtMYB33, AtMYB65 and AtMYB101 (Gocal et al., 2001Go)]. Amongst these AtGAMYBs, AtMYB33 is the most similar to the barley GAMYB (Gocal et al., 2001Go). The AtGAMYBs have been suggested to be involved in the GA-mediated promotion of flowering in SDs, by activation of the floral meristem identity gene LEAFY (Blázquez et al., 1998Go; Blázquez and Weigel, 2000Go; Gocal et al., 2001Go). Activation of LEAFY is known to be important in this process because transgenic over-expression of LEAFY restores a wild-type flowering time to ga1-3 plants grown in SDs (Blázquez et al., 1998Go). AtMYB33 binds in vitro to a GARE in the LEAFY promoter (a GARE that has been shown to be essential for GA induction of LEAFY) and fails to bind to non-functional mutant derivatives of this element. This suggests that GAMYB plays a key role in LEAFY activation (Blázquez and Weigel, 2000Go; Gocal et al., 2001Go). Another floral integrator gene, SOC1, has recently been shown to play an important role in the GA promotion of flowering in SD photoperiods (Moon et al., 2003Go), and it has been suggested that GAMYB and SOC1 both act upstream of LEAFY (Lee et al., 2000Go; Mouradov et al., 2002Go; Yu et al., 2002Go).

To further our understanding of the role of the AtGAMYBs in the regulation of floral development we took advantage of the recent identification of a microRNA (miR159) exhibiting substantial sequence homology with mRNAs encoding AtMYB33, AtMYB65 and AtMYB101 (Gocal et al., 2001Go; Reinhart et al., 2002Go). MicroRNAs are single-stranded RNA molecules of 20-22 nucleotides that can cause complementarity-dependent cleavage (e.g. Llave et al., 2002aGo) or translational inhibition (Chen, 2004Go; Aukerman and Sakai, 2003Go) of target mRNA molecules. More than one hundred distinct small RNAs have been identified in plants, although only a minority of these are microRNAs (Llave et al., 2002bGo; Reinhart et al., 2002Go). Most of the predicted targets of these microRNAs are members of transcription factor gene families involved in developmental patterning or cell differentiation (Rhoades et al., 2002Go; Kidner and Martienssen, 2003Go). In this paper we describe experiments showing that miR159 directs the cleavage of AtMYB33-encoding transcripts (see also Palatnik et al., 2003Go). We also show that miR159 sequence is evolutionarily conserved, and that miR159 levels are GA-regulated via a mechanism that is evolutionarily conserved between Arabidopsis and barley and that is dependent on the GA-promoted opposition of the function of DELLA protein GA-response repressors. To further investigate the role of miR159 in vivo, we generated transgenic Arabidopsis plants over-expressing miR159 and examined the floral developmental phenotypes of these plants. We found that elevated expression of miR159 resulted in a delay in flowering in SD photoperiods that was associated with a reduction in the levels of LEAFY transcripts. In addition, previous experiments in barley and rice have identified a role for GAMYB in anther development (Murray et al., 2003Go; Kaneko et al., 2004Go). We found that elevated levels of miR159 perturbed anther development and caused a consequent reduction in floral fertility. These observations suggest that miR159 modulates GA-mediated developmental regulation via its effects on GAMYB activity.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Plant material and growth conditions
Arabidopsis experiments used the Landsberg erecta laboratory strain of Arabidopsis thaliana. The ga1-3, gai and ga1-3 gai-t6 rga-24 mutations were as previously described (Achard et al., 2003Go). The plants were grown in a growth cabinet in long days (LDs; 22°C, 16-hours photoperiod) or in short days (SDs; 22°C, 10-hour photoperiod) as indicated. Barley (Hordeum vulgare) floral tissues were obtained from 7-week-old greenhouse-grown plants (16 hour photoperiod). Tobacco (Nicotiana benthamiana) leaves and floral tissues were harvested from 5-week-old greenhouse-grown plants (16-hour photoperiod).

Plasmids and construction
The 35S:MYC-MYB33 construct contained a copy of the AtMYB33 (accession number AF411969) coding sequence. The cDNA was amplified from total RNA by RT-PCR using gene-specific primers (AtMYB33: GCATGTTGAGGCACTTGAGTGGAGTC and TCTGGAATCATAACAGGTAATGTCGG) and cloned into the p35S-2 vector (P. Mullineaux, John Innes Centre). Three myc epitope tags were inserted in phase, upstream of the AtMYB33 cDNA. After digestion, an EcoRV fragment containing the construction 35S:MYC-MYB33 was inserted into the plant transformation vector pGreen0029 (P. Mullineaux, John Innes Centre). A mutated version of the AtMYB33 transgene (35S:MYC-mMYB33) was generated by PCR using the Quick Change XL site-directed mutagenesis kit (Stratagene). The mutated mMYB33 primers used were as follows: GGCAGTGAAGCTGGAATTGCCAAGCTTTCAATATTCAGAAACAAC and GTTGTTTCTGAATATTGAAAGCTTGGCAATTCCAGCTTCACTGCC. The nucleotide sequence of the mMYB33 cDNA was as described by Palatnik et al. (Palatnik et al., 2003Go). The 35S:miR159a construct contained a copy of the precursor of miR159 isoform a (Fig. 1A). A fragment of 228 bp (containing the precursor of 182 bp) was amplified from genomic DNA by PCR using specific primers (miR159a: GAGAAGGTGAAAGAAGATGTAGAGCTCCC and CGATAGATCTTGATCTGACGATGGAAG). These primers were designed to anneal specifically to genomic DNA on either side of the predicted miR159a hairpin precursor. The amplified fragment was then cloned into the p35S-2 vector, and an EcoRV fragment containing the construct 35S:miR159a was then inserted into the pGreen0029 vector. The 35S:GFP construct was made similarly using GFP-specific primers: CGGCACGACTTCTTCAAGAGCGC and GTATTCCAACTTGTGGCCGAGG. The resulting constructs were introduced into Agrobacterium tumefaciens strain GV3101.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1. MiR159 and GAMYB mRNA target sequences are evolutionarily conserved. (A) Sequence similarity between three Arabidopsis miR159 isoforms. The nucleotide mismatches are in grey. (B) Sequence similarity between miR159a and internal sequences of putative target genes. Nucleotide mismatches between the internal sequences and miR159a are in grey, and the total number of mismatches is indicated after each sequence. Function and accession number for each putative target is indicated on the right. (C) Location of the complementary sequence between GAMYB genes and miR159. Regions of similarity between Arabidopsis and H. vulgare GAMYB genes are shown in black. The region of sequence that is complementary between miR159a and the GAMYB genes is shown in grey.

