spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 7 July 2004
doi: 10.1242/dev.01241


Development 131, 3727-3735 (2004)
Published by The Company of Biologists 2004


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.01241v1
131/15/3727    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Development
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mann, M. R. W.
Right arrow Articles by Bartolomei, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mann, M. R. W.
Right arrow Articles by Bartolomei, M. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Selective loss of imprinting in the placenta following preimplantation development in culture

Mellissa R. W. Mann1, Susan S. Lee1, Adam S. Doherty1,2, Raluca I. Verona1, Leisha D. Nolen1, Richard M. Schultz2 and Marisa S. Bartolomei1,*

1 Howard Hughes Medical Institute and Department of Cell and Developmental Biology, University of Pennsylvania School of Medicine, Philadelphia, PA 19104, USA
2 Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA

* Author for correspondence (e-mail: bartolom{at}mail.med.upenn.edu)

Accepted 26 April 2004


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Preimplantation development is a period of dynamic epigenetic change that begins with remodeling of egg and sperm genomes, and ends with implantation. During this time, parental-specific imprinting marks are maintained to direct appropriate imprinted gene expression. We previously demonstrated that H19 imprinting could be lost during preimplantation development under certain culture conditions. To define the lability of genomic imprints during this dynamic period and to determine whether loss of imprinting continues at later stages of development, imprinted gene expression and methylation were examined after in vitro preimplantation culture. Following culture in Whitten's medium, the normally silent paternal H19 allele was aberrantly expressed and undermethylated. However, only a subset of individual cultured blastocysts (~65%) exhibited biallelic expression, while others maintained imprinted H19 expression. Loss of H19 imprinting persisted in mid-gestation conceptuses. Placental tissues displayed activation of the normally silent allele for H19, Ascl2, Snrpn, Peg3 and Xist while in the embryo proper imprinted expression for the most part was preserved. Loss of imprinted expression was associated with a decrease in methylation at the H19 and Snrpn imprinting control regions. These results indicate that tissues of trophectoderm origin are unable to restore genomic imprints and suggest that mechanisms that safeguard imprinting might be more robust in the embryo than in the placenta.

Key words: Imprinting, DNA methylation, Placenta, H19, Snrpn, Peg3, Ascl2, Xist, Mouse


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Genomic imprinting is defined as an epigenetic mechanism of transcriptional regulation that results in one of the two parental alleles being expressed (Verona et al., 2003Go). Disruptions in imprinted expression can have severe consequences for growth and development of the mammalian embryo and placenta. Loss of imprinted gene expression has been extensively studied in mice and humans with genetic and epigenetic defects. In humans, such defects result in Prader-Willi, Angelman, and Beckwith-Wiedemann syndromes (Bartolomei and Tilghman, 1997Go; Maher and Reik, 2000Go; Nicholls and Knepper, 2001Go).

Imprinting may be envisaged as a multi-step process that begins in the parental gametes, where epigenetic modifications differentially mark the parental alleles. These parental-specific marks must then be stably maintained during cellular division and differentiation, including during preimplantation development, and finally they must be translated into parental-specific monoallelic expression (Pfeifer, 2000Go). Disruptions in any of these steps may lead to loss of parental-specific expression.

We and others have previously demonstrated that imprinting can be disrupted during preimplantation development; in vitro preimplantation culture of embryos resulted in biallelic expression of the H19 gene (Doherty et al., 2000Go; Sasaki et al., 1995Go). These results support the hypothesis that gametic imprints are labile, for at least one imprinted gene, during this dynamic period of development. However, a comprehensive analysis of loss of imprinting arising during preimplantation development has not been conducted in any species. Many questions remain unanswered, such as: whether all blastocysts or only a subset lose H19 imprinting; whether blastocysts that lose imprinted expression are able to restore imprinting of the H19 gene during postimplantation development; whether other imprinted genes and epigenetic processes display long-term effects of epigenetic errors; and finally, whether loss of imprinting depends on tissue type.

To address these questions we undertook a detailed analysis of allele-specific expression and DNA methylation of imprinted genes after in vitro preimplantation culture of mouse embryos. At the single embryo level, only a subset of individual, Whitten's cultured blastocysts (~65%) displayed biallelic expression, while others maintained allele-specific H19 expression. Analysis of mid-gestation conceptuses revealed that loss of H19 imprinting persisted postimplantation. Placental tissues displayed biallelic expression for multiple imprinted genes, including H19 and Snrpn, while in the embryo proper, imprinted expression was mainly preserved, suggesting that there may be tissue-specific epigenetic disruptions that occurred during preimplantation development. Loss of imprinted expression was associated with reduced methylation at the H19 and Snrpn imprinting control regions (ICRs). These results indicate that genomic imprints are labile in tissues of trophectoderm origin and may be perturbed during preimplantation development.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Mice
For allele-specific expression studies, embryos were obtained from crosses with C57BL/6(CAST7) or C57BL/6(CAST27-t) females and C57BL/6 (B6) males and from the reciprocal cross with B6 females and B6(CAST7) males. B6(CAST7) mice bear Mus musculus castaneus (CAST; The Jackson Laboratory) chromosome 7s on a B6 background, while B6(CAST27-t) are CAST for the central and distal portions of chromosome 7 (27 cM to terminus) and B6 for the proximal region. These mice served as a source of CAST alleles (Mann et al., 2003Go). No difference was observed in the expression patterns of embryos derived from B6(CAST7) or B6(CAST27-t) females by Fisher's exact test.

