|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 30 June 2004
doi: 10.1242/dev.01239
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Cell Biology, Duke University, Durham, NC 27710, USA
2 Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle,
WA 98109, USA
3 Department of Molecular Biology and Pharmacology, Washington University
Medical School, St Louis, MO 63110, USA
* Author for correspondence (e-mail: b.capel{at}cellbio.duke.edu)
Accepted 14 April 2004
| SUMMARY |
|---|
|
|
|---|
Key words: FGF, Sex determination, Sertoli cell, Sry, Gonad, Testes
| Introduction |
|---|
|
|
|---|
The direct targets of Sry are not known. However, Sry
expression is restricted to the lineage of a single cell type, the Sertoli
cell (Albrecht and Eicher,
2001
; Lovell-Badge et al.,
2002
). Sry acts through the Sertoli cell population to
determine the sex of the gonad. Studies in XY
XX chimeras indicate that
if a threshold number of Sertoli cells is present, they can recruit all other
cells in the gonad (XX or XY) to the testis pathway
(Burgoyne and Palmer, 1993
).
Thus, logical targets of Sry include intracellular factors that
influence the development of Sertoli cells, and secreted signaling factors
that exert a paracrine influence on the surrounding cells. However, most
studies of signaling molecules in the testis have focused on juvenile
development and adult functions of the testis, such as spermatogenesis and the
regulation of hormone production (reviewed by
Lamb, 1993
;
Yan et al., 1998
;
Chamindrani Mendis-Handagama and Siril
Ariyaratne, 2001
). Very little information is available regarding
the expression and function of growth factors within the gonad during stages
of early development and sex determination.
Recently, members of three signaling pathways have been identified that
play a role in early testis formation: platelet-derived growth factor receptor
alpha (Pdgfra) (Brennan et al.,
2003
), Desert hedgehog (Dhh)
(Yao et al., 2002
) and the
insulin growth factor receptors (Nef et
al., 2003
). XY mice homozygous for deletions of Pdgfra or
Dhh exhibit abnormalities in the structural development of the testis
and in the differentiation of the steroid cell lineage (Leydig cells), but
they do not show primary defects in Sertoli cell differentiation, and they are
not sex reversed. Thus, although Pdgfra and Dhh are
necessary for aspects of testis development, they are not crucial for Sertoli
cell differentiation and the primary commitment to the testis fate. Triple
mutants of three insulin growth factor receptors (Ir, Igf1r, Irr),
show male to female sex reversal. Sry levels are reduced and male
development is not established; however, the primary role of insulin growth
factor signaling in testis development is not yet clear.
We have previously shown that >80% of XY mice with homozygous deletions
of fibroblast growth factor 9 (Fgf9) do not express Sertoli cell
markers, such as Sox9 and Amh and fail to develop testis
cord structures. As a consequence, most Fgf9-/- XY mice
develop as sex-reversed females (Colvin et
al., 2001a
). However, although Fgf9 was known to be
essential for testis development, the function of this growth factor, the cell
types responsive to it, and the stages at which it was acting were not known.
In this study, we show that Fgf9 acts downstream of Sry and
the initiation of male development, and is essential for two events in early
testis development: (1) the upregulation of proliferation in a population that
contains Sertoli cell precursors, and (2) the localization of an FGF receptor
(FGFR2) in the nucleus of differentiating Sertoli cells. These events coincide
with the earliest stages of sex determination, between 11.0 and 11.2 dpc,
suggesting that they play a crucial role in this process. In fact, the nuclear
localization of FGFR2 overlaps with Sry expression in Sertoli cells
and colocalizes with the first known marker of male development downstream of
Sry, SOX9. Although growth factor receptors have been seen in the
nuclei of cultured cells (reviewed by
Goldfarb, 2001
;
Wells and Marti, 2002
), this
is the first biologically relevant instance where the nuclear localization of
these receptors is associated with the specification/differentiation of a
specific cell type in a developing organ.
| Materials and methods |
|---|
|
|
|---|
Immunofluorescence
Gonads were dissected from staged embryos and fixed in 4% paraformaldehyde.
We could detect no difference between Fgf9+/+ and
Fgf9+/- gonads. Therefore, these samples were pooled and
all littermate controls were labeled Fgf9+/-, but may be
either. Immunofluorescent staining used protocols previously described
(Schmahl et al., 2000
). The
basal lamina surrounding testis cords and beneath the coelomic epithelium was
detected using a 1:250 dilution of a rabbit polyclonal antibody against
laminin, kindly provided by Harold Erickson. Cell types in the gonad were
detected using 1:250 dilutions of a rat IgG antibody against PECAM (Pharmingen
01951D), and rabbit polyclonal antibodies against SF1 (kindly provided by
Ken-ichirou Morohashi) or WT1 (Santa Cruz Biotechnology C-19). FGFR1, FGFR2,
FGFR3 and FGFR4 were detected using rabbit polyclonal antibodies from Santa
Cruz Biotechnology (sc-121 C-15, sc-122 C-17, sc-123 C-15 and sc-7590 M20,
respectively). These antibodies were raised to peptides mapping at the C
terminus of these receptors (residues 808-822 of human FGFR1, 805-821 of human
FGFR2, 792-806 of human FGFR3) and have been tested by immunoprecipitation and
western blotting by Santa Cruz. We have also tested the specificity of the
antibody against FGFR2 (see Fig. S1 at
http://dev.biologists.org/supplemental).
Appropriate secondary antibodies were obtained from Jackson Immunologicals.
Most antibodies were used on whole gonads, except those against FGFR1, FGFR3
and FGFR4, which did not completely permeate whole tissue and worked best on
cryosections. In these samples, gonads were fixed as above, then embedded in
3:1 OCT:20% sucrose and sectioned at 10 µm. Samples were mounted for
confocal imaging as described by Karl and Capel
(Karl and Capel, 1998
). Images
were collected using a Zeiss LSM 410 confocal microscope and processed using
Adobe Photoshop.
SOX9 was detected using a 1:200 dilution of a rabbit polyclonal antibody
(kindly provided by Peter Koopman). Both SOX9 and FGFR2 were raised in
rabbits. Therefore, SOX9 and FGFR2 double labeling was detected using the
double labeling protocol described by Albrecht and Eicher
(Albrecht and Eicher, 2001
).
