|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 28, 2004
doi: 10.1242/10.1242/dev.01229

Department of Neurobiology and Behavior and Center for Developmental Genetics, Stony Brook University, Stony Brook, NY 11794-5230, USA
Author for correspondence (e-mail:
maurice.kernan{at}sunysb.edu)
Accepted 15 April 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Cilia, Flagella, Centrioles, Mechanoreceptors, Spermatogenesis
| Introduction |
|---|
|
|
|---|
Interconversion of centrioles and basal bodies occurs in eukaryotes ranging
from algae to mammals. A centriole may move to the cell periphery and form a
basal body in G1 of interphase, or in quiescent (G0) or differentiating cells
(Rieder and Borisy, 1982
;
Vorobjev and Chentsov, 1982
).
In dividing cells, such basal bodies revert to a centriolar role prior to
mitosis when the cilia are resorbed and centrosomes assemble. In many animal
zygotes, the sperm flagellar basal body recruits maternal pericentriolar
material to form the initial centrosome
(Schatten, 1994
). Centrioles
are conservatively replicated once per cell cycle and segregate so that each
daughter cell inherits an older and a younger centriole
(Kochanski and Borisy, 1990
);
in mammalian somatic cells only the older centriole nucleates a cilium
(Rieder and Borisy, 1982
;
Vorobjev and Chentsov, 1982
).
The older centriole is also distinguished from the younger by distal and
subdistal appendages, by its ability to anchor microtubules, and by its more
stable location in the cell (Piel et al.,
2000
). A newly assembled mammalian centriole matures over two cell
cycles in a stepwise process that includes the acquisition of appendage
structures and component proteins such as ninein
(Piel et al., 2000
),
cenexin/odf2 (Lange and Gull,
1995
; Nakagawa et al.,
2001
) and
-tubulin
(Chang et al., 2003
).
By contrast, centrioles in embryos and most somatic cells of
Drosophila are rudimentary: they are composed of microtubule doublets
rather than triplets, lack most of the specialized accessory structures
characteristic of mature vertebrate centrioles, and do not form primary cilia
(Callaini et al., 1997
;
Gonzalez et al., 1998
). The
only cilia in the fly are found in the peripheral nervous system (PNS) and in
the male germline. In type I sensory neurons, a cilium extends from the more
distal of two basal bodies at the tip of the single sensory process. This
cilium is the probable site of sensory transduction, and is highly modified
for this role in mechanosensory neurons. In mature spermatocytes, two pairs of
centrioles with microtubule triplets migrate to the cell periphery, where
their differentiated distal ends protrude from the cell
(Tates, 1971
) (reviewed by
Fuller, 1993
). During meiosis,
they segregate to the meiotic spindle poles without further replication, so
that a single centriole associates with each postmeiotic haploid nucleus and
becomes the basal body of the spermatid flagellum. At fertilization, the
entire sperm enters the acentrosomal oocyte, where the basal body recruits
maternal components to form the zygotic centrosome
(Callaini and Riparbelli, 1996
;
Callaini et al., 1999
).
Thus, mutations disrupting ciliogenesis in Drosophila are expected
specifically to affect sensory neurons and spermatids. We describe the
uncoordinated (unc) gene product, which appears to be
required to construct normal cilia in these cell types. Previously,
unc mutants were found to be defective in transduction by ciliated
mechanosensory neurons (Eberl et al.,
2000
; Kernan et al.,
1994
). We now show that unc mutant males are also
defective in spermatogenesis: spermatid nuclei are detached from basal bodies
and flagellar axonemes are disrupted. Axonemal defects are also found in the
ciliated endings of mutant sensory neurons. unc encodes a large,
novel, partly coiled-coil protein that is expressed specifically in ciliated
sensory neurons and in male germline cells. Its localization in spermatocytes
suggests an early role in reconfiguring centrioles as basal bodies.
| Materials and methods |
|---|
|
|
|---|
Immunocytochemistry
Flies containing unc-GFP constructs were dissected in
Drosophila Ringers solution
(Ashburner, 1989
), and fixed in
freshly diluted 4% formaldehyde in PBS with 0.3% Triton X-100 (PBST) for 1-2
hours at room temperature. All washes and incubations were carried out in
foil-covered tubes. Tissues were rinsed three times for 1 hour in PBST and
incubated overnight at 4°C in primary antibody solution containing 5%
normal donkey serum. When staining with propidum iodide, 1 mg/ml RNAase A was
included in the antibody solution. Anti-ß-tubulin (E7), which was
obtained from the Developmental Studies Hybridoma Databank, was used at 1:50;
and anti-centrosomin (gift from T. Kaufman, University of Indiana,
Bloomington), at 1:1000. Fluorescently labeled secondary antibodies from
Molecular Probes (Alexafluor) or Jackson Laboratories (Cy5) were used at a
dilution of 1:1000 in PBST with 5% normal donkey serum. Tissues were washed
four times in 3 hours at 25°C, incubated with secondary antibodies
overnight at 4°C, in the dark, washed four times for 1 hour,
counterstained with a dilution of 10 µg/ml propidum iodide (Sigma) and
mounted in 80% glycerol. Images were collected on confocal microscopes (Zeiss
LSM 510 or Leica TCS SP2).