Embryos were recovered at the 2-cell stage and cultured in Whitten's medium or in KSOM augmented with amino acids as described (Doherty et al., 2000Go). For postimplantation analysis, cultured blastocysts were transferred to stage-matched pseudopregnant recipients, and embryos and placentas were recovered at embryonic day (E) 9.5.

Allele-specific expression analysis of blastocyst-stage embryos
Individual blastocysts or pools of blastocysts (~10) were placed in 100 µl Dynal Lysis Buffer, vortexed and stored at -80°C. Dynabeads Oligo (dT)25 (Dynal) were equilibrated with 100 µl Dynal Lysis Buffer according to the manufacturer's instructions. Isolation of mRNA and reverse transcription, or generation of Dynabead Oligo (dT)25 covalently-linked cDNA libraries and second strand synthesis were performed as described (Mann et al., 2003Go).

The H19 and Snrpn expression assays were conducted on cDNA using the LightCycler Real Time PCR System (Roche Molecular Biochemicals) as described (Mann et al., 2003Go) except for the Snrpn assay, for which Genset hybridization probes were used, DMSO was omitted, and amplification and melting curve analysis was performed as follows. After an initial denaturation step at 95°C for 2 minutes, amplification was performed for 45 cycles at 95°C for 1 second, 50°C for 15 seconds and 72°C for 6 seconds. After amplification, a final denaturation and annealing step was conducted (95°C for 0 seconds, 45°C for 15 seconds) then the temperature was increased from 45 to 85°C in 0.2°C increments. Alternatively, Idaho Technologies probes were employed, DMSO was omitted, amplification was performed for 45 cycles and the melting curve analysis was performed as follows. A final denaturation step was conducted at 95°C for 4 minutes, followed by annealing at 35°C for 3 minutes, 40°C for 1 minute and 45°C for 1 minute, and melting curve analysis with fluorescence acquisition occurred continuously as the temperature was increased from 45 to 85°C in 0.5°C increments.

For the Peg3 analysis, Peg3 primers (final concentration 0.3 µM), Peg11 (5'AAGGCTCTGGTTGACAGTCGTG3') and Peg12 (5'TTCTCCTTGGTCTCACGGGC3'), amplified a 239 bp fragment (95°C for 2 minutes followed by 34 cycles at 95°C for 15 seconds, 52°C for 10 seconds and 72°C for 20 seconds) containing a polymorphism between B6 (A) and CAST (G) (position 3451, AF038939). Restriction digestion with TaaI resulted in 224 bp and 16 bp fragments in B6 and 148, 76 and 16 bp fragments in CAST. Parental allele-specific expression patterns for all genes were calculated as the percentage expression of the B6 or CAST allele relative to the total expression of both alleles.

E9.5 embryo and placental RNA isolation and expression assays
Embryos and placentas were recovered at E9.5 and RNA was isolated using the HighPure RNA Tissue Kit (Roche Molecular Biochemicals), with minor modifications to the manufacturer's recommendations. cDNA synthesis was performed as described (Percec et al., 2002Go).

Allele-specific H19 and Snrpn expression assays were conducted on E9.5 embryo and placental cDNA using the LightCycler Real Time PCR System as described above. For Peg3 and Ascl2, PCR amplification was conducted on cDNA under conditions specific for each primer set. To a Ready-To-Go PCR Bead, 0.3 µM of each primer and [{alpha}-32P]dCTP (1 µCi) were added. PCR amplification was performed for 30 cycles as described above (Mann et al., 2003Go). Products were resolved on a 7% polyacrylamide gel. After exposure (approximately 15 hours), the relative band intensities were quantified using ImageQuant (Molecular Dynamics). The Xist expression assay was conducted on E9.5 embryo and placental cDNA using the LightCycler Real Time PCR System as described (Percec et al., 2002Go).

Genotyping the sex of E9.5 conceptuses
DNA was extracted from E9.5 yolk sacs and amplified using primers for Zfy to determine embryo sex (i.e. the presence of the Y chromosome) and for Mkrn3 to control for DNA extraction as described (Yamazaki et al., 2003Go).

Allele-specific DNA methylation analysis
DNA was isolated from pools of 25-30 blastocysts and from individual embryos and placentas obtained at E9.5, subjected to bisulfite modification, PCR amplification, subcloning and sequencing as previously described for the H19 differentially methylated domain (DMD) (1304-1726 bp, U19619) and Snurf-Snrpn (herein referred to as Snrpn) promoter-exon 1 region (2073-2601 bp, AF081460) (Davis et al., 1999Go; Mann et al., 2003Go). Alternatively, bisulfite mutagenesis sequencing with agarose embedding was conducted on whole blastocysts (Olek et al., 1996Go; Schoenherr et al., 2003Go). At least two independent PCRs were performed on each sample. H19 and Snrpn parental alleles were distinguished by single nucleotide polymorphisms as previously reported (Lucifero et al., 2002Go; Mann et al., 2003Go; Tremblay et al., 1997Go).