Controls samples with either secondary antibody omitted showed no
crossreactivity with the inappropriate secondary antibody. Additionally, XX
gonads (which do not express Sox9 at 12.5 dpc), showed only FGFR
localization using this protocol, indicating that the overlap of SOX9 and
FGFR2 labeling seen in XY samples is due to the colocalization of the
proteins, not to crossreactivity of the two secondary antibodies.
To detect Sry expression, transgenic mice containing a EGFP
reporter driven by a 7762 bp 5' flanking region of the Sry gene
were obtained from Eva Eicher (Albrecht and
Eicher, 2001
). Homozygous individuals were mated to ensure that
the reporter was detectable by autofluorescence. Mice were typed by PCR as
described previously Albrecht and Eicher
(Albrecht and Eicher,
2001
).
Detection of proliferating cells
BrdU was used to detect proliferating cells as previously described
(Schmahl et al., 2000
). To
determine if FGF9 induced proliferation in culture, XX and XY gonads were
dissected between 11.0 and 11.5 and cultured for 2 hours in culture media (10%
FCS, 50 µg/ml ampicillin and 5% CO2 in DMEM) containing 10 µM
BrdU, with or without 50 ng/ml FGF9 (15 nM, R&D systems #273-F9). After
induction with FGF9, gonads were rinsed three times for 15 minutes in culture
media, and cultured for 12 hours in shallow grooves on agar blocks as
previously described (Martineau et al.,
1997
), then fixed in 4% paraformaldehyde at 4°C overnight.
In situ FGF9 binding assay
Embryonic gonads (11.5 dpc) were embedded in sucrose/OCT and cryosectioned
at 12 µm. Sections were dried, then fixed in 4% paraformaldehyde for 30
minutes on ice. Before incubation with human FGF9, sections were blocked in
10% fetal calf serum in PBS for 1 hour. Sections were incubated in incubation
solution (0.7 µg/ml human FGF9 and 1% fetal calf serum in PBS) for 1 hour
at room temperature followed by the three washes for 30 minute each in PBS.
For the heparinase assay, heparinase I and III (Sigma) were added at 1 U/ml to
the sections, incubated for 1 hour at 37°C, and the enzyme-treated
sections were tested for human FGF9 binding. Sections were then blocked using
an M.O.M. kit (Vector Laboratories) and bound human FGF9 was detected with
1:50 mouse monoclonal anti-human FGF9 antibody (R&D systems) and
FITC-conjugated anti-mouse antibody (Jackson ImmunoResearch Laboratories). The
anti-human FGF9 antibody did not detect endogenous mouse FGF9 in control
sections.
In situ hybridization and FGF induction
To detect Fgf9 expression, gonads were fixed and processed for in
situ hybridization as previously described
(Henrique et al., 1995
), using
probes described in Colvin et al. (Colvin
et al., 1999
). At 11.5 dpc, Fgf9 could only be detected
in gonads that had first been cryosectioned (see above protocol). To determine
if FGF9 induces male-specific genes, gonads were cultured in culture media
with or without 50 ng/ml FGF9 for 36 hours in shallow grooves on agar blocks
as previously described (Martineau et al.,
1997
), fixed in 4% paraformaldehyde and processed for in situ
hybridization or immunofluorescence. In situ probes used were Amh, Sox9,
Scc and Dhh, kindly provided by Robin Lovell-Badge, Peter
Koopman, Keith Parker and Andy McMahon, respectively.
Reverse transcriptase-polymerase chain reaction (RTPCR)
Total RNA was isolated from embryonic gonad tissues, which were dissected
free of the mesonephros, using Trizol reagent as instructed by manufacturer
(GIBCO BRL). The sample was amplified using SuperScriptTM One-Step RT-PCR
system (Invitrogen) using one cycle of 45°C for 15 minutes, followed by
one cycle of 94°C for 2 minutes and 32 cycles of 94°C for 30 seconds,
50°C for 30 seconds and 72°C for 1 minute. The primer pairs for
Fgf9 and Hprt are 5'AGGCAGCTGTACTGCAGGAC3' and
5'TAGTTCAGGTACTTGTCAGG3' and
5'CCTGCTGGATTACATTAAAGCACTG3' and
5'GTCAAGGGCATATCCAACAACAAAC3', respectively. Reaction products
were resolved alongside a 100 bp DNA ladder on a 2% agarose gel.
| Results |
|---|
|
|
|---|
15% of
samples, to the complete absence of testis-specific markers
(Colvin et al., 2001a
|
Proliferation is reduced in Fgf9-/- XY gonads before cord formation
Abnormalities in testis formation were observed in
Fgf9-/- XY gonads by 12.5 dpc
(Colvin et al., 2001a
).
However, the sexual fate of the gonad is determined earlier. Although XY and
XX gonads are still morphologically identical at 11.5 dpc, Sry
reaches its peak expression level and initiates the process of testis
determination in the XY gonad by this stage
(Hacker et al., 1995
). The
earliest known morphological change induced by Sry in the XY gonad is
an increase in proliferation at the surface of the gonad
(Schmahl et al., 2000
).
Previous experiments have shown that early stages of proliferation are
necessary for cord formation and the expression of male-specific markers
(Schmahl and Capel, 2003
). As
FGF9 is known to be mitogenic for a variety of cell types and is expressed
near proliferating zones in many systems
(Colvin et al., 1999
), we
examined proliferation in Fgf9-/- XY gonads at early
stages of sex determination. For accurate staging during early periods of
gonad development, tail somites (ts) were counted.
Using BrdU to label dividing cells, we found that proliferation was reduced
in Fgf9-/- XY gonads as early as 11.2 dpc (14-15 ts;
Fig. 2A,D). This stage occurs
before any other known morphological differences between XY and XX gonads,
during a period that proliferation blocking experiments have shown to be
crucial for Sertoli cell differentiation
(Schmahl and Capel, 2003
). By
11.5 dpc (18 ts), a male-specific increase in proliferation is normally
visible in cells at or near the surface of the XY gonad, in the coelomic
epithelium (Fig. 2B,C)
(Schmahl et al., 2000
).