FRAP analysis
Spermatocyte cultures were established as described
(Noguchi and Miller, 2003
).
Adult testes were isolated in Shields and Sangs medium without bicarbonate
(Sigma S8398), transferred to fresh media twice and then to the culture
chamber (LabtekII VWR 62407-294). Glass needles or sharpened fine forceps were
used to dissect open testes and tease spermatocyte cysts onto a coverslip.
Isolated cysts were selected with a Leica TCS SP2 confocal microscope and
focally bleached using the time-lapse command. Centriole-bound UNC-GFP was
bleached with a 15 second pulse on 100% power, sufficient to eliminate most,
or all, of the signal associated with a single centriole. The centriole was
monitored for 30 minutes to 1 hour by collecting z-series spanning
the centriole pair at 1-5 minute intervals.
Electron microscopy
Testes from 2-day-old males and heads and legs from pharate adults were
fixed in 2% glutaraldehyde and 2% formaldehyde in 0.1 M sodium cacodylate, pH
7.4 for 1-2 hours on ice and postfixed in 2% OsO4 for 4 hours on
ice. Tissues were dehydrated through an ethanol series, incubated in two
changes of propylene oxide, and then embedded in Spurr's resin (Polysciences).
Thin sections were post-stained with uranyl acetate and lead citrate before
viewing with a JEM-1200EX electron microscope (80 kV).
Electrophysiology
Transepithelial and mechanoreceptor potentials were recorded as described
(Kernan et al., 1994
).
Sound-evoked potentials were recorded from the antennal nerve as described
(Eberl et al., 2000
).
Molecular biology
X-ray breakpoints were mapped by field inversion gel electrophoresis and
Southern blot hybridization. Cycle sequencing was performed using the ABI Big
Dye cycle sequencing kit. unc gene fragments were amplified for
sequencing from single male flies (Gloor
and Engels, 1992
). The cDNA LP08350 was obtained from the Berkeley
Drosophila Genome Project. Genomic sequence was derived from fragments
subcloned or amplified from whole P1 clones.
The 5' end of the cDNA was extended using an RNA ligase-based RACE
protocol (Chen, 1996
). Total
adult RNA was used as a template for first-strand cDNA using primers
ATCCTGCTCCTCAATCTGATCC and GGAACTTCACCTCGAACTCCTG from the 5' end of the
LP08350 cDNA. The adapter primer was ligated to the 5' end using RNA
ligase and a complementary primer was used in combination with the internal
primer to amplify the 5' end. Products from a second round of RACE,
using 5' primers CGCTCCTGCTTAATCTGCTC and GCTTCGCCCTGAACGATAAC were
cloned using the TopoTM TA cloning kit (Invitrogen).
To construct a P{unc+} transformation vector, the cDNA
LP08350 was digested with SfiI and XhoI and ligated in frame
to a 4.65 kb SfiI fragment which spanned from the beginning of the
third exon of the divergently transcribed CG15445 to the third exon of
unc. The free SfiI end was blunted with T4 DNA polymerase
and ligated into pCasper4 digested with XhoI/HpaI. This and
other transformation constructs were injected into embryos as described
(Rubin and Spradling,
1982
).
To construct the P{unc-GFP} fusion, PCR was used to modify the 5' end of EGFP (Clontech, Palo Alto, CA) by replacing the start codon ATG with a sequence encoding the amino acids GGSRGG and including an XbaI site. After sequencing, the modified EGFP was cloned into a XbaI site at the C terminus of the predicted full-length unc protein. This product was cloned into the original rescue construct.
For in situ hybridization, digoxigenin-labeled sense and antisense probes
were generated by unidirectional PCR. Whole testes were probed in a protocol
based on embryo in situ hybridization
(Tautz and Pfeifle, 1989
).
| Results |
|---|
|
|
|---|
Early events in spermatogenesis, from meiosis to `onion' stage spermatids,
appear normal in unc mutants: uniformly sized spermatid nuclei (data
not shown) indicate that meiotic chromosome segregation occurs normally.
Labeling of DNA and tubulin shows that unc mutant spermatids
elongate, begin nuclear condensation and contain microtubules
(Fig. 1). However, in mutant
elongating spermatid cysts, nuclei are dispersed along the flagellar bundle
(Fig. 1A,B). To determine
whether the dispersed nuclei had separated from the flagella or if intact
spermatids had moved relative to each other, we labeled wild-type and mutant
testes with an antibody to
-tubulin. In wild-type spermatids, this
antibody labels the junction between the nucleus and flagellum
(Wilson et al., 1997
). The
labeled structure is probably the centriole adjunct, a collar that surrounds
the basal body and transforms from a thin sheath to a torus during spermatid
elongation (Tates, 1971
).