 
Infiltration of Agrobacterium tumefaciens into N. benthamiana
Agro-infiltration was performed in Nicotiana benthamiana leaves as described previously (Llave et al., 2002aGo). 35S:miR159a, 35S:MYC-MYB33, 35S:MYC-mMYB33 and 35S:GFP were introduced into A. tumefaciens and the bacteria injected into N. benthamiana leaves with a syringe. For co-injections of two or three different constructs, bacteria were resuspended in infiltration medium (0.5x Murashige and Skoog salts, 5% sucrose, 0.5 g/l Mes) at OD600=1, and incubated for 3 hours at room temperature with 150 µM acetosyringone. Zones of infiltration were harvested at 4 and 5 days after injection for RNA and protein isolations. The 35S:GFP construct was used as a control for the co-Agro-infiltration.

Transformation of Arabidopsis thaliana
Transformation was performed by floral dipping (Clough and Bent, 1998Go). A. tumefaciens containing the appropriate constructs were resuspended in infiltration buffer (0.5x Murashige and Skoog salts, 5% sucrose, 0.5 g/l Mes, 0.05% Silwet L77) at OD600=1. Transformants were selected by resistance to 50 mg/l of kanamycin sulphate. Plants in Fig. 5A-C, Figs 6 and 7 were homozygous for the 35S:miR159a transgene (T2 generation); plants in Fig. 5D,E were from segregating populations (self-pollination progeny of 35S:miR159a primary transformants).



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 5. Overexpression of miR159a delays the floral transition in short days (SDs). (A) wild-type (WT) and 35S:miR159a homozygotes grown for 4 weeks in SDs. The arrow indicates a new rosette leaf. (B) WT and 35S:miR159a homozygotes grown for 6 weeks in short days. (C) Means of the number of total leaves produced before flowering (nb), and of the number of days to flower in SD conditions (±s.e.; n>10), are shown. Wild type, light grey bars; 35S:miR159a homozygotes, dark grey bars. (D) RNA gel-blot analysis of miR159 levels in 4-week-old wild-type and 35S:miR159a leaves. Lines 2 and 4 are clonally independent (T1) transgenic lines that segregate 35S:miR159a. WTF, segregants lacking the transgene, flowered at the same time as wild type (non-transgenic control); LF, late flowering segregants carrying 35S:miR159a. (E) RNA gel-blot analysis of MYB33, LEAFY and SOC1 mRNA performed on the same plant material as in D. ELF4a transcript was used as a RNA sample control.

 



View larger version (98K):
[in this window]
[in a new window]
 
Fig. 6. 35S:miR159a plants have reduced fertility. (A) Wild type and 35S:miR159a homozygotes grown for 4 weeks in a LD photoperiod (16 hours light). The arrows indicate the two last cauline leaves formed. (B) Siliques of wild type and 35S:miR159a homozygotes. Scale bar: 3 mm. (C) Wild-type inflorescence. (D) Inflorescence of 35S:miR159a homozygote. (E) RNA gel-blot analysis of miR159 and MYB33 from wild-type and 35S:miR159a flowers.

 



View larger version (95K):
[in this window]
[in a new window]
 
Fig. 7. Overexpression of miR159a affects anther development. (A,C) Wild-type flowers. (B,D) Flowers of 35S:miR159a homozygotes. (E) Anthers from wild-type and 35S:miR159a homozygote [taken from flowers at floral development stage 10 (Cheng et al., 2004Go)]. (F) Anthers from wild-type and 35S:miR159a homozygotes (from flowers at floral development stage 12). Scale bars: A, B, 1 mm; C, D, 500 µm; E, 50 µm; F, 100 µm.

 
Nucleic acid isolation and blot analysis
Total RNA was extracted using the Trizol reagent (Gibco-BRL) and resuspended in 50% formamide. Low molecular mass and high molecular mass RNAs were isolated by three successive precipitations in PEG8000/NaCl as previously described (Hamilton et al., 2002Go). 20 µg high molecular mass RNA was separated in a 1% denaturing agarose gel and subjected to blot-hybridisation analysis. Radiolabelled probes were prepared from a 200 bp 3'-end MYB33 fragment or from full-length LEAFY, SOC1 and ELF4a open reading frames via random priming reactions (Roche) in the presence of [{alpha}32P]dCTP. 20 µg low molecular mass RNA was separated in a 15% denaturing polyacrylamide gel and subjected to blot-hybridization analysis. Small RNA (miR159a: TAGAGCTCCCTTCAATCCAAAGA; miR167: TAGATCATGCTGGCAGCTTCA) probes were labelled with T4 kinase (Gibco-BRL) in the presence of [{gamma}32P]ATP. Since miR159 hybridises with miR-JAW [a microRNA that is more divergent from miR159 than each of the miR159 isoforms are from each other; Fig. 1A (Palatnik et al., 2003Go)], it is likely that the miR159a probe used in our experiments hybridises with all three isoforms of miR159. Each RNA blot analysis was repeated at least twice.

Protein isolation and analysis
Agro-infiltrated tobacco leaves were harvested and frozen in liquid nitrogen. Total protein was extracted and quantified as described by Achard et al. (Achard et al., 2003Go). 20 µg of proteins were separated by 10% SDS-PAGE and transferred to a nitrocellulose membrane. Immunodetection of the MYC-MYB33 fusion protein was performed using a 2000-fold dilution of anti-cMYC polyclonal antibodies from goat (Santa Cruz Biotechnology, CA) and a 2000-fold dilution of peroxidase-conjugated anti-goat IgG (Santa Cruz Biotechnology, CA). Immunodetection of GFP was performed using a 2500-fold dilution of anti-GFP monoclonal antibodies from mouse (Chemicon International, Temecula, CA, USA) and a 5000-fold dilution of peroxidase-conjugated goat anti-mouse IgG (SouthernBiotech). Signals were detected by chemiluminescence using the ECL Western Blotting Analysis System (Amersham Biosciences).