However, proliferation throughout the Fgf9-/- XY gonad
remained at a low level at this stage (Fig.
2E,F), and was roughly equivalent to proliferation in the XX gonad
(Fig. 2H,I).
|
|
Fgf9 and all four FGF receptors are expressed in both XX and XY gonads, but FGFR2 has a sexually dimorphic expression pattern
The gonad phenotype of Fgf9-/- embryos is sex specific.
However, using both in situ hybridization
(Fig. 4A) and RTPCR
(Fig. 4B), Fgf9
transcripts were detected within both XY and XX gonads at 11.5 dpc, as well as
within the mesonephric duct and tubules of the adjacent mesonephroi of both
sexes, indicating that the sex-specific phenotype is not determined by
sex-specific expression of Fgf9 at this stage. Later in testis
development (12.5 dpc), Fgf9 expression is downregulated in the XX
gonad and restricted to the testis cords of the XY gonad.
|
|
|
Components of the extracellular matrix (ECM), specifically heparin sulfate
proteoglycans (HSPG), act as low-affinity receptors for FGFs and are required
to efficiently activate FGFRs (Rapraeger
et al., 1991
; Yayon et al.,
1991
; Lin et al.,
1999
). Patterns of HSPG expression and modification have been
shown to lead to cell- and tissue-specific effects of FGFs during development
(Chang et al., 2000
;
Allen et al., 2001
;
Friedl et al., 2001
;
Ford-Perriss et al., 2002
;
Jenniskens et al., 2002
;
Habuchi et al., 2003
). To
determine if sex-specific differences in the HSPGs are responsible for the
sex-specific requirement of FGF9 for proliferation in the XY gonad, we
preformed in situ binding assays
(Rapraeger, 2002
) on gonad
sections. In these assays, purified human FGF9 was added to sections of XX and
XY gonads, and bound human FGF9 was detected with an antibody specific to the
human protein. In the XY gonad, human FGF9 accumulated on both somatic and
germ cells, particularly on cells near the coelomic surface of the gonad
(Fig. 6B). In the XX gonad,
human FGF9 showed reduced binding to cells throughout the section
(Fig. 6A), and bound at levels
only slightly higher than the untreated controls. Pre-treatment of XY gonad
sections with heparatinase abolished the XY-specific binding of human FGF9
(Fig. 6C), indicating that
male-specific heparan sulfates at the cell surface and/or within the ECM lead
to differential binding of human FGF9 in XY and XX gonads. Interestingly,
induction of cultured gonads with 50 ng/ml FGF9 in the presence of BrdU
revealed that exogenous FGF9 induces proliferation in XX gonads
(Fig. 6F, arrows), suggesting
that the ECM mediated sensitivity can be overcome with increased
concentrations of FGF9.
|
|
Nuclear localization of FGFR2 is dependant on both Fgf9 and components of the male pathway
To determine if the nuclear localization of FGFR2 is dependant on
Fgf9, we examined the pattern of this receptor in
Fgf9-/- XY gonads. Nuclear FGFR2 was not observed in
Fgf9-/- XY gonads (Fig.
8C). Instead, this receptor showed cytoplasmic and membrane
localization in somatic cells throughout the Fgf9-/- XY
gonad, in a pattern resembling the XX gonad
(Fig. 8B). We conclude that the
nuclear localization of FGFR2 is dependent on Fgf9. However, even
though both Fgf9 and FGFR2 are expressed in XX gonads, FGFR2 is not
transported to the nucleus in XX cells, indicating that other components of
the male pathway are essential for the nuclear localization of this
receptor.
It is possible that levels of active FGF9 protein are not high enough in XX gonads to trigger nuclear localization of FGFR2. To determine if exogenous FGF9 could induce the nuclear localization of FGFR2 in the XX gonad independent of Sry, we cultured early (11.2-11.5 dpc) gonads with 50 ng/ml FGF9 protein for 36 hours. Nuclear FGFR2 was observed in the testis cords of cultured XY gonads (Fig. 8E), recapitulating the in vivo pattern of this receptor. However, FGF9 did not induce the nuclear localization of FGFR2 in cultured XX gonads (Fig. 8G), nor did it induce a greater number of XY cells to localize FGFR2 to the nucleus (data not shown). Thus, Fgf9 is necessary but not sufficient to direct FGFR2 to the nucleus. Additional components of the male pathway, specific to Sertoli cell precursors, are required for the nuclear localization of FGFR2. Consistent with the inability to induce nuclear FGFR2, FGF9 also did not induce the expression of other markers of Sertoli differentiation (Sox9, Amh and Dhh; Fig. 8H). However, FGF9 did induce the expression of a male specific gene normally found in the interstitium of the testis, P450 side chain cleavage enzyme (Scc; Cyp11a1 - Mouse Genome Informatics). This gene is a marker of differentiating Leydig cells, the hormone-producing cells of the testis. Leydig cell development occurs after Sertoli cell differentiation, and signals from Sertoli cells have been proposed to control the number and differentiation of Leydig cells. Thus, FGF9 may have a role in this process later in testis organogenesis, after its expression becomes sex specific.
| Discussion |
|---|
|
|
|---|
Fgf9 is necessary for male-specific proliferation
A rapid increase in proliferation in the XY gonad is observed before 11.5
dpc, and is the earliest known morphological difference between XY and XX
gonads downstream of Sry (Schmahl
et al., 2000
). This male-specific proliferation is concentrated at
the surface of the gonad, within and just under the coelomic epithelium, in a
population of cells that give rise to Sertoli progenitors
(Karl and Capel, 1998
). In
this study, we show that proliferation at the coelomic epithelium of XY gonads
is reduced very early in the development of Fgf9-/-
mutants (by 11.2 dpc), In addition, we show that exogenous FGF9 induces
proliferation in these cells in cultured gonads. Interestingly, both
Fgf9-/- XX and XY gonads maintained normal levels of
growth prior to 11.0 dpc, and were equal in size to wild-type XX gonads by
12.5 dpc. Thus, despite the fact that Fgf9 and all four FGF receptors
are expressed in both XX and XY gonads, proliferation and gonad size are
affected only in Fgf9-/- XY gonads. These results indicate
that Fgf9 is not necessary for all cell division in the gonad;
instead, it is necessary specifically for the male increase in growth and
proliferation initiated by Sry.