Nuclei were frequently separated from centriole adjuncts in mutants,
suggesting that the connection between them is indeed disrupted
(Fig. 1C). Electron microscopy
shows that mutant flagellar axonemes are also defective. Sections of wild-type
cysts show the profile of an axoneme and its associated mitochondrial
derivative in each of the 64 spermatids in a cyst
(Fig. 1D). In unc
mutants the number of axoneme profiles in each cyst is reduced by an average
of 73% (17/64 intact axonemes, n=5). Some of the remaining profiles
appear unaffected, but many show defects ranging from a single break to
complete disruption of the axoneme into its constituent microtubule doublets
(Fig. 1E,F).
|
|
|
Sequence similarity searches indicate that unc is unique in the
D. melanogaster genome; the closest matches are to other coiled-coil
proteins. Homologs of unc are currently found only in dipteran
insects. A predicted unc homolog appears in D. pseudoobscura
(D. pseudoobscura sequencing project;
http://www.hgsc.bcm.tmc.edu/projects/drosophila/),
but shows only 31% amino acid identity with UNC, unusually low for this
closely related species (
50 Mya divergence). The genome of the mosquito
Anopheles (Holt et al.,
2002
), which diverged from Drosophila
240 Mya,
includes an unannotated gene (segment AAAB01008986_326) with limited sequence
similarity to the N-terminal half of UNC (39% identity over 119 amino acids).
Thus, the UNC protein sequence appears to be diverging rapidly, even within
the Diptera. The 120-amino acid region that is most highly conserved between
all three proteins includes a Lissencephaly 1 homology (LisH) domain
(Emes and Ponting, 2001
), a
short
-helical motif present in several microtubule-associated
proteins.
Expression and protein localization
Direct detection of transcripts with an antisense probe showed weak
labeling near the apical end of the testis (data not shown). Transcripts in
the embryonic PNS were not detectable by in situ hybridization, so to
visualize unc transcription the upstream region and promoter from the
rescue construct (Fig. 3B) was
joined to the coding region for enhanced green fluorescent protein (EGFP). In
transgenic flies, this construct labels cells close to but not at the apical
tip of the testis (Fig. 4A),
the location of late gonial cells and early spermatocytes in which most
germline transcription occurs. In embryos
(Fig. 4B,C) the promoter fusion
is expressed in sensory neurons of the PNS, but not in the central nervous
system or non-neuronal tissues. During pupal development, expression was
observed in sensory neurons of imaginal discs
(Fig. 4D,E).
|
|
|
The stability of the UNC-GFP association with centrioles was assessed by fluorescence recovery after photobleaching (FRAP). One of a pair of centrioles in cultured primary or secondary spermatocytes was bleached and the pair was monitored for recovery of GFP fluorescence. Little or no fluorescence recovery was observed in eight experiments, up to an hour after bleaching, indicating that once UNC is bound to centrioles, it does not exchange rapidly between centrioles and cytoplasm.
UNC-GFP localization in maturing and arrested spermatocytes
To specify when UNC-GFP first becomes localized to centrioles in the
germline, we examined its localization in larval testes, which consist mostly
of gonial cells and maturing spermatocytes. Localized UNC-GFP first appears in
early spermatocytes as two pairs of equally labeled dots, which increase in
length as the spermatocytes mature, ultimately migrating to the cell periphery
(Fig. 7A-G). This progression
mirrors that described for spermatocyte centrioles
(Fuller, 1993
;
Tates, 1971
). To confirm the
stage at which UNC was localized, we expressed UNC-GFP in mutants that arrest
spermatogenesis before and during spermatocyte differentiation.
bag-of-marbles (bam) and benign gonial cell
neoplasm (bgcn) mutants accumulate amplifying gonial cells
(Gonczy et al., 1997
). In
these cells (Fig. 7H,I), no
localized UNC-GFP is observed. spermatocyte arrest (sa)
mutants accumulate large spermatocytes that are arrested before the first
meiotic division (Lin et al.,
1996
). UNC-GFP is localized to paired centrioles in sa
mutants, but the labeled area does not increase to the wild-type extent, and
the centrioles do not migrate to the cell periphery
(Fig. 7J,K). Taken together
with the results from wild-type testes, these data indicate that UNC is
produced during gonial cell proliferation and in early spermatocytes, but is
not localized until after centriole duplication in early G2, when it
associates equally with all four centrioles.
|
-tubulin colocalization and centriole length in unc mutants
-Tubulins form part of a ring complex that nucleates and anchors
microtubule minus ends at centrosomes
(Moritz et al., 1998
-tubulin isoform,
Tub23C, localizes to foci at the spindle poles
(Wilson et al., 1997
Tub23C labels v-shaped structures that
enclose and connect the proximal ends of a pair of centrioles. In postmeiotic
spermatids,
Tub23C and UNC-GFP labeling behave similarly, first
condensing to the centriole adjunct
(Wilson et al., 1997
We examined the localization of centrosomin and gamma-tubulin in
unc mutants. Centrosomin labeling was unchanged suggesting that,
consistent with the absence of cytological meiotic defects, the centrosomes in
dividing spermatocytes form and segregate normally. However, the
-tubulin-labeled structures in larval spermatocytes were altered in
mutants: the v-shaped structures were reduced to dots
(Fig. 8B,C). This suggests that
either the centriole pairs themselves or the areas to which
-tubulin
binds are much reduced.