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Allele-specific expression of imprinted genes in F1 hybrid blastocysts
We have previously demonstrated that H19 imprinted expression in blastocysts was lost following culture in Whitten's medium (Doherty et al., 2000Go). Similarly to this previous report, pools of Whitten's cultured B6(CAST7)XB6 and B6(CAST27-t)XB6 blastocysts exhibited biallelic expression of the H19 gene, while those cultured in KSOM augmented with amino acids (KSOMaa) maintained maternal monoallelic expression (Table 1). To determine whether all embryos cultured in Whitten's medium experienced a relaxation of imprinted gene expression or if only a subset of embryos in the original pool activated expression of the normally silent paternal allele, we assayed single B6(CAST7)XB6 and B6(CAST27-t)XB6 hybrid embryos that were cultured from the 2-cell to the blastocyst stage in Whitten's medium or in KSOMaa. We found that a significant number of Whitten's cultured embryos expressed H19 from both parental alleles (63%), although a proportion of blastocysts (32%) maintained monoallelic (defined as <10% expression from the normally silent allele) H19 expression (Fig. 1). A small number of embryos also displayed an allelic switch in imprinting; the mechanistic defect for such a switch is currently not evident. While in vivo-derived blastocysts displayed lower levels of expression than Whitten's cultured blastocysts (data not shown), this expression was monoallelic; 6% of blastocysts exhibited biallelic expression. By comparison, the number of KSOMaa cultured embryos with biallelic expression (14%) did not differ significantly from that of in vivo-derived blastocysts. These results demonstrate that H19 imprinting was affected in many, but not all, blastocysts after culture in Whitten's medium.


View this table:
[in this window]
[in a new window]
 
Table 1. Expression of H19, Snrpn and Peg3 in pooled in vivo-derived, Whitten's and KSOMaa cultured blastocysts

 



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1. Allele-specific expression of the H19 imprinted gene in individual blastocysts. Gray bar height indicates the level of maternal expression, while black bar height represents the level of paternal-specific expression. The number of Whitten's cultured blastocysts with biallelic expression differed significantly from that of KSOMaa cultured (P=0.002), in vivo-derived (P=0.006), and B6XB6(CAST7) Whitten's cultured (P=0.0001) blastocysts as calculated by Fisher's exact test.

 
In our previous study, we had observed an effect of genotype on H19 imprinting in Whitten's in vitro cultured embryos; embryos of the reciprocal cross, B6XB6(CAST-H19), cultured under identical conditions, maintained imprinted expression of H19 (Doherty et al., 2000Go). In this study, all individual B6XB6(CAST7) Whitten's cultured blastocysts also preserved H19 imprinting, and thus these embryos served as a control in postimplantation studies (Fig. 1).

These genotypic effects led us to hypothesize that strain-specific modifiers might affect maintenance of the H19 imprint. In Peromyscus mice, an imprinting modifier is linked to Peg3 (Vrana et al., 2000Go) and in humans, the orthologous region is linked to an imprinting defect that gives rise to recurrent biparental, complete hydatidiform moles (Moglabey et al., 1999Go). Thus, the proximal portion of Mus musculus chromosome 7 containing the Peg3 gene may harbor a presumptive modifier that offers `protection' from environmental stress when inherited from a B6 mother. To test this, we compared maintenance of H19 imprinted expression in B6(CAST7) mice (CAST for entire chromosome 7) and B6(CAST27-t) mice (B6 proximal, CAST central and distal portions) following culture in Whitten's medium. No difference was observed in the number of blastocysts with H19 biallelic expression, indicating that the putative modifier likely resides elsewhere in the genome.

Parental-specific expression was next assayed in pools and individual B6(CAST7)XB6, B6(CAST27-t)XB6 and B6XB6(CAST7) embryos for two paternally transcribed genes, Snrpn and Peg3. Similarly to our previous study, embryos cultured in Whitten's medium or in KSOMaa maintained monoallelic expression of Snrpn (Table 1; data not shown). Likewise, the paternally expressed Peg3 gene also maintained imprinted expression after culture in KSOMaa and in Whitten's media, suggesting that expression of this gene is fairly resistant to epigenetic disturbances at the blastocyst stage (Table 1; data not shown).

Allele-specific methylation analysis of ICRs in cultured blastocysts
As methylation of distinct CpG-rich regions around imprinted genes plays an important role in the control of monoallelic expression, methylation at the H19 and Snrpn ICRs was assayed by bisulfite mutagenesis analysis in cultured blastocysts. The H19 ICR (designated the differentially methylated domain, or DMD) is paternally hypermethylated (Tremblay et al., 1997Go), whereas the Snrpn promoter-exon 1 region is maternally hypermethylated (J. Trasler and M. Toppings, personal communication) in in vivo-derived blastocysts. Our analysis revealed that a large proportion of paternal H19 strands lacked significant methylation in blastocysts cultured in Whitten's medium; only 59% of paternal H19 strands displayed the expected pattern of hypermethylation (defined as >50% CpGs on a given strand methylated) (Fig. 2A). By comparison, in blastocysts cultured in KSOMaa, 77% of paternal strands were methylated. One explanation for the proportion of paternal hyper- and hypomethylated strands is the composition of blastocysts within the pool; some blastocysts have maintained, while others have lost, H19 imprinting. To test this hypothesis, we examined methylation of the Snrpn ICR with the expectation that Snrpn monoallelic expression would correlate with preservation of the methylation imprint. Surprisingly, substantial loss of methylation was observed at the ICR of this gene following Whitten's culture; similarly to H19, only 40% of maternal Snrpn strands were hypermethylated, while the remaining strands were hypomethylated (Fig. 2B). Blastocysts cultured in KSOMaa exhibited 82% maternal hypermethylation; a loss of methylation comparable to that of H19.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 2. Methylation status of individual DNA strands in (A) the H19 upstream differentially methylated domain (DMD) (paternal strands shown) and (B) Snrpn promoter-exon 1 region (maternal strands shown) in cultured blastocysts as determined by bisulfite mutagenesis analysis. Unmethylated CpGs are represented as empty circles, while methylated CpGs are depicted as filled circles. Each line denotes an individual strand of DNA with the number of strands showing a given pattern indicated to the left. Bar height indicates the percentage of strands that have a methylated CpG at each specific site. Paternal and maternal alleles are depicted by black and gray bars, respectively. For H19, a base pair change in the paternal B6 allele eliminates CpG dinucleotide 8, while for Snrpn, CpG dinucleotide 1 is not present in the maternal CAST allele.