It has been proposed that a threshold number of Sertoli cells is necessary
to recruit the other cells in the gonad to the testis pathway
(Burgoyne and Palmer, 1993
). In
fact, it has been shown that blocking proliferation at a specific period of
early gonad development not only decreases the size of the gonad, but also
decreases or eliminates the expression of male-specific genes, the
differentiation of Sertoli cells and the formation of testis cords
(Schmahl and Capel, 2003
).
Thus, proliferation in the early testis is crucial for the normal patterning
and, ultimately, the developmental fate of the XY gonad. In
Fgf9-/- XY gonads, the reduction in proliferation is
observed within the period that blocking experiments defined as crucial in
testis development, and occurs at the time and place that pre-Sertoli cells
are dividing. Therefore, the failure of cord formation and other aspects of
testis development in Fgf9-/- XY gonads may be at least
partially due to a reduction in the numbers of pre-Sertoli cells normally
produced by early proliferation.
However, despite the importance of proliferation in testis development, it should be noted that the induction of proliferation at the coelomic epithelium in cultured XX gonads by FGF9 was not sufficient for Sertoli differentiation and cord formation. Therefore, although proliferation has an important role in testis development, other elements downstream of Sry are necessary for Sertoli differentiation and normal testis development.
Sex-specific components of the ECM may determine the sex-specific action of FGF9
FGF9 is known to bind and activate four receptors (FGFR1, FGFR2, FGFR3 and
FGFR4) (Ornitz et al., 1996
).
FGFR1, FGFR3 and FGFR4 were found in somatic and germ cells throughout both XY
and XX gonads at 11.5 dpc, indicating that they could have a role in gonad
formation. However, mice with null mutations of Fgfr3 and
Fgfr4 are fertile (Colvin et al.,
1996
; Deng et al.,
1996
; Weinstein et al.,
1998
), indicating that these receptors are not required (or are
redundant) for the development of a functional testis. Null mutations in
Fgfr1 are lethal between 6.5 and 9.5 dpc, before gonad formation
(Deng et al., 1994
). However,
studies with chimeric mice indicate that the testis develops normally even
with up to 90% Fgfr1-/- cells
(Deng et al., 1997
).
Therefore, at least in many cells of the testis, FGFR1 is not essential for
testis development. FGFR2 is necessary for many processes in development,
including bone growth and the induction of the limb
(Xu et al., 1998
;
Yu et al., 2003
). However,
because homozygous null mutations for Fgfr2 result in embryonic
lethality at 10.5 dpc (Arman et al.,
1999
), the reproductive function of this receptor has not been
assessed.
Despite the sex-specific proliferation phenotype in
Fgf9-/- gonads, the expression patterns of Fgf9
and all four known FGF receptors are not sex specific during the early stages
of sex determination (11.5 dpc). FGFR2 is localized to the plasma membrane of
proliferating cells; however, its expression in these cells is similar in XX
and XY gonads. One explanation for the dimorphic effect of the Fgf9
mutation is that sex-specific components of the ECM, such as HSPGs, mediate
the activity of FGF9 in XY gonads. HSPGs in the extracellular matrix form
complexes with FGFs and FGFRs, and are required to efficiently activate FGFRs
(Rapraeger et al., 1991
;
Yayon et al., 1991
;
Lin et al., 1999
). HSPGs also
stabilize secreted FGFs, limit their diffusion and maintain them in active or
inactive states, thus generating sites of increased local activity and
morphogenetic boundaries. Tissue-specific expression and modification of HSPGs
have been shown to be responsible for the tissue specific action of FGFs in
other systems (Chang et al.,
2000
; Pye et al.,
2000
; Allen et al.,
2001
; Friedl et al.,
2001
; Ford-Perriss et al.,
2002
; Jenniskens et al.,
2002
; Habuchi et al.,
2003
). In gonad sections, enhanced binding of FGF9 occurred
specifically at the coelomic epithelium, the region where male proliferation
increases occur. This enhanced binding of FGF9 was abolished by heparinases,
indicating that the enhanced binding of FGF9 to the male gonad is dependant on
sex-specific differences in the ECM, not differences in FGF9 or FGFR
expression. These findings support a role for XY-specific components of the
ECM in regulating the sex-specific activity of FGF9.
FGFR2 translocates to the nucleus during the early differentiation of Sertoli cells
FGFR2 showed a striking sex-specific expression pattern within the nuclei
of a scattered population of cells located in the interior of the XY gonad.
This dimorphic pattern in the nucleus of XY cells was detected by 11.0 dpc and
is coincident with the appearance of nuclear SOX9, a marker of Sertoli cell
differentiation and the earliest known difference between XY and XX gonads
previously known to occur after the initiation of Sry expression.
FGFR2 was not observed in the nuclei of Fgf9-/- XY gonads,
indicating that the nuclear localization of this receptor is dependent on
Fgf9. However, addition of exogenous FGF9 did not induce the nuclear
translocation of FGFR2 or other markers of Sertoli differentiation in XX
gonads, indicating that nuclear localization of this growth factor receptor is
also mediated by factors specific to the XY gonad.
Nuclear localization of FGFR2 does not occur in proliferating cells at the
epithelial surface, but in cells that are initiating Sertoli cell
differentiation within the gonad. Direct lineage tracing experiments indicate
that Sertoli precursors originate from the coelomic epithelium
(Karl and Capel, 1998
), where
FGFR2 is found at the plasma membrane. Once cells leave the coelomic
epithelium, they initiate Sertoli cell differentiation within the interior of
the gonad (Albrecht and Eicher,
2001
; Bullejos and Koopman,
2001
), where the expression of Sry, the upregulation of
Sox9, and the nuclear location of FGFR2 are observed.