|
-tubulin labeling reflected altered
centriole structure in unc mutants, we examined centriole
ultrastructure in larval spermatocytes. Long, bipartite centrioles
characteristic of spermatocytes (Gonzalez
et al., 1998
-tubulin labeling, these data show that unc mutant centrioles
are defective even before meiosis, although the cellular consequences are not
seen until spermatid elongation.
|
Only spermatocytes and sensory neurons, postmitotic cells that construct
basal bodies and cilia, normally express unc. To investigate if
ectopic UNC expression interferes with mitotic centrioles and centrosomes, we
crossed males carrying UASunc-GFP to females expressing GAL4
in the germline (Tracey et al.,
2000
), to generate embryos containing high levels of UNC-GFP. No
centrosomal GFP localization was observed in syncytial embryos (not shown) or
cellularizing embryos. The resulting larvae were fully viable, indicating that
the early nuclear divisions and later cell divisions had proceeded normally.
Thus, ectopically expressed UNC does not localize to embryonic mitotic
centrioles or interfere with their function.
In sensory neurons, the unc-GFP cDNA produces a basal body GFP
signal similar to that obtained by expression from the native unc
promoter (not shown). GAL4-driven overexpression of UNC-GFP in other tissues
including nerve fibers (not shown), salivary gland, tracheal cells and
epidermal cells illuminates filamentous structures ranging from single fibers
in nerves to elaborate meshworks extending throughout salivary gland cells.
These could be endogenous structures labeled by ectopic UNC-GFP, or artifacts
of UNC-GFP aggregation: similar filaments have been observed to result from
the concentration or overexpression of other coiled-coil proteins (e.g.
septins) (Trimble, 1999
). In
any case, the GFP-labeled filaments have no evident phenotypic effects: flies
overexpressing unc-GFP developed, behaved and reproduced
normally.
| Discussion |
|---|
|
|
|---|
Unc localization and function
unc is expressed only in postmitotic cells that are forming or
will form cilia, and it is localized to centrioles in these cells. The
stability and persistence of UNC-GFP labeling on the centrioles, from early
spermatocytes through meiosis, indicate that it associates more closely with
the centriole than do
-tubulin and centrosomin, which show a more
diffuse and cell cycle-dependent association. However, UNC is probably not an
integral component of the centriole microtubules, as its later redistribution
in maturing spermatids, like that of
-tubulin, appears to reflect the
transformation of an accessory structure, the centriole adjunct, from a sheath
to a doughnut-shaped collar. UNC-GFP is cytoplasmic in dividing gonial cells
or when ectopically expressed in early embryos, while it forms large,
apparently artefactual aggregates when overexpressed in differentiated somatic
cells. Therefore, specific modifications of the centrioles or of UNC itself
must regulate its normal localization in neurons and spermatocytes.
What does UNC do? Centrosome organization and replication, the functions of
centrioles in dividing cells, are not affected in unc mutants:
-tubulin and centrosomin are still recruited to the meiotic
centrosomes, bipolar spindles form and meiosis proceeds normally.
Abnormalities in unc mutants are restricted to axonemal structures,
implying a specific defect in basal body function. Basal bodies are present
and correctly located in mutant sensory neurons, but show ultrastructural
defects and fail to template normal axonemes. Similar defects are caused by
mutations affecting intraflagellar transport (IFT) in Chlamydomonas,
nematodes and mammals (Haycraft et al.,
2001
; Pazour et al.,
2000
). IFT is required for the assembly and maintenance of
flagella and cilia, and involves transport of a protein complex along axonemes
by kinesin II (reviewed by Rosenbaum and
Witman, 2002
). However, UNC is not part of the core IFT mechanism.
IFT particle proteins, unlike UNC, are well-conserved across eukaryotic phyla,
including Drosophila (Han et al.,
2003
). Drosophila IFT complexes are present along sensory
cilia (Han et al., 2003
),
while UNC-GFP appears only at the basal body. Finally, IFT is not needed to
assemble Drosophila sperm flagella: mutants lacking the
Drosophila homolog of the IFT88 protein
(Han et al., 2003
), or with
defects in the kinesin II accessory protein
(Sarpal et al., 2003
) have
defective sensory cilia but normal sperm.