 
Allele-specific expression analyses of E9.5 conceptuses following preimplantation culture
Because H19 imprinted expression and methylation were disrupted in blastocyst-stage embryos, the question remained as to whether these embryos restored H19 imprinting during later stages of development. To address this question, F1 hybrid 2-cell embryos were cultured to the blastocyst stage, transferred to recipient mothers, and embryos and placentas were recovered at E9.5. Although many embryos appeared normal (Whitten's 42% normal, KSOMaa 70% normal), we found a proportion of embryos were developmentally delayed or abnormal (not shown) compared with embryos from in vivo-derived and transferred blastocysts (91% normal). Allelic expression was assayed in normal, abnormal (abn) and delayed conceptuses. While imprinted expression was maintained for H19 in B6(CAST7)XB6 embryos that were subjected to culture in Whitten's medium, the paternal H19 allele was activated in the corresponding placentas (Fig. 3), indicating that the placenta lacked the ability to restore H19 imprinting as development proceeded. E9.5 embryos and placentas derived from B6(CAST7)XB6 in vivo blastocysts, B6XB6(CAST7) Whitten's cultured blastocysts, and B6(CAST7)XB6 KSOMaa cultured blastocysts, for the most part, displayed maternal H19 expression, with the exception of the KSOMaa culture regime, in which some placentas exhibited biallelic expression.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 3. Loss of imprinted expression in embryonic day (E) 9.5 B6(CAST7)XB6 placentas following preimplantation culture in Whitten's medium. Embryos at the 2-cell stage were cultured to the blastocyst stage then transferred to recipient females. Postimplantation embryo-placental sets were recovered at E9.5. B6(CAST7)XB6 in vivo-derived controls (Vivo), B6XB6(CAST7) Whitten's cultured controls (BCW), the remaining samples are B6(CAST7)XB6 KSOMaa (K) or Whitten's (W) cultured conceptuses. Red bar height indicates the level of maternal expression, while blue bar height represents the level of paternal-specific expression.

 
Although the Snrpn gene displayed paternal-specific expression in blastocysts, loss of methylation at the Snrpn ICR in Whitten's cultured blastocysts prompted us to examine Snrpn expression in E9.5 embryonic and placental tissues to determine if loss of imprinted expression occurred at a later stage. While imprinting was maintained in the embryo proper, Snrpn was biallelically expressed in a subset of B6(CAST7)XB6 placentas derived from Whitten's cultured blastocysts (Fig. 3), indicating that loss of imprinted expression occurred for this gene as well.

To determine whether there were global preimplantation culture effects on imprinting, two additional genes were examined in the E9.5 conceptuses. Similar to H19 and Snrpn, loss of imprinted expression of Ascl2 and Peg3 occurred in B6(CAST7)XB6 preimplantation Whitten's cultured placentas. By contrast to expectations, Peg3 was biallelically expressed in placentas from both crosses, suggesting that this gene is sensitive to preimplantation culture in Whitten's medium regardless of genetic background. Furthermore, expression of H19 and Ascl2 was also susceptible to disruption after preimplantation development in KSOMaa. Taken together, these data indicate that the effects of perturbations in preimplantation embryos can be seen long after they have been removed from the culture medium.

Analysis of individual genes revealed that not all placentas exhibited loss of imprinted expression, consistent with the observation that not all blastocysts expressed H19 biallelically. However, no single pattern emerged with respect to loss or maintenance of imprinted expression when all genes were considered, suggesting a stochastic response to preimplantation Whitten's culture. Occasionally, biallelic expression was observed in the embryo proper (Fig. 3, see W113 as an example), suggesting that although more resilient, imprinting in tissues arising from inner cell mass (ICM) might also be lost during preimplantation development. Loss of imprinted gene expression was independent of the sex of the embryo. Finally, no correlation was observed between the developmental phenotype of cultured embryos and loss of imprinted expression for the four genes examined.