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
MiR159 is a post-transcriptional regulator of GAMYB
MiR159 is a microRNA of 21 nucleotides in length derived from a precursor molecule of 182 nucleotides (Reinhart et al., 2002Go). In Arabidopsis, miR159 is present in three isoforms (Fig. 1A). MiR159 sequence is of near-perfect complementarity to an internal sequence of five Arabidopsis mRNAs encoding three GAMYB-like proteins (AtMYB33, AtMYB65 and AtMYB101) and two additional MYB proteins (Fig. 1B). The Arabidopsis miR159 sequence is also closely complementary to an internal sequence of several GAMYB mRNAs from barley (Hordeum vulgare; HvGAMYB), Oryza sativa, Avena sativa and Lolium temulentum (Fig. 1B). AtMYB33, AtMYB65 and AtMYB101 share substantial homology with HvGAMYB in an N-terminal region corresponding to an R2R3 repeat DNA-binding domain (Fig. 1C). These proteins also contain three additional conserved motifs (Box 1, Box 2 and Box 3) that are characteristic of GAMYB (Gocal et al., 2001Go). The zone that is complementary between miR159 and the GAMYB-encoding mRNAs is located about 100 nucleotides upstream of the sequence encoding Box 2 (Fig. 1C).

MicroRNAs can regulate gene expression by directing cleavage or by inhibition of translation of target transcripts (Llave et al., 2002aGo; Chen, 2004Go; Aukerman and Sakai, 2003Go). We tested if miR159 directs the cleavage of GAMYB-like mRNAs (see also Palatnik et al., 2003Go) using an Agrobacterium-mediated delivery system to co-express miR159 and MYB33 target mRNA in N. benthamiana leaf tissue (Llave et al., 2002aGo) (Fig. 2). Four constructs (35S:miR159a, 35S:MYC-MYB33, 35S:MYC-mMYB33 and 35S:GFP) were inoculated and expressed (Fig. 2A). Whilst basal levels of endogenous miR159 were detected in tissues lacking the 35S:miR159a construct, increased levels of miR159 were detected in tobacco leaves inoculated with this construct, indicating that over-expression and processing of transgenically derived miR159a was successfully achieved (Fig. 2B). Expression of the 35S:MYC-MYB33 construct resulted in detectable levels of MYC-MYB33 transcripts (MYC-MYB33a; Fig. 2B). Co-expression of 35S:MYC-MYB33 with 35S:miR159a resulted in loss of the full length MYC-MYB33a transcript form, and the appearance of detectable levels of a smaller transcript (3'-MYB33b) that hybridized to the MYB33 probe (a 3' probe fragment, see Materials and methods; Fig. 2B). We attribute this smaller fragment to internal cleavage of the MYC-MYB33 mRNA directed by miR159 (as previously suggested by 5' RACE-PCR experiments; Palatnik et al., 2003Go). Consistent with this attribution, co-expression of 35S:MYC-mMYB33 (encoding a MYC-mMYB33 transcript that carries an altered miR159 binding site; see Materials and methods) with 35S:miR159a resulted in detectable transcripts of the MYC-MYB33a size, but not of the 3'-MYB33b size.



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2. MiR159 directs the cleavage of MYB33 transcripts and regulates MYB33 levels. (A) Constructs specifying miR159a, MYC-MYB33 and MYC-mMYB33 RNAs and driven by the 35S promoter. 35S:GFP was used as control for co-Agro-inoculation. (B) RNA gel-blot analysis of miR159, MYC-MYB33 and MYC-mMYB33 RNA forms (full length MYC-MYB33a and cleaved 3'-MYB33b transcripts) in N. benthamiana leaves co-Agro-inoculated with different combinations of 35S:miR159a, 35S:MYC-MYB33, 35S:MYC-mMYB33 and 35S:GFP as indicated. (C) Immunoblot analysis of total proteins (20 µg) from N. benthamiana leaves co-Agro-inoculated as in B. Goat anti-myc antiserum and a peroxidase-conjugated anti-goat IgG were used as primary and secondary antibodies, respectively. The lower panel shows a GFP immunoblot using the same extracts (loading control).

 
Subsequently, we tested whether miR159 causes a reduction in the level of MYC-MYB33 fusion protein (Fig. 2C). A peptide of ~83 kDa was recognised by MYC antibodies in a sample from leaves expressing 35S:MYC-MYB33 but not in a sample co-expressing 35S:miR159a and 35S:MYC-MYB33 (Fig. 2C). This peptide was of the size expected for the MYC-MYB33 fusion protein encoded by 35S:MYC-MYB33. Taken together, these RNA gel-blot and immunoblot analyses indicate that miR159 can direct the cleavage of transcripts encoding GAMYB, thus down-regulating GAMYB levels.

MiR159 is an evolutionarily conserved sequence
We next investigated the distribution of miR159 in Arabidopsis, tobacco (Nicotiana benthamiana) and barley. In Arabidopsis, miR159 accumulated predominantly in young seedlings and flowers, was less abundant in rosette leaves, cauline leaves or siliques, and was undetectable in roots (Fig. 3). Interestingly, miR159 was also clearly detectable in tobacco and barley. As in Arabidopsis, miR159 accumulated predominantly in the inflorescence and floral tissues in these species (Fig. 3). These observations indicate that the sequence and developmental regulation of miR159 is highly conserved, despite the considerable evolutionary distance that separates Arabidopsis, tobacco and barley from their last common ancestor.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 3. MiR159 levels vary in different tissues. RNA gel-blot analysis of miR159 from Arabidopsis root, 5 day-old seedling, rosette leaf, cauline leaf, flower and silique tissues; N. benthamiana leaf and flower tissues; barley (Hordeum vulgare) leaf, apical shoot and green spike (inflorescence) tissues. 5S rRNA was used as RNA control (shown in ethidium bromide-stained gel).

 
GA enhances miR159 levels by opposing DELLA function
Since GAMYB functions in GA-mediated gene regulation, we next investigated the possibility that GA might itself regulate miR159 levels. The Arabidopsis ga1-3 mutant is GA deficient and exhibits a dwarf, dark-green phenotype (Koornneef and van der Veen, 1980Go; King et al., 2001Go). MiR159 was less abundant in flowers of ga1-3 than in wild-type flowers (Fig. 4A). MiR159 levels in GA-treated ga1-3 plants were similar to those in GA-treated wild-type plants, and higher than in untreated wild-type controls (Fig. 4A). These data indicate that miR159 levels are GA regulated.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4. GA regulates miR159 levels via the DELLA-dependent GA signalling pathway. (A) RNA gel-blot analysis of miR159, MYB33 and SOC1 from wild-type (WT), gai, ga1-3 and ga1-3 gai-t6 rga-24 plants grown in long days (LD) in the presence (+GA) or absence (–GA) of gibberellin (100 µM GA3 sprayed twice per week). The blots were stripped and re-analysed with miR167 and ELF4a probes (RNA controls). (B) RNA gel-blot analysis of miR159 levels in wild-type and sln1-dwarf mutant barley (Hordeum vulgare). 5S rRNA was used as RNA control.