UNC could, however, recruit IFT particles or other axoneme components to
the basal body for export to cilia. Its sequence is consistent with such a
role. The coiled-coil segments that are its main structural motifs are a
common feature of multiprotein complexes, including centrosome and spindle
pole body proteins. The several separate segments in UNC may enable it to
bring together multiple coiled-coil protein partners, while the aggregates
produced by UNC overexpression suggest that it may self-associate. UNC shares
a conserved, partial lissencephaly homology (LisH) motif with a number of
proteins involved in microtubule organization
(Emes and Ponting, 2001
), but
the specific function of this motif is unknown. In humans, the gene mutated in
oral-facial-digital syndrome (OFD1), a probable ciliary disorder,
encodes a protein with a similar arrangement of a LisH domain and coiled-coil
segments, which is localized to centrosomes
(Ferrante et al., 2001
;
Romio et al., 2003
). OFD1 may
therefore have a basal body function similar to that of UNC. However, OFD1
failed to rescue unc mutant sensory defects when expressed from a
transgene in Drosophila sensory neurons (data not shown).
UNC and centriole maturation; a comparison with vertebrates
Centrioles in Drosophila embryos and most somatic cells are
composed of doublet microtubules, lack appendages and do not form cilia
(Gonzalez et al., 1998
). Their
relatively simple structure, and the absence of structural distinctions
between mother and daughter centrioles suggest that they are `neotenous'
i.e. reproduce without undergoing the final stages of maturation
(Callaini et al., 1997
). This
is consistent with the absence of some otherwise conserved centrosomal
proteins from Drosophila and other ecdysozoa. For example,
-
and
-tubulins, which are conserved from mammals to
Chlamydomonas and required for basal body assembly and ciliogenesis
(Dutcher and Trabuco, 1998
;
Chang and Stearns, 2000
;
Dutcher et al., 2002
;
Chang et al., 2003
), are
absent from the sequenced Drosophila, Anopheles and
Caenorhabditis genomes. Ninein and cenexin, proteins that identify
the ciliogenic centriole in mammals
(Mogensen et al., 2000
;
Piel et al., 2000
), are also
absent from Drosophila. However, Drosophila spermatocyte
centrioles are complex, with triplet microtubules and, differentiated distal
segments that are, in effect, short primary cilia
(Gonzalez et al., 1998
). Other
insect spermatocytes have more elongated flagella associated with centrioles
before and during meiosis, a feature that first established the identity of
centrioles with basal bodies (Meves,
1900
). Spermatocyte and sensory neuron centrioles may be the only
centrioles in the fly comparable with mature ciliogenic centrioles in
vertebrates, and UNC may substitute for one or more of the proteins that
distinguish the ciliogenic centriole in other systems.
The cilium on a mammalian monociliated cell forms in G1, specifically on the older of the two centrioles in a cell. By contrast, all four centrioles in Drosophila spermatocytes appear to be equivalent by the time they differentiate: all migrate to the cell periphery and form ciliary extensions. UNC first localizes to spermatocyte centrioles after they have duplicated, and binds equally to all four centrioles. This may reflect a difference between vertebrate and invertebrate ciliogenesis. Alternatively, it may reveal a general uncoupling of centriole duplication and maturation from the cell division cycle in the extended G2 phase that precedes meiosis. In sensory neurons, UNC-GFP is localized to both the proximal and distal basal bodies, both of which are located at the base of the cilium and aligned with its axis. It will be of interest to determine when UNC is first expressed and localized in the neuronal cell lineage.
In summary, UNC is required for ciliogenesis, and its localization is an early marker for the conversion of a mitotic centriole into a ciliogenic basal body. Finding the proteins that interact with UNC to localize it on centrioles and mediate its function will be a key to understanding this remarkable transformation, and how it is regulated during entry into meiosis and neuronal differentiation.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A.,
Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A.,
Galle, R. A. et al. (2000). The genome sequence of Drosophila
melanogaster. Science
287,2185
-2195.
Ansley, S. J., Badano, J. L., Blacque, O. E., Hill, J., Hoskins,
B. E., Leitch, C. C., Kim, J. C., Ross, A. J., Eichers, E. R., Teslovich, T.
M. et al. (2003). Basal body dysfunction is a likely cause of
pleiotropic Bardet-Biedl syndrome. Nature
425,628
-633.[CrossRef][Medline]
Ashburner, M. (1989). Drosophila: A
Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor
Laboratory Press.
Beisson, J. and Wright, M. (2003). Basal
body/centriole assembly and continuity. Curr. Opin. Cell
Biol. 15,96
-104.[CrossRef][Medline]
Bornens, M. (2002). Centrosome composition and
microtubule anchoring mechanisms. Curr. Opin. Cell
Biol. 14,25
-34.[CrossRef][Medline]
Brand, A. and Dormand, E. (1995). The GAL4
system as a tool for unravelling the mysteries of the Drosophila nervous
system. Curr. Opin. Neurobiol.
5, 572-578.[CrossRef][Medline]
Callaini, G. and Riparbelli, M. G. (1996).
Fertilization in Drosophila melanogaster: centrosome inheritance and
organization of the first mitotic spindle. Dev. Biol.
176,199
-208.[CrossRef][Medline]
Callaini, G., Whitfield, W. G. and Riparbelli, M. G.
(1997). Centriole and centrosome dynamics during the embryonic
cell cycles that follow the formation of the cellular blastoderm in
Drosophila. Exp. Cell Res.
234,183
-190.[CrossRef][Medline]
Callaini, G., Riparbelli, M. G. and Dallai, R.