It has been known for some time that many cell-surface growth factor
receptors can accumulate within the nucleus. However, the biological relevance
of this event is not known (reviewed by
Goldfarb, 2001
;
Wells and Marti, 2002
). It has
been speculated that nuclear growth factor receptors may act as weak
transcription factors, topoisomerases and/or nuclear kinases. Nuclear FGF
receptors have been observed in spliceosomes
(Penderson, 1998
;
Peng et al., 2002
). This is
particularly interesting, as several components of the sex-determination
pathway (including SRY, SOX9 and the +KTS isoform of WT) have been shown to
associate with splicing factors, and have been demonstrated to have splicing
activity (Hastie, 2001
;
Ohe et al., 2002
). Another
function of nuclear FGF receptors may be to phosphorylate nuclear substrates,
as the forced nuclear translocation of FGF receptors leads to an increase in
the phosphorylation of nuclear proteins, and some activities of the nuclear
receptor are abolished by deactivation of the kinase domain
(Maher, 1996
;
Reilly and Maher, 2001
;
Peng et al., 2002
).
A potential role of FGFR signaling in the gonad is suggested by studies in
chondrocytes. In this cell type, the activation of FGF receptors in vitro can
upregulate expression of Sox9 which is involved in chondrocyte
differentiation in bone growth plates (de
Crombrugghe et al., 2000
;
Murakami et al., 2000
).
Sox9 is known to be essential for male sex determination
(Foster et al., 1994
). In
fact, because the induction of Sox9 expression can initiate the male
pathway in the absence of Sry, this gene is hypothesized to lie
immediately downstream of Sry in the sex-determination cascade
(Bishop et al., 2000
;
Vidal et al., 2001
). In early
gonad development, SOX9 is found at low levels in the cytoplasm of cells in
both XX and XY gonads. However, like FGFR2, SOX9 undergoes a change in
subcellular localization and is found in the nucleus of cells in the XY gonad
just after Sry is expressed
(Morais da Silva et al., 1996
;
de Santa Barbara et al.,
2000
). Nuclear FGFR2 colocalizes with SOX9 in the gonad,
suggesting that this receptor could be involved in the induction or
maintenance of the nuclear localization of SOX9.
The discovery of the sex-specific subcellular localization of FGFR2 in the nuclei of Sertoli precursors provides a well-characterized biological context in which to study the function of nuclear growth factor receptors. In this context, the transition of FGFR2 from the cell membrane to the nucleus suggests that the nuclear localization of cell-surface receptors is linked to the initiation of cell differentiation. It is not yet clear how proliferation of Sertoli cell precursors in the coelomic epithelium and subsequent commitment to the Sertoli fate are interwoven; however, these findings suggest that FGF signaling may be involved in bridging these two processes essential to testis development.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Albrecht, K. H. and Eicher, E. M. (2001). Evidence that Sry is expressed in pre-Sertoli cells and Sertoli and granulosa cells have a common precursor. Dev. Biol. 240,92 -107.[CrossRef][Medline]
Allen, B. L., Filla, M. S. and Rapraeger, A. C.
(2001). Role of heparan sulfate as a tissue-specific regulator of
FGF-4 and FGF receptor recognition. J. Cell Biol.
155,845
-858.
Arman, E., Haffner-Krausz, R., Gorivodsky, M. and Lonai, P.
(1999). Fgfr2 is required for limb outgrowth and
lung-branching morphogenesis. Proc. Natl. Acad. Sci.
USA 96,11895
-11899.
Bishop, C., Whitworth, D., Qin, Y., Agoulnik, A., Agoulnik, I., Harrison, W., Behringer, R. and Overbeek, P. (2000). A trangenic insertion upstream of Sox9 is associated with dominant XX sex reversal in the mouse. Nat. Genet. 26,490 -494.[CrossRef][Medline]
Brennan, J., Tilmann, C. and Capel, B. (2003).
Pdgfr
mediates testis cord organization and fetal Leydig cell
development. Genes Dev.
17,800
-810.
Bullejos, M. and Koopman, P. (2001). Spatially dynamic expression of Sry in mouse genital ridges. Dev. Dyn. 221,201 -205.[CrossRef][Medline]
Burgoyne, P. and Palmer, S. (1993). Cellular basis of sex determination and sex reversal in mammals. In Gonadal Development and Function (ed. S. G. Hillier), pp.17 -29. New York: Raven Press.
Chamindrani Mendis-Handagama, S. M. and Siril Ariyaratne, H.
B. (2001). Differentiation of the adult leydig cell
population in the postnatal testis. Biol. Reprod.
65,660
-671.
Chang, Z., Meyer, K., Rapraeger, A. C. and Friedl, A.
(2000). Differential ability of heparan sulfate proteoglycans to
assemble the fibroblast growth factor receptor complex in situ.
FASEB J. 14,137
-144.
Colvin, J. S., Bohne, B. A., Harding, G. W., McEwen, D. G. and Ornitz, D. M. (1996). Skeletal overgrowth and deafness in mice lacking fibroblast growth factor receptor 3. Nat. Genet. 12,390 -397.[CrossRef][Medline]
Colvin, J. S., Feldman, B., Nadeau, H. H., Goldfarb, M. and Ornitz, D. M. (1999). Genomic organization and embryonic expression of the mouse fibroblast growth factor 9 gene. Dev. Dyn. 216,72 -88.[CrossRef][Medline]
Colvin, J. S., Green, R. P., Schmahl, J., Capel, B. and Ornitz, D. M. (2001a). Male-to-female sex reversal in mice lacking fibroblast growth factor 9. Cell 104,875 -889.[CrossRef][Medline]
Colvin, J. S., White, A. C., Pratt, S. J. and Ornitz, D. M.
(2001b). Lung hypoplasia and neonatal death in Fgf9-null
mice identify this gene as an essential regulator of lung mesenchyme.
Development 128,2095
-2106.
de Crombrugghe, B., Lefebvre, V., Behringer, R. R., Bi, W., Murakami, S. and Huang, W. (2000). Transcriptional mechanisms of chondrocyte differentiation. Matrix Biol. 19,389 -394.[CrossRef][Medline]
de Santa Barbara, P., Moniot, B., Poulat, F. and Berta, P. (2000). Expression and subcellular location of SF-1, SOX9, WT1, and AMH proteins during early human testicular development. Dev. Dyn. 217,293 -298.[CrossRef][Medline]
Deng, C. X., Wynshaw-Boris, A., Shen, M. M., Daugherty, C.,
Ornitz, D. M. and Leder, P. (1994). Murine FGFR1 is
required for early postimplantation growth and axial organization.
Genes Dev. 8,3045
-3057.