Methylation analyses of ICRs in E9.5 conceptuses following preimplantation culture
Methylation associated with the ICRs of H19 and Snrpn was assessed in preimplantation cultured and in vivo-derived conceptuses recovered at E9.5. As predicted from the expression data, the paternal H19 allele was hypermethylated in B6(CAST7)XB6 Whitten's cultured E9.5 embryos (100%, 100% and 83% strands for W35, W36 and W321, respectively) (Fig. 4A). By contrast, one B6(CAST7)XB6 Whitten's cultured E9.5 placenta (W35) exhibited a partial loss of methylation with 63% paternal strands hypermethylated and placentas from the other conceptuses displayed a substantial loss of methylation with 13% (W36) and 10% (W321) paternal hypermethylation. Although different fetuses were analyzed for imprinted methylation and expression, generally paternal methylation loss (37-90%) correlated with the level of paternal activation (~23-75%, to consider only paternal allelic contributions, percentage of paternal expression was multiplied by 2). Allele-specific methylation was preserved in a control B6XB6(CAST7) embryo (WBC5) with 100% paternal strands hypermethylated, while in the placenta lower levels were observed (63%). All paternal strands were hypermethylated in embryos and placentas that were in vivo-derived or subjected to preimplantation KSOMaa culture, consistent with the silent state of this allele.



View larger version (103K):
[in this window]
[in a new window]
 
Fig. 4. Methylation status of individual DNA strands in (A) the H19 upstream DMD and (B) Snrpn promoter-exon 1 region in embryos and placentas recovered at embryonic day 9.5 as determined by bisulfite analysis. Details are as described in Fig. 2. A low level of sporadic methylation on the normally unmethylated allele was observed in samples perturbed by preimplantation culture (data not shown).

 
While not as dramatic as H19, B6(CAST7)XB6 placentas derived from cultured blastocysts also experienced a loss of maternal-specific Snrpn methylation with 86% (W35), 89% (W36), 89% (W321) and 67% (K17) hypermethylated strands (Fig. 4B). In this case, the normally silent maternal allele was activated to a greater level (~53-100%, maternal expression multiplied by 2) than would have been predicted from the loss of maternal-specific methylation (11-33%). By comparison, in vivo-derived and control B6XB6(CAST7) placentas, and all embryos, maintained 100% Snrpn hypermethylation, which correlated with maternal allele silencing.

Effects of in vitro culture on Xist expression
X-inactivation is an epigenetic process whereby one X chromosome is inactivated in female cells. In embryonic tissues, X-inactivation occurs in a random manner, while in extra-embryonic tissues there is preferential inactivation of the paternal X chromosome (Plath et al., 2002Go). The X-inactivation process is partly regulated by the X-inactive-specific transcript (Xist). Xist is expressed from the inactive X chromosome in females but not in males, where the sole X chromosome remains active. To determine whether regulation of another epigenetic process was affected under conditions that resulted in loss of imprinting, Xist expression was examined in embryonic and placental tissues of E9.5 conceptuses after preimplantation culture (Table 2). As female B6(CAST7)XB6 mice possess two B6 X chromosomes, effects of preimplantation development in culture on Xist expression was determined for males only. Male placental tissues from embryos that were cultured to the blastocyst stage in Whitten's medium, and a proportion that were cultured in KSOMaa, inappropriately expressed the Xist gene, with the levels generally falling within the range observed for female tissues, perhaps indicating that the imprinted form of X-inactivation was disrupted. An absence of ectopic Xist expression in B6(CAST7)XB6 male embryonic tissues suggests that the machinery regulating the random form of X-inactivation was unaffected during preimplantation development or was corrected as development proceeded. Thus, errors arising during preimplantation can result in general epigenetic dysregulation in trophectoderm lineages.


View this table:
[in this window]
[in a new window]
 
Table 2. Xist expression in XY conceptuses

 

    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Previous studies in mice have suggested that in vitro culture of embryos and embryonic stem cells can lead to reduced viability and growth, developmental abnormalities and aberrant imprinted gene expression (Bowman and McLaren, 1970Go; Dean et al., 1998Go; Doherty et al., 2000Go; Khosla et al., 2001Go; Nagy et al., 1993Go; Reik et al., 1993Go; Sasaki et al., 1995Go). With respect to the latter, we and others have observed that culture of preimplantation embryos can result in biallelic or reduced expression of the H19 gene (Doherty et al., 2000Go; Khosla et al., 2001Go; Sasaki et al., 1995Go), indicating that epigenetic mechanisms that maintain imprinting might be unstable. Sasaki and colleagues were the first to demonstrate that in vitro fertilization and culture of mouse embryos result in loss of H19 imprinted expression in blastocysts (Sasaki et al., 1995Go). Postimplantation analysis of these in vitro-derived embryos at E6.5, 7.5 and 8.5 revealed that the paternal H19 allele continues to be expressed in extra-embryonic but not in embryonic lineages. While we previously demonstrated that in vitro culture alone results in a loss of H19 imprinted expression in blastocysts (Doherty et al., 2000Go), we report here that this disruption occurs in only a subset of blastocysts and that preimplantation effects on imprinting persist postimplantation in a tissue-specific manner; placental tissues isolated at E9.5 continue to show loss of allelic expression of H19 and other imprinted genes. We also demonstrate that activation of the paternal H19 allele for the most part correlates with loss of paternal-specific methylation at the DMD in both cultured blastocysts and mid-gestation placentas. Together these results demonstrate that appropriate imprinting is not restored during postimplantation development of the placenta.