(1999). Centrosome inheritance in insects: fertilization and
parthenogenesis. Biol. Cell
91,355
-366.[CrossRef][Medline]
Carvalho, A. B., Lazzaro, B. P. and Clark, A. G.
(2000). Y chromosomal fertility factors kl-2 and kl-3 of
Drosophila melanogaster encode dynein heavy chain polypeptides.
Proc. Natl. Acad. Sci. USA
97,13239
-13244.
Chang, P., Giddings, T. H., Jr, Winey, M. and Stearns, T.
(2003). Epsilon-tubulin is required for centriole duplication and
microtubule organization. Nat. Cell Biol.
5, 71-76.[CrossRef][Medline]
Chang, P. and Stearns, T. (2000). Delta-tubulin
and epsilon-tubulin: two new human centrosomal tubulins reveal new aspects of
centrosome structure and function. Nat. Cell Biol.
2, 30-35.[CrossRef][Medline]
Chen, Z. (1996). Simple modifications to
increase specificity of the 5' RACE procedure. Trends
Genet. 12,87
-88.[CrossRef][Medline]
Doxsey, S. (2001). Re-evaluating centrosome
function. Nat. Rev. Mol. Cell Biol.
2, 688-698.[CrossRef][Medline]
Dubruille, R., Laurencon, A., Vandaele, C., Shishido, E.,
Coulon-Bublex, M., Swoboda, P., Couble, P., Kernan, M. and Durand, B.
(2002). Drosophila regulatory factor X is necessary for ciliated
sensory neuron differentiation. Development
129,5487
-5498.
Dutcher, S. K., Morrissette, N. S., Preble, A. M., Rackley, C.
and Stanga, J. (2002). epsilon-tubulin is an essential
component of the centriole. Mol. Biol. Cell
13,3859
-3869.
Dutcher, S. K. and Trabuco, E. C. (1998). The
UNI3 gene is required for assembly of basal bodies of Chlamydomonas and
encodes delta-tubulin, a new member of the tubulin superfamily.
Mol. Biol. Cell 9,1293
-1308.
Eberl, D., Hardy, R. and Kernan, M. (2000).
Genetically similar transduction mechanisms for touch and hearing in
Drosophila. J. Neurosci.
20,5981
-5988.
Emes, R. D. and Ponting, C. P. (2001). A new
sequence motif linking lissencephaly, Treacher Collins and oral-facial-digital
type 1 syndromes, microtubule dynamics and cell migration. Hum.
Mol. Genet. 10,2813
-2820.
Ferrante, M. I., Giorgio, G., Feather, S. A., Bulfone, A.,
Wright, V., Ghiani, M., Selicorni, A., Gammaro, L., Scolari, F., Woolf, A. S.
et al. (2001). Identification of the gene for
oral-facial-digital type I syndrome. Am. J. Hum.
Genet. 68,569
-576.[CrossRef][Medline]
Fuller, M. (1993). Spermatogenesis. InThe Development of Drosophila melanogaster
, Vol.2
(ed. M. Bate and A. Martinez Arias), pp.71
-147. New York: Cold Spring Harbor Laboratory
Press.
Gloor, G. and Engels, W. (1992). Single-fly DNA
preps for PCR. Drosophila Information Service.
71,148
-149.
Gonczy, P., Matunis, E. and DiNardo, S. (1997).
bag-of-marbles and benign gonial cell neoplasm act in the germline to restrict
proliferation during Drosophila spermatogenesis.
Development 124,4361
-4371.[Abstract]
Gonzalez, C., Tavosanis, G. and Mollinari, C.
(1998). Centrosomes and microtubule organisation during
Drosophila development. J. Cell Sci.
111,2697
-2706.[Abstract]
Han, Y.-G., Kwok, B. H. and Kernan, M. J.
(2003). Intraflagellar transport is required in Drosophila to
differentiate sensory cilia but not sperm. Curr. Biol.
13,1679
-1686.[CrossRef][Medline]
Haycraft, C. J., Swoboda, P., Taulman, P. D., Thomas, J. H. and
Yoder, B. K. (2001). The C. elegans homolog of the murine
cystic kidney disease gene Tg737 functions in a ciliogenic pathway and is
disrupted in osm-5 mutant worms. Development
128,1493
-1505.[Abstract]
Healy, M. J., Russell, R. J. and Miklos, G.
(1988). Molecular studies on interspersed repetitive and unique
sequences in the region of the complementation group uncoordinated on the X
chromosome of Drosophila melanogaster. Mol. Gen.
Genet. 213,63
-71.[CrossRef][Medline]
Holt, R. A., Subramanian, G. M., Halpern, A., Sutton, G. G.,
Charlab, R., Nusskern, D. R., Wincker, P., Clark, A. G., Ribeiro, J. M.,
Wides, R. et al. (2002). The genome sequence of the malaria
mosquito Anopheles gambiae. Science
298,129
-149.
Kernan, M., Cowan, D. and Zuker, C. (1994).