Deng, C. X., Wynshaw-Boris, A., Zhou, F., Kuo, A. and Leder, P. (1996). Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell 84,911 -921.[CrossRef][Medline]
Deng, C. X., Bedford, M., Li, C., Xu, X., Yang, X., Dunmore, J. and Leder, P. (1997). Fibroblast growth factor receptor-1 (FGFR-1) is essential for normal neural tube and limb development. Dev. Biol. 185,42 -54.[CrossRef][Medline]
Ford-Perriss, M., Guimond, S. E., Greferath, U., Kita, M.,
Grobe, K., Habuchi, H., Kimata, K., Esko, J. D., Murphy, M. and
Turnbull, J. E. (2002). Variant heparan sulfates synthesized
in developing mouse brain differentially regulate FGF signaling.
Glycobiology 12,721
-727.
Foster, J., Dominguez-Steglich, M., Guioli, S., Kwok, C., Weller, P., Stevanovic, M., Weissenbach, J., Mansour, S., Young, I., Goodfellow, P. et al. (1994). Campomelic Dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene. Nature 372,525 -529.[CrossRef][Medline]
Friedl, A., Filla, M. and Rapraeger, A. C. (2001). Tissue-specific binding by FGF and FGF receptors to endogenous heparan sulfates. Methods Mol. Biol. 171,535 -546.[Medline]
Goldfarb, M. (2001). Signaling by fibroblast growth factors: the inside story. Sci. STKE 106, PE37.
Gubbay, J., Collignon, J., Koopman, P., Capel, B., Economou, A., Munsterberg, A., Vivian, N., Goodfellow, P. and Lovell-Badge, R. (1990). A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346,245 -250.[CrossRef][Medline]
Habuchi, H., Miyake, G., Nogami, K., Kuroiwa, A., Matsuda, Y., Kusche- Gullberg, M., Habuchi, O., Tanaka, M. and Kimata, K. (2003). Biosynthesis of heparan sulphate with diverse structures and functions: two alternatively spliced forms of human heparan sulphate 6-O-sulphotransferase-2 having different expression patterns and properties. Biochem. J. 371,131 -142.[CrossRef][Medline]
Hacker, A., Capel, B., Goodfellow, P. and Lovell-Badge, R. (1995). Expression of Sry, the mouse sex determining gene. Development 121,1603 -1614.[Abstract]
Hastie, N. D. (2001). Life, sex, and WT1 isoforms-three amino acids can make all the difference. Cell 106.
Henrique, D., Adam, J., Myat, A., Chitnis, A., Lewis, J. and Ish-Horowicz, D. (1995). Expression of a Delta homologue in prospective neurons in the chick. Nature 375,787 -790.[CrossRef][Medline]
Jenniskens, G. J., Hafmans, T., Veerkamp, J. H. and van Kuppevelt, T. H. (2002). Spatiotemporal distribution of heparan sulfate epitopes during myogenesis and synaptogenesis: a study in developing mouse intercostal muscle. Dev. Dyn. 225, 70-79.[CrossRef][Medline]
Karl, J. and Capel, B. (1998). Sertoli cells of the mouse testis originate from the coelomic epithelium. Dev. Biol. 203,323 -333.[CrossRef][Medline]
Kent, J., Wheatley, S. C., Andrews, J. E., Sinclair, A. H. and Koopman, P. (1996). A male-specific role for Sox9 in vertebrate sex determination. Development 122,2813 -2822.[Abstract]
Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P. and Lovell-Badge, R. (1991). Male development of chromosomally female mice transgenic for Sry. Nature 351,117 -121.[CrossRef][Medline]
Lamb, D. J. (1993). Growth factors and testicular development. J. Urol. 150,583 -592.[Medline]
Lin, X., Buff, E. M., Perrimon, N. and Michelson, A. M. (1999). Heparan sulfate proteoglycans are essential for FGF receptor signaling during Drosophila embryonic development. Development 126,3715 -3723.[Abstract]
Lovell-Badge, R., Canning, C. and Sekido, R. H. (2002). Sex-determining genes in mice: building pathways. In The Genetics and Biology of Sex Determination, Novaris Foundation symposium, pp. 4-23. Chichester, UK: John Wiley & Sons Ltd.
Maher, P. A. (1996). Nuclear translocation of
fibroblast growth factor (FGF) receptors in response to FGF-2. J
Cell Biol 134,529
-536.
Martineau, J., Nordqvist, K., Tilmann, C., Lovell-Badge, R. and Capel, B. (1997). Male-specific cell migration into the developing gonad. Curr. Biol. 7, 958-968.[CrossRef][Medline]
Morais da Silva, S., Hacker, A., Harley, V., Goodfellow, P., Swain, A. and Lovell-Badge, R. (1996). Sox9 expression during gonadal development implies a conserved role for the gene in testis differentiation in mammals and birds. Nat. Genet. 14,62 -68.[CrossRef][Medline]
Murakami, S., Kan, M., McKeehan, W. L. and de Crombrugghe,
B. (2000). Up-regulation of the chondrogenic Sox9
gene by fibroblast growth factors is mediated by the mitogen-activated protein
kinase pathway. Proc. Natl. Acad. Sci. USA
97,1113
-1119.
Nef, S., Verma-Kurvari, S., Merenmies, J., Vassalli, J. D., Efstratiadis, A., Accili, D. and Parada, L. F. (2003). Testis determination requires insulin receptor family function in mice. Nature 426,291 -295.[CrossRef][Medline]
Ohe, K., Lalli, E. and Sassone-Corsi, P.
(2002). A direct role of SRY and SOX proteins in pre-mRNA
splicing. Proc. Natl. Acad. Sci. USA
99,1146
-1151.
Ornitz, D. M., Xu, J., Colvin, J. S., McEwen, D. G., MacArthur,
C. A., Coulier, F., Gao, G. and Goldfarb, M. (1996).
Receptor specificity of the fibroblast growth factor family. J.
Biol. Chem. 271,15292
-15297.
Palmer, S. J. and Burgoyne, P. S. (1991). In situ analysis of fetal, prepuberal and adult XX-XY chimaeric mouse testes: Sertoli cells are predominantly, but not exclusively, XY. Development 112,265 -268.[Abstract]
Penderson, T. (1998). Growth factors in the
nucleolus. J. Cell Biol.