In our initial study (Doherty et al., 2000Go), we proposed that H19 is hypersensitive to environmental stress, as analysis of a second imprinted gene, Snrpn, revealed that its imprinting is preserved in blastocysts after preimplantation development in culture. However, biallelic expression of several imprinted genes in postimplantation placentas, including Snrpn, after culture in Whitten's medium indicates a more global effect on imprinting. This is supported by the partial loss of methylation that was observed at the Snrpn ICR in mid-gestation placentas that were derived from cultured blastocysts. The less dramatic loss of methylation at Snrpn in comparison with H19 and the lack of correlation between Snrpn imprinted expression and methylation in blastocysts may indicate that disruptions in methylation are not solely responsible for the inability to maintain imprinted expression at this gene.

Loss of imprinted expression is also observed for Ascl2, an imprinted gene that is normally biallelically expressed in blastocyst-stage embryos but is monoallelically expressed in placentas. This result suggests that culture in Whitten's medium either disrupted the imprinting mechanism that regulates this gene at later stages or it did not allow the normal imprinting control mechanism to initiate allele-specific expression at the appropriate time in development. Interestingly, imprinted regulation of Ascl2 operates in a methylation-independent manner (Caspary et al., 1998Go; Tanaka et al., 1999Go). The Xist gene and its antisense transcript, Tsix, also lack germline-derived methylation imprints (McDonald et al., 1998Go; Prissette et al., 2001Go). This suggests either that imprinting is disrupted through different mechanisms for distinct genes or that a uniform process upstream of methylation operates at all imprinted loci, resulting in disruptions to both imprinted gene expression and methylation.

In mice, loss of Tsix expression results in ectopic activation of Xist from the normally silent maternal chromosome in females and males (Lee, 2000Go; Sado et al., 2001Go). In our study, aberrant expression of the Xist gene in male placentas might indicate that the antisense Tsix transcript is inactivated or that transcription is not initiated, thereby resulting in ectopic Xist expression. Alternatively, the Xist gene itself might be susceptible to culture conditions, independent of the Tsix antisense transcript. In either case, these results demonstrate that disturbances arising during preimplantation can result in general epigenetic dysregulation in trophectoderm lineages.

Placental tissues appear to be particularly sensitive to an imbalance of imprinted gene expression. This has been clearly observed in parthenogenetic and androgenetic embryos, in fetuses that underwent round spermatid injection and in interspecific hybrids of Peromyscus mice (Barton et al., 1984Go; McGrath and Solter, 1984Go; Shamanski et al., 1999Go; Vrana et al., 2000Go; Vrana et al., 1998Go). We propose that loss of imprinting is a consequence of the failure to maintain imprinting in the preimplantation embryo and that trophectodermal cells might be more sensitive to preimplantation epigenetic upset than ICMs. We can formulate several explanations for the differential response of placental tissues to preimplantation development in culture; trophectoderm cells are in closer contact with the culture medium, are the first cells to differentiate in the embryo and/or have less redundancy in epigenetic modifications that maintain imprints.

Initial studies to determine whether loss of methylation imprints occurs selectively in the trophectoderm revealed that ICMs isolated using immunosurgery and subjected to bisulfite mutagenesis analysis experience a similar loss of methylation to DNA from intact blastocysts (data not shown). While this suggests that loss of methylation might occur randomly in the preimplantation embryo, we cannot rule out the possibility that loss of imprinting within the ICM occurs in cells that have differentiated into or are destined to become primitive endoderm, an extra-embryonic cell-type. Thus, we envision two different scenarios. In the first, extra-embryonic cells are more affected by culture and this translates into loss of imprinting in mid-gestation placentas. In the second, loss of imprinting may also occur in cells destined to become the embryo. Later, these cells are able to restore imprinted expression and methylation. Consistent with this, biallelic expression was occasionally observed in the embryo, suggesting that mechanisms that safeguard imprinting might be more robust in the embryo than in the placenta. Of note is that there is a wave of de novo methylation that is lineage-restricted, occurring in ICM but not in trophectoderm lineages (Monk et al., 1987Go; Santos et al., 2002Go). DNA methyltransferases and methyl-binding domain proteins are probable key players in this process and are transcribed in mouse and human blastocysts and embryonic stem (ES) cells (Chen et al., 2003Go; Huntriss et al., 2004Go; Okano et al., 1998Go). While the somatic form of DNMT1 maintains methylation in ES cells and postimplantation embryos, DNMT3a and 3b probably have roles in both de novo-related and maintenance-related methylation of imprinted genes (Chen et al., 2003Go; Lei et al., 1996Go; Okano et al., 1998Go). Interestingly, DNMT3b localizes exclusively to the ICM and its derivates at E4.5 to 7.0 (Watanabe et al., 2002Go). Therefore, lack of this protein in trophectoderm cells might offer one explanation for their inability to restore methylation imprints in the placenta.

The results reported here might be relevant to the treatment of human infertility by assisted reproductive technologies (ART). Our data indicate that loss of imprinting occurs after the 2-cell stage and prior to the blastocyst stage. As reductions in the level of transcript abundance of non-housekeeping genes following Whitten's culture were present as early as the 8-cell stage (Ho et al., 1995Go), epigenetic dysregulation in general might be an early event. In humans, ART has been linked to a higher incidence of interuterine growth retardation, premature birth and low birth weight (Maher et al., 2003aGo), suggesting a loss of epigenetic regulation during preimplantation development. Recently, ART procedures have also become suspect in the generation of sporadic epigenetic errors that result in the development of two imprinting disorders, Angelman and Beckwith-Wiedemann syndromes (Cox et al., 2002Go; DeBaun et al., 2003Go; Gicquel et al., 2003Go; Maher et al., 2003bGo; Orstavik et al., 2003Go). Furthermore, an increased incidence of monozygotic twinning occurs in the latter with the affected twin exhibiting loss of imprinting (Weksberg et al., 2002Go), intimating a period of sensitivity during early embryogenesis. Pinpointing the timing of epigenetic misregulation in mice and humans may reveal a common pathway in mechanisms that maintain imprinting during preimplantation development.