 
GA-regulated processes are usually controlled via the effects of GA on DELLA protein function (Richards et al., 2001Go). In many cases, DELLA proteins act as repressors of GA-response, and GA acts by targeting the DELLA proteins for destruction in the proteasome (Fu et al., 2002Go). We therefore tested whether GA enhances miR159 levels by overcoming the effects of DELLA proteins. Firstly, we found that the level of miR159 was reduced in gai mutant plants (Fig. 4A). The gai mutant shares many phenotypic characteristics with ga1-3, except that the gai phenotype cannot be restored to normal with GA (Koornneef et al., 1985Go; Peng et al., 1997Go). gai encodes a dominant altered-function mutant GAI protein (gai) that is resistant to the opposing effects of GA and confers a reduced GA response (Peng et al., 1997Go; Richards et al., 2001Go). Consistent with this we found that the reduced miR159 levels in gai were not restored to normal by GA. Secondly, we investigated the effect of lack of the DELLA proteins GAI and RGA on miR159 levels in ga1-3. Previous experiments have shown that various aspects of the ga1-3 phenotype are suppressed in plants lacking GAI and RGA (Dill and Sun, 2001Go; King et al., 2001Go; Fu and Harberd, 2003Go; Cheng et al., 2004Go). We found that ga1-3 plants lacking GAI and RGA (ga1-3 gai-t6 rga-24) had miR159 levels that were not detectably different from those of wild-type plants (Fig. 4A). Taken together, these observations indicate that the DELLA proteins GAI and RGA repress miR159 levels, and that GA promotes miR159 levels by overcoming DELLA-mediated repression.

We next compared the regulation of miR159 level in Arabidopsis with its regulation in barley. Barley SLN1 encodes a DELLA protein (Chandler et al., 2002Go; Fu et al., 2002Go), and the dominant dwarfing sln1-dwarf allele encodes a mutant protein that is altered in the highly conserved DELLA domain (X. Fu, D. E. Richards and N.P.H., unpublished) (see also Peng et al., 1999Go; Chandler et al., 2002Go; Itoh et al., 2002Go). The effect of this mutation is analogous to that of the Arabidopsis gai allele. We found that miR159 levels were reduced in sln1-dwarf compared to SLN barley (Fig. 4B). Thus, GA-DELLA system regulation of miR159 levels is evolutionarily conserved across the divided lineage that separates Arabidopsis and barley.

Exogenous GA enhances MYB33 transcript levels
We also compared the levels of MYB33 transcripts in the Arabidopsis GA-signalling mutant lines. MYB33 transcript levels were not substantially different in wild type, ga1-3, gai or ga1-3 gai-t6 rga-24 (grown in the absence of exogenous GA; Fig. 4A). However, MYB33 transcript levels were consistently higher in all of these genotypes when grown in the presence of exogenous GA (Fig. 4A). Since MYB33 is the target of miR159, it might have been expected that there would be an inverse correlation between miRNA and MYB33 transcript levels. Yet whilst miR159 levels were reduced in ga1-3 (and restored by GA or lack of GAI and RGA) there were no detectable differences in MYB33 transcript levels in these various mutant lines. This apparent paradox is considered further in the Discussion.

MiR159 level modulates photoperiodic control of the floral transition
Recent studies suggest that GA might regulate flowering via GAMYB-dependent activation of the floral meristem identity gene LEAFY (Blázquez and Weigel, 2000Go; Gocal et al., 2001Go). In Arabidopsis, the GA pathway has a stronger effect on flowering in SD than it does in LD photoperiods (Wilson et al., 1992Go; Mouradov et al., 2002Go; Moon et al., 2003Go). We therefore investigated the effect of elevated expression of miR159 on flowering time in SDs. Four-week-old SD-grown transgenic plants over-expressing miR159a (homozygous for 35S:miR159a) had leaves that were smaller and rounder than wild-type control plants (Fig. 5A). In addition, SD-grown 35S:miR159a plants exhibited a delay in flowering time (Fig. 5B). Wild-type plants bolted then flowered at day 39 (±1.12) whereas transgenic plants flowered at day 53 (±4.66) (Fig. 5C). A delay in flowering time (of varying severity) was observed in plants of ten additional independent transgenic lines (each homozygous for 35S:miR159a), and was heritable in the progeny of these plants (data not shown). 35S:miR159a homozygotes also produced more rosette leaves than did wild-type controls when grown in SDs (37±2.63 against 23±2.38 for wild type; Fig. 5C). In LD photoperiods the effect of 35S:miR159a was much less than in SDs, with LD-grown plants over-expressing miR159a flowering at approximately the same time as wild-type plants (actually 1 day later; data not shown).

In subsequent experiments, segregation of the late-flowering phenotype was followed in two independent transgenic families that were segregating for 35S:miR159a. Only those plants overexpressing miR159a exhibited late flowering in SDs, whilst segregants expressing normal levels of miR159 flowered at the same time as non-transgenic wild-type controls (Fig. 5D). We next determined the levels of MYB33 transcripts, the targets of miR159, in these plants. MYB33 transcripts were detected at substantially reduced levels in plants over-expressing miR159a (and exhibiting a late flowering phenotype), but were not reduced in segregating plants that expressed normal levels of miR159 (Fig. 5E). In addition, the pattern of MYB33 transcript accumulation correlated with that of LEAFY transcripts. LEAFY transcript levels were reduced in SD-grown 35S:miR159a plants, but not in segregants expressing normal levels of miR159 (Fig. 5E). Taken together, these observations suggest that miR159 directs the cleavage of MYB33 transcripts, that the resultant reduction in MYB33 level reduces LEAFY activity, and that the reduction in LEAFY activity delays SD flowering.