143,279
-281.
Peng, H., Myers, J., Fang, X., Stachowiak, E. K., Maher, P. A., Martins, G. G., Popescu, G., Berenzney, R. and Stachowiak, M. K. (2002). Integrative nuclear FGFR1 signaling (INFS) pathway mediates activation of the tyrosine hydroxylase gene by angiotensin II, depolarization and protein kinase C. J. Neurochem. 81,506 -524.[CrossRef][Medline]
Pye, D. A., Vives, R. R., Hyde, P. and Gallagher, J. T.
(2000). Regulation of FGF-1 mitogenic activity by heparan sulfate
oligosaccharides is dependent on specific structural features: differential
requirements for the modulation of FGF-1 and FGF-2.
Glycobiology 10,1183
-1192.
Rapraeger, A. C. (2002). Heparan sulfate-growth factor interactions. Methods Cell Biol. 69, 83-109.[Medline]
Rapraeger, A. C., Krufka, A. and Olwin, B. B.
(1991). Requirement of heparan sulfate for bFGF-mediated
fibroblast growth and myoblast differentiation.
Science 252,1705
-1708.
Reilly, J. F. and Maher, P. A. (2001). Importin
ß-mediated nuclear import of fibroblast growth factor receptor: role in
cell proliferation. J. Cell Biol.
152,1307
-1312.
Schmahl, J. and Capel, B. (2003). Cell proliferation is necessary for the determination of male fate in the gonad. Dev. Biol. 258,264 -276.[CrossRef][Medline]
Schmahl, J., Eicher, E. M., Washburn, L. L. and Capel, B. (2000). Sry induces cell proliferation in the mouse gonad. Development 127,65 -73.[Abstract]
Vidal, V. P., Chaboissier, M. C., de Rooij, D. G. and Schedl, A. (2001). Sox9 induces testis development in XX transgenic mice. Nat. Genet. 28,216 -217.[CrossRef][Medline]
Weinstein, M., Xu, X., Ohyama, K. and Deng, C. X. (1998). FGFR-3 and FGFR-4 function cooperatively to direct alveogenesis in the murine lung. Development 125,3615 -3623.[Abstract]
Wells, A. and Marti, U. (2002). Signalling shortcuts: cell-surface receptors in the nucleus? Nat. Rev. Mol. Cell Biol. 3,697 -702.[CrossRef][Medline]
Xu, X., Weinstein, M., Li, C., Naski, M., Cohen, R. I., Ornitz, D. M., Leder, P. and Deng, C. (1998). Fibroblast growth factor receptor 2 (FGFR2)-mediated regulation loop between FGF8 and FGF10 is essential for limb induction. Development 125,753 -765.[Abstract]
Yan, Y. C., Sun, Y. P. and Zhang, M. L. (1998). Testis epidermal growth factor and spermatogenesis. Arch. Androl. 40,133 -146.[Medline]
Yao, H. H., Whoriskey, W. and Capel, B. (2002).
Desert Hedgehog/Patched 1 signaling specifies fetal Leydig cell fate in testis
organogenesis. Genes Dev.
16,1433
-1440.
Yayon, A., Klagsbrun, M., Esko, J. D., Leder, P. and Ornitz, D. M. (1991). Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Cell 64,841 -848.[CrossRef][Medline]
Yu, K., Xu, J., Liu, Z., Sosic, D., Shao, J., Olson, E. N.,
Towler, D. A. and Ornitz, D. M. (2003). Conditional
inactivation of FGF receptor 2 reveals an essential role for FGF signaling in
the regulation of osteoblast function and bone growth.
Development 130,3063
-3074.
This article has been cited by other articles:
![]() |
B. Moniot, F. Declosmenil, F. Barrionuevo, G. Scherer, K. Aritake, S. Malki, L. Marzi, A. Cohen-Solal, I. Georg, J. Klattig, et al. The PGD2 pathway, independently of FGF9, amplifies SOX9 activity in Sertoli cells during male sexual differentiation Development, June 1, 2009; 136(11): 1813 - 1821. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hiramatsu, S. Matoba, M. Kanai-Azuma, N. Tsunekawa, Y. Katoh-Fukui, M. Kurohmaru, K.-i. Morohashi, D. Wilhelm, P. Koopman, and Y. Kanai A critical time window of Sry action in gonadal sex determination in mice Development, January 1, 2009; 136(1): 129 - 138. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Widberg, F. S. Newell, A. W. Bachmann, S. N. Ramnoruth, M. C. Spelta, J. P. Whitehead, L. J. Hutley, and J. B. Prins Fibroblast growth factor receptor 1 is a key regulator of early adipogenic events in human preadipocytes Am J Physiol Endocrinol Metab, January 1, 2009; 296(1): E121 - E131. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Daggag, T. Svingen, P. S. Western, J. A. v. d. Bergen, P. J. McClive, V. R. Harley, P. Koopman, and A. H. Sinclair The Rhox Homeobox Gene Family Shows Sexually Dimorphic and Dynamic Expression During Mouse Embryonic Gonad Development Biol Reprod, September 1, 2008; 79(3): 468 - 474. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Cotton, M. K. O'Bryan, and B. T. Hinton Cellular Signaling by Fibroblast Growth Factors (FGFs) and Their Receptors (FGFRs) in Male Reproduction Endocr. Rev., April 1, 2008; 29(2): 193 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. DiNapoli and B. Capel SRY and the Standoff in Sex Determination Mol. Endocrinol., January 1, 2008; 22(1): 1 - 9. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zachow and M. Uzumcu The hepatocyte growth factor system as a regulator of female and male gonadal function J. Endocrinol., December 1, 2007; 195(3): 359 - 371. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kim, N. Bingham, R. Sekido, K. L. Parker, R. Lovell-Badge, and B. Capel Fibroblast growth factor receptor 2 regulates proliferation and Sertoli differentiation during male sex determination PNAS, October 16, 2007; 104(42): 16558 - 16563. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Bouma, L. L. Washburn, K. H. Albrecht, and E. M. Eicher Correct dosage of Fog2 and Gata4 transcription factors is critical for fetal testis development in mice PNAS, September 18, 2007; 104(38): 14994 - 14999. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M Clement, M. D Anway, M. Uzumcu, and M. K Skinner Regulation of the gonadal transcriptome during sex determination and testis morphogenesis: comparative candidate genes Reproduction, September 1, 2007; 134(3): 455 - 472. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Drummond, M. Tellbach, M. Dyson, and J. K. Findlay Fibroblast Growth Factor-9, a Local Regulator of Ovarian Function Endocrinology, August 1, 2007; 148(8): 3711 - 3721. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Liao and G. Carpenter Role of the Sec61 Translocon in EGF Receptor Trafficking to the Nucleus and Gene Expression Mol. Biol. Cell, March 1, 2007; 18(3): 1064 - 1072. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Kuslak, J. L. Thielen, and P. C. Marker The mouse seminal vesicle shape mutation is allelic with Fgfr2 Development, February 1, 2007; 134(3): 557 - 565. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wilhelm, S. Palmer, and P. Koopman Sex Determination and Gonadal Development in Mammals Physiol Rev, January 1, 2007; 87(1): 1 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chi, P. Itaranta, S. Zhang, and S. Vainio Sprouty2 Is Involved in Male Sex Organogenesis by Controlling Fibroblast Growth Factor 9-Induced Mesonephric Cell Migration to the Developing Testis Endocrinology, August 1, 2006; 147(8): 3777 - 3788. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, O. A. Ibrahimi, S. K. Olsen, H. Umemori, M. Mohammadi, and D. M. Ornitz Receptor Specificity of the Fibroblast Growth Factor Family: THE COMPLETE MAMMALIAN FGF FAMILY J. Biol. Chem., June 9, 2006; 281(23): 15694 - 15700. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Durcova-Hills, I. R. Adams, S. C. Barton, M. A. Surani, and A. McLaren The role of exogenous fibroblast growth factor-2 on the reprogramming of primordial germ cells into pluripotent stem cells. Stem Cells, June 1, 2006; 24(6): 1441 - 1449. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H.-C. Yao, J. Aardema, and K. Holthusen Sexually Dimorphic Regulation of Inhibin Beta B in Establishing Gonadal Vasculature in Mice Biol Reprod, May 1, 2006; 74(5): 978 - 983. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Dunham-Ems, H. E. Pudavar, J. M. Myers, P. A. Maher, P. N. Prasad, and M. K. Stachowiak Factors Controlling Fibroblast Growth Factor Receptor-1's Cytoplasmic Trafficking and Its Regulation as Revealed by FRAP Analysis Mol. Biol. Cell, May 1, 2006; 17(5): 2223 - 2235. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. DiNapoli, J. Batchvarov, and B. Capel FGF9 promotes survival of germ cells in the fetal testis Development, April 15, 2006; 133(8): 1519 - 1527. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Beverdam and P. Koopman Expression profiling of purified mouse gonadal somatic cells during the critical time window of sex determination reveals novel candidate genes for human sexual dysgenesis syndromes Hum. Mol. Genet., February 1, 2006; 15(3): 417 - 431. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Loveland, C. Hogarth, A. Szczepny, S. M. Prabhu, and D. A. Jans Expression of Nuclear Transport Importins beta 1 and beta 3 Is Regulated During Rodent Spermatogenesis Biol Reprod, January 1, 2006; 74(1): 67 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
R E. Ramy, A Verot, S Mazaud, F Odet, S Magre, and B Le Magueresse-Battistoni Fibroblast growth factor (FGF) 2 and FGF9 mediate mesenchymal-epithelial interactions of peritubular and Sertoli cells in the rat testis J. Endocrinol., October 1, 2005; 187(1): 135 - 147. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Fang, E. K. Stachowiak, S. M. Dunham-Ems, I. Klejbor, and M. K. Stachowiak Control of CREB-binding Protein Signaling by Nuclear Fibroblast Growth Factor Receptor-1: A NOVEL MECHANISM OF GENE REGULATION J. Biol. Chem., August 5, 2005; 280(31): 28451 - 28462. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ottolenghi, S. Omari, J. E. Garcia-Ortiz, M. Uda, L. Crisponi, A. Forabosco, G. Pilia, and D. Schlessinger Foxl2 is required for commitment to ovary differentiation Hum. Mol. Genet., July 15, 2005; 14(14): 2053 - 2062. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kanai, R. Hiramatsu, S. Matoba, and T. Kidokoro From SRY to SOX9: Mammalian Testis Differentiation J. Biochem., July 1, 2005; 138(1): 13 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matsuyama, H. Mizusaki, A. Shimono, T. Mukai, K. Okumura, K. Abe, K. Shimada, and K.-i. Morohashi A novel isoform of Vinexin, Vinexin {gamma}, regulates Sox9 gene expression through activation of MAPK cascade in mouse fetal gonad Genes Cells, May 1, 2005; 10(5): 421 - 434. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Matoba, Y. Kanai, T. Kidokoro, M. Kanai-Azuma, H. Kawakami, Y. Hayashi, and M. Kurohmaru A novel Sry-downstream cellular event which preserves the readily available energy source of glycogen in mouse sex differentiation J. Cell Sci., April 1, 2005; 118(7): 1449 - 1459. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Steinberg, C. Myers, V. M. Heim, C. A. Lathrop, I. T. Rebustini, J. S. Stewart, M. Larsen, and M. P. Hoffman FGFR2b signaling regulates ex vivo submandibular gland epithelial cell proliferation and branching morphogenesis Development, March 15, 2005; 132(6): 1223 - 1234. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Park and J. L. Jameson Minireview: Transcriptional Regulation of Gonadal Development and Differentiation Endocrinology, March 1, 2005; 146(3): 1035 - 1042. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Agrotis, P. Kanellakis, G. Kostolias, G. Di Vitto, C. Wei, R. Hannan, G. Jennings, and A. Bobik Proliferation of Neointimal Smooth Muscle Cells after Arterial Injury: DEPENDENCE ON INTERACTIONS BETWEEN FIBROBLAST GROWTH FACTOR RECEPTOR-2 AND FIBROBLAST GROWTH FACTOR-9 J. Biol. Chem., October 1, 2004; 279(40): 42221 - 42229. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||