    ACKNOWLEDGMENTS
 
We thank Paula Stein and Zhe Xu for assistance with embryo transfers. This work was supported by NIH grant HD-42026 to M.S.B. and R.M.S. and the Howard Hughes Medical Institute to M.S.B. M.R.W.M. was supported by the Lalor Foundation fellowship and R.I.V. by the Rena and Vic Damone American Cancer Society fellowship.


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 


Bartolomei, M. S. and Tilghman, S. M. (1997). Genomic imprinting in mammals. Annu. Rev. Genet. 31,493 -525.[CrossRef][Medline]
Barton, S. C., Surani, M. A. H. and Norris, M. L. (1984). Role of paternal and maternal genomes in mouse development. Nature 311,374 -376.[CrossRef][Medline]
Bowman, P. and McLaren, A. (1970). Viability and growth of mouse embryos after in vitro culture and fusion. J. Embryol. Exp. Morphol. 23,693 -704.[Medline]
Caspary, T., Cleary, M. A., Baker, C. C., Guan, X.-J. and Tilghman, S. M. (1998). Multiple mechanisms regulate imprinting of the mouse distal chromosome 7 gene cluster. Mol. Cell Biol. 18,3466 -3474.[Abstract/Free Full Text]
Chen, T., Ueda, Y., Dodge, J. E., Wang, Z. and Li, E. (2003). Establishment and maintenance of genomic methylation patterns in mouse embryonic stem cells by Dnmt3a and Dnmt3b. Mol. Cell Biol. 23,5594 -5605.[Abstract/Free Full Text]
Cox, G. F., Burger, J., Lip, V., Mau, U. A., Sperling, K., Wu, B. L. and Horsthemke, B. (2002). Intracytoplasmic sperm injection may increase the risk of imprinting defects. Am. J. Hum. Genet. 71,162 -164.[CrossRef][Medline]
Davis, T. L., Trasler, J. M., Moss, S. B., Yang, G. J. and Bartolomei, M. S. (1999). Acquisition of the H19 methylation imprint occurs differentially on the parental alleles during spermatogenesis. Genomics 58, 18-28.[CrossRef][Medline]
Dean, W., Bowden, L., Aitchison, A., Klose, J., Moore, T., Meneses, J. J., Reik, W. and Feil, R. (1998). Altered imprinted gene methylation and expression in completely ES cell-derived mouse fetuses: association with aberrant phenotypes. Development 125,2273 -2282.[Abstract]
DeBaun, M. R., Niemitz, E. L. and Feinberg, A. P. (2003). Association of in vitro fertilization with Beckwith-Wiedemann syndrome and epigenetic alterations of LIT1 and H19. Am. J. Hum. Genet. 72,156 -160.[CrossRef][Medline]
Doherty, A. S., Mann, M. R. W., Tremblay, K. D., Bartolomei, M. S. and Schultz, R. M. (2000). Differential effects of culture on imprinted H19 expression in the preimplantation mouse embryo. Biol. Reprod. 62,1526 -1535.[Abstract/Free Full Text]
Gicquel, C., Gaston, V., Mandelbaum, J., Siffroi, J. P., Flahault, A. and Le Bouc, Y. (2003). In vitro fertilization may increase the risk of Beckwith-Wiedemann syndrome related to the abnormal imprinting of the KCN1OT gene. Am. J. Hum. Genet. 72,1338 -1341.[CrossRef][Medline]
Ho, Y., Wigglesworth, K., Eppig, J. J. and Schultz, R. M. (1995). Preimplantation development of mouse embryos in KSOM: augmentation by amino acids and analysis of gene expression. Mol. Reprod. Dev. 41,232 -238.[CrossRef][Medline]
Huntriss, J., Hinkins, M., Oliver, B., Harris, S. E., Beazley, J. C., Rutherford, A. J., Gosden, R. G., Lanzendorf, S. E. and Picton, H. M. (2004). Expression of mRNAs for DNA methyltransferases and methyl-CpG-binding proteins in the human female germ line, preimplantation embryos, and embryonic stem cells. Mol. Reprod. Dev. 67,323 -336.[CrossRef][Medline]
Khosla, S., Dean, W., Brown, D., Reik, W. and Feil, R. (2001). Culture of preimplantation mouse embryos affects fetal development and the expression of imprinted genes. Biol. Reprod. 64,918 -926.[Abstract/Free Full Text]
Lee, J. T. (2000). Disruption of imprinted X inactivation by parent-of-origin effects at Tsix. Cell 103,17 -27.[CrossRef][Medline]
Lei, H., Oh, S. P., Okano, M., Juttermann, R., Goss, K. A., Jaenisch, R. and Li, E. (1996). De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development 122,3195 -3205.[Abstract]
Lucifero, D., Mertineit, C., Clarke, H. J., Bestor, T. H. and Trasler, J. M. (2002). Methylation dynamics of imprinted genes in mouse germ cells. Genomics 79,530 -538.[CrossRef][Medline]
Maher, E. R. and Reik, W. (2000). Beckwith-Wiedemann syndrome: imprinting in clusters revisited. J. Clin. Invest. 105,247 -252.[Medline]