Recent experiments have shown that SUPPRESOR OF OVEREXPRESSION OF CO1 (SOC1) is also an important component of the GA-dependent flowering pathway and that integration via SOC1 is necessary for flowering in SDs (Moon et al., 2003Go). We therefore investigated the relationships between the GA-DELLA system, miR159, MYB33 and SOC1. To begin with, we tested whether the DELLA proteins GAI and RGA regulate SOC1 expression. SOC1 transcripts were less abundant in GA-deficient ga1-3 plants than in wild-type plants. In contrast, similar levels of SOC1 transcripts were observed in wild-type and ga1-3 plants treated with exogenous GA (Fig. 4A) (see also Moon et al., 2003Go). Two further observations indicated that GA regulates SOC1 transcript levels via opposition of DELLA repression. First, SOC1 transcript levels were reduced in gai mutant plants (compared to wild type) and not restored to wild-type levels by exogenous GA (Fig. 4A). Thus the constitutively repressing mutant gai protein confers a reduction in SOC1 transcript levels. Secondly, SOC1 transcript levels in ga1-3 plants lacking GAI and RGA (ga1-3 gai-t6 rga-24) were little different to those in wild-type plants (Fig. 4A). Thus lack of GAI and RGA suppressed the effect of ga1-3 on SOC1 transcript levels, indicating that GA regulates SOC1 levels (and thus flowering time in SD) by opposition of GAI and RGA function.

How does GA-pathway regulation of SD flowering via SOC1 relate to GA-pathway regulation of flowering via miR159/MYB33? To answer this question we determined SOC1 transcript levels in plants from a family segregating for 35S:miR159a. Late flowering plants contained SOC1 transcript levels that were similar to those of non-transgenic wild-type plants (Fig. 5E). Thus an increase in miR159 level has no downstream effect on SOC1 transcript levels, demonstrating that the SOC1- and miR159/MYB33-dependent signalling pathways through which GA regulates flowering in SD act independently of one another.

Elevated miR159 levels affect anther development
GA and GAMYB are known to be involved in the regulation of anther development (Murray et al., 2003Go; Cheng et al., 2004Go; Kaneko et al., 2004Go). We next investigated the possible role of miR159 in anther development. LD-grown 35S:miR159a homozygotes had smaller cauline leaves than wild-type controls (Fig. 6A). In addition, 35S:miR159a plants had short, sterile siliques (Fig. 6C,D). 35S:miR159a siliques were ~40% of the length of wild-type siliques and contained no seeds (Fig. 6B; eventually a few fertile siliques were obtained in some plants). In other respects the development of 35S:miR159a homozygotes was indistinguishable from that of wild type.

In order to determine the cause of the infertility, the floral development of 35S:miR159a homozygotes was compared with that of wild-type controls. Except for the anthers, the floral organs of 35S:miR159a plants appeared relatively normal. However, the increase in miR159 levels (and decrease in MYB33 transcript levels; Fig. 6E) characteristic of 35S:miR159a plants was associated with a progressive increase in the size of anthers, and with a darkening of anther colour (Fig. 7A-D). In addition, the 35S:miR159a anthers failed to release pollen (Fig. 7D). Since seed-bearing siliques were recovered following cross-fertilization of 35S:miR159a with wild-type pollen (data not shown) it was clear that the infertility of the 35S:miR159a plants was due to male sterility resulting from failure to release pollen. The anther phenotype characteristic of the 35S:miR159a plants was visible from floral developmental stage 10 (Fig. 7E) and was clear until stage 12 (Fig. 7F). Subsequently, the anthers became increasingly dark in colour (Fig. 7B,D). The final stamen lengths in wild-type and 35S:miR159a flowers were indistinguishable (data not shown).


    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Although the recent discoveries of small RNA species in the cells of diverse organisms have generated much excitement, there are still relatively few cases where small RNAs have been definitively linked to specific plant developmental functions (Chen, 2004Go; Aukerman and Sakai, 2003Go; Emery et al., 2003Go; Palatnik et al., 2003Go). In this paper we describe experiments designed to investigate the developmental function of miR159. Our initial interest in miR159 was stimulated by its complementarity with a short region of transcripts encoding proteins of the GAMYB class (Rhoades et al., 2002Go; Park et al., 2002Go). The specific function of GAMYB proteins in various aspects of developmental regulation by the phytohormone GA led us to develop the hypothesis that miR159 might also function in GA-regulated developmental processes.

On the basis of the sequence complementarity between miR159 and transcripts encoding GAMYB proteins, it seemed possible that miR159 might direct the cleavage of these transcripts. We tested this possibility, and found that expression of miR159 in N. benthamiana causes a reduction in the level of intact MYB33 transcripts and of detectable MYB33 protein. In addition, expression of miR159 failed to reduce the level of mutant MYB33 transcripts (mMYB33) carrying an alteration in the miR159 complementary region. These results are consistent with the previous observation that MYB33 and MYB65 transcripts are cleaved in Arabidopsis plants in the centre of the miR159 binding site (Palatnik et al., 2003Go). Furthermore, whereas overexpression of MYB33 has no obvious effect on development in Arabidopsis, overexpression of miR159-resistant mMYB33 transcripts confers dramatic developmental perturbations [e.g. curly leaves (Palatnik et al., 2003Go)]. These results indicate that miR159-directed cleavage of MYB33 (and other GAMYB-encoding transcripts) (Palatnik et al., 2003Go) is developmentally relevant. However, it is also possible that miR159 influences development via inhibition of translation of GAMYB-encoding transcripts.

We next investigated the levels of miR159 in Arabidopsis and barley GA-signalling mutant lines. We found that the accumulation of miR159 was positively regulated by GA, and negatively regulated by DELLA proteins (GAI and RGA in Arabidopsis; SLN in barley; Fig. 4). Therefore GA regulates miR159 accumulation via an evolutionarily conserved mechanism that involves opposition of DELLA function. Recent advances have shown that the DELLA proteins, although originally identified as components of the GA signalling pathway, also mediate auxin and ethylene responses (Achard et al., 2003Go; Fu and Harberd, 2003Go). Thus DELLA proteins may serve as a means of regulating miR159 levels in response to multiple hormonal signalling inputs. Although it has recently been shown that specific miRNA levels are hormonally regulated in Drosophila (Bashirullah et al., 2003Go), our results are, to our knowledge, the first demonstration of hormonal regulation of microRNA levels in plants.