Genetic dissection of mechanosensory transduction: mechanoreception-defective
mutations of Drosophila. Neuron
12,1195
-1206.[CrossRef][Medline]
Kochanski, R. and Borisy, G. (1990). Mode of
centriole duplication and distribution. J. Cell Biol.
110,1599
-1605.
Kurek, R., Reugels, A. M., Glatzer, K. H. and Bunemann, H.
(1998). The Y chromosomal fertility factor Threads in Drosophila
hydei harbors a functional gene encoding an axonemal dynein beta heavy chain
protein. Genetics 149,1363
-1376.
Lange, B. and Gull, K. (1995). A molecular
marker for centriole maturation in the mammalian cell cycle. J.
Cell Biol. 130,919
-927.
Lange, B. M., Faragher, A. J., March, P. and Gull, K.
(2000). Centriole duplication and maturation in animal cells.
Curr. Top. Dev. Biol.
49,235
-249.[Medline]
Lee, T. and Luo, L. (1999). Mosaic analysis
with a repressible cell marker for studies of gene function in neuronal
morphogenesis. Neuron
22,451
-461.[CrossRef][Medline]
Li, K. and Kaufman, T. C. (1996). The homeotic
target gene centrosomin encodes an essential centrosomal component.
Cell 85,585
-596.[CrossRef][Medline]
Li, K., Xu, E. Y., Cecil, J. K., Turner, F. R., Megraw, T. L.
and Kaufman, T. C. (1998). Drosophila centrosomin protein is
required for male meiosis and assembly of the flagellar axoneme. J.
Cell Biol. 141,455
-467.
Lin, T. Y., Viswanathan, S., Wood, C., Wilson, P. G., Wolf, N.
and Fuller, M. T. (1996). Coordinate developmental control of
the meiotic cell cycle and spermatid differentiation in Drosophila males.
Development 122,1331
-1341.[Abstract]
Lindsley, D. and Tokuyasu, K. T. (1980).
Spermatogenesis. In Genetics and Biology of Drosophila
(ed. M. Ashburner and T. R. Wright), pp. 225-294. New
York: Academic Press.
Liu, X., Vansant, G., Udovichenko, I. P., Wolfrum, U. and
Williams, D. S. (1997). Myosin VIIa, the product of the Usher
1B syndrome gene, is concentrated in the connecting cilia of photoreceptor
cells. Cell Motil. Cytoskel.
37,240
-252.[CrossRef][Medline]
Lupas, A., van Dyke, M. and Stock, J. (1991).
Predicting coiled coils from protein sequences.
Science 252,1162
-1164.
Marshall, W. F. and Rosenbaum, J. L. (2000).
How centrioles work: lessons from green yeast. Curr. Opin. Cell
Biol. 12,119
-125.[CrossRef][Medline]
Meves, F. (1900). Ueber den von la Valette St.
George entdecktden Nebenkern (Mitochondrionkörper) deer Samenzellen.
Archiv für mikroskopische Anatomie und
Entwicklungsgeschichte 56,553
-606.
Mogensen, M. M., Malik, A., Piel, M., Bouckson-Castaing, V. and
Bornens, M. (2000). Microtubule minus-end anchorage at
centrosomal and non-centrosomal sites: the role of ninein. J. Cell
Sci. 113,3013
-3023.[Abstract]
Moritz, M., Zheng, Y., Alberts, B. M. and Oegema, K.
(1998). Recruitment of the gamma-tubulin ring complex to
Drosophila salt-stripped centrosome scaffolds. J. Cell
Biol. 142,775
-786.
Nakagawa, Y., Yamane, Y., Okanoue, T. and Tsukita, S.
(2001). Outer dense fiber 2 is a widespread centrosome scaffold
component preferentially associated with mother centrioles: its identification
from isolated centrosomes. Mol. Biol. Cell
12,1687
-1697.
Noguchi, T. and Miller, K. G. (2003). A role
for actin dynamics in individualization during spermatogenesis in
Drosophila melanogaster. Development
130,1805
-1816.
Pazour, G. J. and Witman, G. B. (2003). The
vertebrate primary cilium is a sensory organelle. Curr. Opin. Cell
Biol. 15,105
-110.[CrossRef][Medline]
Pazour, G. J., Dickert, B. L., Vucica, Y., Seeley, E. S.,
Rosenbaum, J. L., Witman, G. B. and Cole, D. G. (2000).
Chlamydomonas IFT88 and its mouse homologue, polycystic kidney disease gene
Tg737, are required for assembly of cilia and flagella. J. Cell
Biol. 151,709
-718.
Piel, M., Meyer, P., Khodjakov, A., Rieder, C. L. and Bornens,
M. (2000). The respective contributions of the mother and
daughter centrioles to centrosome activity and behavior in vertebrate cells.
J. Cell Biol. 149,317
-330.
Rieder, C. and Borisy, G. (1982). The
centrosome cycle in PtK2 cells: asymmetric distribution and structural changes
in the pericentriolar materiel. Biol. Cell.
44,117
-132.