Since GAMYB has been previously implicated in the regulation of flowering time in SDs in Arabidopsis (Blázquez et al., 1998Go; Blázquez and Weigel, 2000Go) and of anther development in barley and in rice (Murray et al., 2003Go; Kaneko et al., 2004Go), we determined if transgenic alteration in miR159 levels would perturb these developmental aspects. The timing of the floral transition is of considerable adaptive significance, and hence is subject to multiple interdependent genetic and environmental controls (Mouradov et al., 2002Go). Genetic and molecular analyses have identified three distinct genetic floral promotive pathways: the photoperiod pathway, the autonomous pathway and the GA pathway; the latter being of particular prominence in SD photoperiods (Simpson and Dean, 2003). Previous data suggested that the GA pathway promotes flowering in SD via GAMYB-dependent activation of the floral meristem identity gene LEAFY (Blázquez et al., 1998Go; Blázquez and Weigel, 2000Go). Consistent with these ideas, we found that transgenic overexpression of miR159a resulted in a reduction in the levels of MYB33 and of LEAFY transcripts, and a specific delay in flowering in SDs. Despite causing severe developmental perturbations at the vegetative rosette stage, expression of miR159-resistant mMYB33 transcripts had no dramatic effect on flowering time in SDs (J. Palatnik and D. Weigel, personal communication). Similarly, treatment of SD-grown wild-type plants with GA promotes flowering time by only a few days (P.A. and N.P.H.; data not shown). Thus, in SD conditions, flowering time is at most slightly advanced by increases in MYB33 activity (due to mMYB33 transcripts or GA treatment) but is markedly delayed by decreases in MYB33 activity (due to overexpression of miR159a).

The GA-deficient ga1-3 mutant also either fails to flower or flowers very late in SD photoperiods (Wilson et al., 1992Go). Yet the ga1-3 mutant contains reduced, rather than increased, levels of miR159 (Fig. 4A). Thus increased levels of mi159 cannot contribute to the late flowering of ga1-3 in SD photoperiods. Our experiments further investigated the relationship between GA regulation of SD flowering and miR159 by looking at levels of transcripts encoding the floral integrator SOC1. GA regulates SD flowering time both via the GAMYB-LEAFY pathway, and via regulation of SOC1 expression (Fig. 8) (Moon et al., 2003Go). We therefore investigated the effect of GA-DELLA signalling, and of overexpression of miR159a, on SOC1 transcript levels. We showed that GA regulates SOC1 transcript levels by opposing the negative effects of GAI and RGA (Fig. 4A). We also showed that transgenic overexpression of miR159a had no detectable effect on SOC1 transcript levels (Fig. 5E). Thus GA regulates SOC1 via a DELLA-opposition-dependent pathway that does not involve GAMYB (or miR159). It seems probable that SD-grown ga1-3 plants flower late (although miR159 levels are reduced) because the reduction in SOC1 transcripts, also seen in ga1-3, overcomes any promotion of flowering resulting from miR159 reductions.



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 8. The GA-DELLA signalling system regulates floral development by modulation of miR159/GAMYB and SOC1. Schematic representation of the regulation of the floral transition in SD photoperiods via the GA-DELLA signalling pathway. GA relieves the DELLA repression of GAMYB (e.g. MYB33) and SOC1 and enhances activity of the downstream floral meristem identity gene LEAFY. This activation is moderated by the GA activation of miR159, a post-transcriptional regulator of GAMYB transcript levels. This GA-dependent homeostatic mechanism provides sensitive regulation of the floral transition in SDs and anther development via the regulation of GAMYB levels.

 
We also found that transgenic overexpression of miR159a caused the formation of abnormal, sterile anthers. In particular, increased levels of miR159 caused an increase in anther size, a darkening of anthers and a failure to release pollen. These observations are of particular interest since, in barley, increased expression of HvGAMYB has some opposite effects on anther development. Whilst barley plants overexpressing HvGAMYB are also pollen-sterile, these plants have anthers of decreased size and lightened colour (Murray et al., 2003Go). In rice, lack of GAMYB also perturbs stamen and anther development (Kaneko et al., 2004Go). Taken together, these various observations suggest that a modulation in GAMYB levels causes a defect in anther development and a consequent reduction in floral fertility.

Overall, the results obtained from our transgenic overexpression experiments support the view that miR159 acts in GA signalling to regulate GAMYB activity, presumably through its ability to direct the cleavage of mRNA molecules encoding GAMYB proteins. However, our experiments also reveal a complexity in the relationship between GA signalling, miR159 and GAMYB levels. The levels of MYB33 transcripts do not obviously differ between wild-type, GA-deficient (ga1-3) or GA-deficient plants lacking GAI and RGA (ga1-3 ga-t6 rga-24), despite the fact that miR159 levels vary between these different genotypes (Fig. 4A). At first sight this observation seems puzzling, since the a priori expectation would be that an increased level of miR159 should result in a reduction in MYB33 transcript levels. However, the levels of another plant microRNA, miR39, actually display a positive correlation (rather than the expected negative correlation) with the levels of its cleavage target (Llave et al., 2002aGo). These unexpected relationships between microRNA and target transcript levels may result from a failure of gel-blot analyses to reveal underlying heterogeneities in the relative cell-specific distributions of microRNAs and their targets, or may reveal a homeostatic component of microRNA function.

Recent results indicate that miRNAs can work as components in negative feedback regulatory loops (Xie et al., 2003Go). It is therefore possible that miR159 acts within such a loop, as a general homeostatic regulator of GAMYB function. An illustrative example (Fig. 8) of how such feedback might operate could involve down-regulation of MYB33 activity by miR159 (as shown in this paper), and compensatory up-regulation of miR159 by MYB33. Indeed, potential GARE-like sites have been identified in the putative promoter of the miR159 precursor-encoding gene, suggesting the possibility of feedback regulation of miR159 by MYB33 (P.A. and N.P.H., data not shown).

Of course the above hypothetical example is but one possible route for regulation of levels of MYB33 activity, and concerns miR159 and MYB33 in isolation. The miR159/MYB33 system is also subject to DELLA-dependent regulation. In this case, the fact that MYB33 transcript levels are indistinguishable in ga1-3 compared with ga1-3 gai-t6 rga-24 could be explained if absence of GAI and RGA increases both MYB33 transcription and miR159 levels. Larger-scale changes to the system (e.g. transgenic overexpression of miR159a) break homeostatic regulation of MYB33 levels and result in detectable changes in phenotype (delayed flowering in SD, perturbed anther development). We therefore propose that miR159 acts as a homeostatic regulator of GAMYB function in GA-regulated plant development. Despite these complexities, the strong evolutionary conservation of both sequence and phytohormonal regulation of miR159 suggests that this microRNA is of adaptive significance to the growth and development of many plant species.


    ACKNOWLEDGMENTS
 
We thank Louise Chappell for technical assistance with miRNA analysis; Lali Sakvarelidze for computing assistance during the creation of the figures; the European Union Research Training Network (INTEGA: HPRN-CT-RT1-2000-00090) and BBSRC (Core Strategic Grant to the John Innes Centre) for funding. We also thank J. Palatnik and D. Weigel for permission to cite unpublished observations.


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 

Achard, P., Vriezen, W. H., Van Der Straeten, D. and Harberd, N. P. (2003). Ethylene regulates Arabidopsis development via the modulation of DELLA protein growth repressor function. Plant Cell 15,2816 -2825.[Abstract/Free Full Text]

Aukerman, M. J. and Sakai, H. (2003). Regulation of flowering time and floral organ identity by a microRNA and its APETALA2-Like target genes. Plant Cell 15,2730 -2741.[Abstract/Free Full Text]

Bashirullah, A., Pasquinelli, A. E., Kiger, A. A., Perrimon, N., Ruvkun, G. and Thummel, C. S. (2003). Coordinate regulation of small temporal RNAs at the onset of Drosophila metamorphosis. Dev. Biol. 259,1 -8.[CrossRef][Medline]

Blázquez, M. A., Green, R., Nilsson, O., Sussman, M. R. and Weigel, D. (1998). Gibberellins promote flowering of Arabidopsis by activating the LEAFY promoter. Plant Cell 10,791 -800.[Abstract/Free Full Text]

Blázquez, M. A. and Weigel, D. (2000). Integration of floral inductive signals in Arabidopsis.Nature 404,889 -892.[CrossRef][Medline]

Cercos, M., Gomez-Cadenas, A. and Ho, T. H. D. (1999). Hormonal regulation of a cysteine proteinase gene, EPB-1, in barley aleurone layers: cis- and trans-acting elements involved in the coordinated gene expression regulated by gibberellins and abscisic-acid. Plant J. 19,107 -118.[CrossRef][Medline]

Chandler, P. M., Marion-Poll, A., Ellis, M. and Gubler, F. (2002). Mutants at the Slender1 locus of barley cv Himalaya. Molecular and physiological characterization. Plant Physiol. 129,181 -190.[Abstract/Free Full Text]

Chen, X. (2004). A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 303,2022 -2025.[Abstract/Free Full Text]

Cheng, H., Qin, L., Lee, S., Fu, X., Richards, D. E., Cao, D., Luo, D., Harberd, N. P. and Peng, J. (2004). Gibberellin regulates Arabidopsis floral development via suppression of DELLA protein function. Development 131,1055 -1064.[Abstract/Free Full Text]

Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16,735 -743.[CrossRef][Medline]

Dill, A. and Sun, T.-p. (2001). Synergistic derepression of gibberellin signaling by removing RGA and GAI function in Arabidopsis thaliana. Genetics 159,777 -785.[Abstract/Free Full Text]

Emery, J. F., Floyd, S. K., Alvarez, J., Eshed, Y., Hawker, N. P., Izhaki, A., Baum, S. F. and Bowman, J. L. (2003). Radial patterning of Arabidopsis shoots by class III HD-ZIP and KANADI genes. Curr. Biol. 13,1768 -1774.[CrossRef][Medline]

Fu, X., Richards, D. E., Ait-ali, T., Hynes, L. W., Ougham, H., Peng, J. and Harberd, N. P. (2002). Gibberellin-mediated proteasome-dependent degradation of the barley DELLA protein SLN1 repressor. Plant Cell 14,3191 -3200.[Abstract/Free Full Text]

Fu, X. and Harberd, N. P. (2003). Auxin promotes Arabidopsis root growth by modulating gibberellin response. Nature 421,740 -743.[CrossRef][Medline]

Gocal, G. F. W., Sheldon, C. C., Gubler, F., Moritz, T., Bagnall, D. J., MacMillan, C. P., Li, S. F., Parish, R. W., Dennis, E. S., Weigel, D. and King, R. W. (2001). GAMYB-like genes, flowering, and gibberellin signalling in Arabidopsis. Plant Physiol. 127,1682 -1693.[Abstract/Free Full Text]

Gubler, F., Kalla, R., Roberts, J. K. and Jacobsen, J. V. (1995). Gibberellin-regulated expression of a myb gene in barley aleurone cells: evidence for Myb transactivation of a high-pI alpha-amylase gene promoter. Plant Cell 7,1879 -1891.[Abstract]

Gubler, F., Raventos, D., Keys, M., Watts, R., Mundy, J. and Jacobsen, J. V. (1999). Target genes and regulatory domains of the GAMYB transcriptional activator in cereal aleurone. Plant J. 17,1 -9.[CrossRef][Medline]

Hamilton, A., Voinnet, O., Chappell, L. and Baulcombe, D. (2002). Two classes of short interfering RNA in RNA silencing. EMBO J. 17,4671 -4679.[CrossRef]

Harberd, N. P. (2003). Relieving DELLA restraint. Science 299,1853 -1854.[Abstract/Free Full Text]

Itoh, H., Ueguchi-Tanaka, M., Sato, Y., Ashikari, M. and Matsuoka, M. (2002). The gibberellin signaling pathway is regulated by the appearance and disappearance of SLENDER RICE1 in nuclei. Plant Cell 14,57 -70.[Abstract/Free Full Text]

Kaneko, M., Inukai, Y., Ueguchi-Tanaka, M., Itoh, H., Izawa, T., Kobayashi, Y., Hattori, T., Miyao, A., Hirochika, H., Ashikari, M. and Matsuoka, M. (2004). Loss-of-function mutations of the rice GAMYB gene impair {alpha}-amylase expression in aleurone and flower development. Plant Cell 16, 33-44.[Abstract/Free Full Text]

Kidner, C. A. and Martienssen, R. A. (2003). Macro effects of microRNAs in plants. Trends Genet. 19, 13-16.[CrossRef][Medline]

King, K. E., Moritz, T. and Harberd, N. P. (2001). Gibberellins are not required for normal stem growth in Arabidopsis thaliana in the absence of GAI and RGA. Genetics 159,767 -776.[Abstract/Free Full Text]

Koornneef, M. and van der Veen, J. H. (1980). Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) Heynh. Theor. Appl. Genet. 58,257 -263.[CrossRef]

Koornneef, M., Elgersma, A., Hanhart, C. J., van Loenen-Martinet, E. P., van Rijn, L. and Zeevaart, J. A. D. (1985). A gibberellin insensitive mutant of Arabidopsis thaliana. Physiol. Plant 65,33 -39.