Romio, L., Wright, V., Price, K., Winyard, P. J., Donnai, D.,
Porteous, M. E., Franco, B., Giorgio, G., Malcolm, S., Woolf, A. S. et al.
(2003). OFD1, the gene mutated in oral-facial-digital syndrome
type 1, is expressed in the metanephros and in human embryonic renal
mesenchymal cells. J. Am. Soc. Nephrol.
14,680
-689.
Rosenbaum, J. L., Cole, D. G. and Diener, D. R.
(1999). Intraflagellar transport: the eyes have it. J.
Cell Biol. 144,385
-388.
Rosenbaum, J. L. and Witman, G. B. (2002).
Intraflagellar transport. Nat. Rev. Mol. Cell Biol.
3, 813-825.[CrossRef][Medline]
Rubin, G. M. and Spradling, A. C. (1982).
Genetic transformation of Drosophila with transposable element vectors.
Science 218,348
-353.
Sarpal, R., Todi, S. V., Sivan-Loukianova, E., Shirolikar, S.,
Subramanian, N., Raff, E. C., Erickson, J. W., Ray, K. and Eberl, D. F.
(2003). Drosophila KAP interacts with the kinesin II motor
subunit KLP64D to assemble chordotonal sensory cilia, but not sperm tails.
Curr. Biol. 13,1687
-1696.[CrossRef][Medline]
Schatten, G. (1994). The centrosome and its
mode of inheritance: the reduction of the centrosome during gametogenesis and
its restoration during fertilization. Dev. Biol.
165,299
-335.[CrossRef][Medline]
Tates, A. (1971).Cytodifferentiation during Spermatogenesis in
Drosophila
. Leiden: Rijksuniversiteit.
Tautz, D. and Pfeifle, C. (1989). A
non-radioactive in situ hybridization method for the localization of specific
RNAs in Drosophila embryos reveals translational control of the segmentation
gene hunchback. Chromosoma
98, 81-85.[CrossRef][Medline]
Tracey, W. D., Jr, Ning, X., Klingler, M., Kramer, S. G. and
Gergen, J. P. (2000). Quantitative analysis of gene function
in the Drosophila embryo. Genetics
154,273
-284.
Trimble, W. S. (1999). Septins: a highly
conserved family of membrane-associated GTPases with functions in cell
division and beyond. J. Membr. Biol.
169, 75-81.[CrossRef][Medline]
Vorobjev, I. and Chentsov, Y. (1982).
Centrioles in the cell cycle. I. Epithelial cells. J. Cell
Biol. 98,938
-949.
Wilson, P. G., Zheng, Y., Oakley, C. E., Oakley, B. R., Borisy,
G. G. and Fuller, M. T. (1997). Differential expression of
two gamma-tubulin isoforms during gametogenesis and development in Drosophila.
Dev. Biol. 184,207
-221.[CrossRef][Medline]
Yoder, B. K., Hou, X. and Guay-Woodford, L. M.
(2002). The polycystic kidney disease proteins, polycystin-1,
polycystin-2, polaris, and cystin, are co-localized in renal cilia.
J. Am. Soc. Nephrol. 13,2508
-2516.
Zhang, P. and Stankiewicz, R. L. (1998).
Y-Linked male sterile mutations induced by P element in Drosophila
melanogaster. Genetics
150,735
-744.
This article has been cited by other articles:
![]() |
A. Wainman, J. Creque, B. Williams, E. V. Williams, S. Bonaccorsi, M. Gatti, and M. L. Goldberg Roles of the Drosophila NudE protein in kinetochore function and centrosome migration J. Cell Sci., June 1, 2009; 122(11): 1747 - 1758. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Mottier-Pavie and T. L. Megraw Drosophila Bld10 Is a Centriolar Protein That Regulates Centriole, Basal Body, and Motile Cilium Assembly Mol. Biol. Cell, May 15, 2009; 20(10): 2605 - 2614. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Blachon, X. Cai, K. A. Roberts, K. Yang, A. Polyanovsky, A. Church, and T. Avidor-Reiss A Proximal Centriole-Like Structure Is Present in Drosophila Spermatids and Can Serve as a Model to Study Centriole Duplication Genetics, May 1, 2009; 182(1): 133 - 144. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Texada, R. A. Simonette, C. B. Johnson, W. J. Deery, and K. M. Beckingham yuri gagarin is required for actin, tubulin and basal body functions in Drosophila spermatogenesis J. Cell Sci., June 1, 2008; 121(11): 1926 - 1936. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-C. Wei, J. Rollins, L. Fabian, M. Hayes, G. Polevoy, C. Bazinet, and J. A. Brill Depletion of plasma membrane PtdIns(4,5)P2 reveals essential roles for phosphoinositides in flagellar biogenesis J. Cell Sci., April 1, 2008; 121(7): 1076 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Haines and K. D. Irvine Functional analysis of Drosophila {beta}1,4-N-acetlygalactosaminyltransferases Glycobiology, April 1, 2005; 15(4): 335 - 346. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||