Lee, H., Suh, S. S., Park, E., Cho, E., Ahn, J. H., Kim, S. G., Lee, J. S., Kwon, Y. M. and Lee, I. (2000). The AGAMOUS-LIKE 20 MADS domain protein integrates floral inductive pathways in Arabidopsis. Genes Dev. 14,2366 -2376.[Abstract/Free Full Text]

Llave, C., Xie, Z., Kasschau, K. D. and Carrington, J. C. (2002a). Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 297,2053 -2056.[Abstract/Free Full Text]

Llave, C., Kasschau, K. D., Rector, M. A. and Carrington, J. C. (2002b). Endogenous and silencing-associated small RNAs in plants. Plant Cell 14,1605 -1619.[Abstract/Free Full Text]

McGinnis, K. M., Thomas, S. G., Soule, J. D., Strader, L. C., Zale, J. M., Sun, T.-p. and Steber, C. M. (2003). The Arabidopsis SLEEPY1 gene encodes a putative F-box subunit of an SCF E3 ubiquitin ligase. Plant Cell 15,1120 -1130.[Abstract/Free Full Text]

Moon, J., Suh, S. S., Lee, H., Choi, K. R., Hong, C. B., Paek, N. C., Kim, S. G. and Lee, I. (2003). The SOC1 MADS-box gene integrates vernalization and gibberellin signals for flowering in Arabidopsis. Plant J. 35,613 -623.[CrossRef][Medline]

Mouradov, A., Cremer, F. and Coupland G. (2002). Control of flowering time: Interacting pathways as a basis for diversity. Plant Cell 14,S111 -S130.[Free Full Text]

Murray, F., Kalla, R., Jacobsen, J. V. and Gubler, F. (2003). A role for HvGAMYB in anther development. Plant J. 33,481 -491.[CrossRef][Medline]

Palatnik, J. F., Allen, E., Wu, X., Schommer, C., Schwab, R., Carrington, J. C. and Weigel, D. (2003). Control of leaf morphogenesis by microRNAs. Nature 425,257 -263.[CrossRef][Medline]

Park, W., Li, J., Song, R., Messing, J. and Chen, X. (2002). CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana. Curr. Biol. 12,1484 -1495.[CrossRef][Medline]

Peng, J., Carol, P., Richards, D. E., King, K. E., Cowling, R. J., Murphy, G. P. and Harberd, N. P. (1997). The Arabidopsis GAI gene defines a signalling pathway that negatively regulates gibberellin response. Genes Dev. 11,3194 -3205.[Abstract/Free Full Text]

Peng, J., Richards, D. E., Hartley, N. M., Murphy, G. P., Devos, K. M., Flintham, J. E., Beales, J., Fish, L. J., Worland, A. J., Pelica, F., Sudhakar, D., Christou, P., Snape, J. W., Gale, M. D. and Harberd, N. P. (1999). "Green revolution" genes encode mutant gibberellin response modulators. Nature 400,256 -261.[CrossRef][Medline]

Reinhart, B. J., Weinstein, E. G., Rhoades, M. W., Bartel, B. and Bartel, D. P. (2002). MicroRNAs in plants. Genes Dev. 16,1616 -1626.[Abstract/Free Full Text]

Rhoades, M. W., Reinhart, B. J., Lim, L. P., Burge, C. B., Bartel, B. and Bartel, D. P. (2002). Prediction of plant microRNA targets. Cell 110,513 -520.[CrossRef][Medline]

Richards, D. E., King, K. E., Ait-ali, T. and Harberd, N. P. (2001). How gibberellin regulates plant growth and development: A molecular genetic analysis of gibberellin signalling. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52,67 -88.[CrossRef][Medline]

Sasaki, A., Itoh, H., Gomi, K., Ueguchi-Tanaka, M., Ishiyama, K., Kobayashi, M., Jeong, D. H., An, G., Kitano, H., Ashikari, M. and Matsuoka, M. (2003). Accumulation of phosphorylated repressor for gibberellin signaling in an F-box mutant. Science 299,1896 -1898.[Abstract/Free Full Text]

Simpson, G. G. and Dean, C. (2002). Arabidopsis, the Rosetta stone of flowering time? Science 296,285 -289.[Abstract/Free Full Text]

Wilson, R. N., Heckman, J. W. and Sommerville, C. R. (1992). Gibberellin is required for flowering in Arabidopsis thaliana under short days. Plant Physiol. 100,403 -408.[Abstract/Free Full Text]

Xie, Z., Kasschau, K. D. and Carrington, J. C. (2003). Negative feedback regulation of Dicer-Like1 in Arabidopsis by microRNA-guided mRNA degradation. Curr. Biol. 13,784 -789.[CrossRef][Medline]

Yu, H., Xu, Y., Tan, E. L. and Kumar, P. P. (2002). AGAMOUS-LIKE 24, a dosage-dependent mediator of the flowering signals. Proc. Natl. Acad. Sci. USA 99,16336 -16341.[Abstract/Free Full Text]


Related articles in Development:

As the days draw in

Development 2004 131: e1402. [Full Text]  



This article has been cited by other articles:


Home page
Plant Physiol.Home page
I. M. Ehrenreich and M. D. Purugganan
Sequence Variation of MicroRNAs and Their Binding Sites in Arabidopsis
Plant Physiology, April 1, 2008; 146(4): 1974 - 1982.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. S. Allen, J. Li, M. I. Stahle, A. Dubroue, F. Gubler, and A. A. Millar
From the Cover: Genetic analysis reveals functional redundancy and the major target genes of the Arabidopsis miR159 family
PNAS, October 9, 2007; 104(41): 16371 - 16376.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
J.-H. Jung, Y.-H. Seo, P. J. Seo, J. L. Reyes, J. Yun, N.-H. Chua, and C.-M. Park
The GIGANTEA-Regulated MicroRNA172 Mediates Photoperiodic Flowering Independent of CONSTANS in Arabidopsis
PLANT CELL, September 1, 2007; 19(9): 2736 - 2748.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
D. Weiss and N. Ori
Mechanisms of Cross Talk between Gibberellin and Other Hormones
Plant Physiology, July 1, 2007; 144(3): 1240 - 1246.
[Full Text] [PDF]


Home page
Plant CellHome page
X. M. Xu, A. Rose, S. Muthuswamy, S. Y. Jeong, S. Venkatakrishnan, Q. Zhao, and I. Meier
NUCLEAR PORE ANCHOR, the Arabidopsis Homolog of Tpr/Mlp1/Mlp2/Megator, Is Involved in mRNA Export and SUMO Homeostasis and Affects Diverse Aspects of Plant Development
PLANT CELL, May 1, 2007; 19(5): 1537 - 1548.
[Abstract] [Full Text] [PDF]