Maher, E. R., Afnan, M. and Barratt, C. L. (2003a). Epigenetic risks related to assisted reproductive technologies: epigenetics, imprinting, ART and icebergs? Hum. Reprod. 18,2508 -2511.[Abstract/Free Full Text]
Maher, E. R., Brueton, L. A., Bowdin, S. C., Luharia, A., Cooper, W., Cole, T. R., Macdonald, F., Sampson, J. R., Barratt, C. L., Reik, W. et al. (2003b). Beckwith-Wiedemann syndrome and assisted reproduction technology (ART). J. Med. Genet. 40, 62-64.[Free Full Text]
Mann, M. R. W., Chung, Y. G., Nolen, L. D., Verona, R. I., Latham, K. E. and Bartolomei, M. S. (2003). Disruption of imprinted gene methylation and expression in cloned preimplantation stage mouse embryos. Biol. Reprod. 69,902 -914.[Abstract/Free Full Text]
McDonald, L. E., Paterson, C. A. and Kay, G. F. (1998). Bisulfite genomic sequencing-derived methylation profile of the xist gene throughout early mouse development. Genomics 54,379 -386.[CrossRef][Medline]
McGrath, J. and Solter, D. (1984). Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell 37,179 -183.[CrossRef][Medline]
Moglabey, Y. B., Kircheisen, R., Seoud, M., El Mogharbel, N., Van den Veyver, I. and Slim, R. (1999). Genetic mapping of a maternal locus responsible for familial hydatidiform moles. Hum. Mol. Genet. 8,667 -671.[Abstract/Free Full Text]
Monk, M., Boubelik, M. and Lehnert, S. (1987). Temporal and regional changes in DNA methylation in the embryonic, extraembryonic and germ cell lineages during mouse embryo development. Development 99,371 -382.[Abstract]
Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W. and Roder, J. C. (1993). Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc. Natl. Acad. Sci. USA 90,8424 -8428.[Abstract/Free Full Text]
Nicholls, R. D. and Knepper, J. L. (2001). Genome organization, function, and imprinting in Prader-Willi and Angelman syndromes. Annu. Rev. Genomics Hum. Genet. 2, 153-175.[CrossRef][Medline]
Okano, M., Xie, S. and Li, E. (1998). Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases. Nat. Genet. 19,219 -220.[CrossRef][Medline]
Olek, A., Oswald, J. and Walter, J. (1996). A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. 24,5064 -5066.[Abstract/Free Full Text]
Orstavik, K. H., Eiklid, K., van der Hagen, C. B., Spetalen, S., Kierulf, K., Skjeldal, O. and Buiting, K. (2003). Another case of imprinting defect in a girl with Angelman syndrome who was conceived by intracytoplasmic semen injection. Am. J. Hum. Genet. 72,218 -219.[CrossRef][Medline]
Percec, I., Plenge, R. M., Nadeau, J. H., Bartolomei, M. S. and Willard, H. F. (2002). Autosomal dominant mutations affecting X inactivation choice in the mouse. Science 296,1136 -1139.[Abstract/Free Full Text]
Pfeifer, K. (2000). Mechanisms of genomic imprinting. Am. J. Hum. Genet. 67,777 -787.[CrossRef][Medline]
Plath, K., Mlynarczyk-Evans, S., Nusinow, D. A. and Panning, B. (2002). Xist RNA and the mechanism of X chromosome inactivation. Annu. Rev. Genet. 36,233 -278.[CrossRef][Medline]
Prissette, M., El-Maarri, O., Arnaud, D., Walter, J. and Avner, P. (2001). Methylation profiles of DXPas34 during the onset of X-inactivation. Hum. Mol. Genet. 10, 31-38.[Abstract/Free Full Text]
Reik, W., Rîmer, I., Barton, S. C., Surani, M. A., Howlett, S. K. and Klose, J. (1993). Adult phenotype in the mouse can be affected by epigenetic events in the early embryo. Development 119,933 -942.[Abstract/Free Full Text]
Sado, T., Wang, Z., Sasaki, H. and Li, E. (2001). Regulation of imprinted X-chromosome inactivation in mice by Tsix. Development 128,1275 -1286.[Abstract]
Santos, F., Hendrich, B., Reik, W. and Dean, W. (2002). Dynamic reprogramming of DNA methylation in the early mouse embryo. Dev. Biol. 241,172 -182.[CrossRef][Medline]
Sasaki, H., Ferguson-Smith, A. C., Shum, A. S. W., Barton, S. C. and Surani, M. A. (1995). Temporal and spatial regulation of H19 imprinting in normal and uniparental mouse embryos. Development 121,4195 -4202.[Abstract]
Schoenherr, C. J., Levorse, J. M. and Tilghman, S. M. (2003). CTCF maintains differential methylation at the Igf2/H19 locus. Nat. Genet. 33,66 -69.[CrossRef][Medline]
Shamanski, F. L., Kimura, Y., Lavoir, M.-C., Pedersen, R. A. and Yanagimachi, R. (1999). Status of genomic imprinting in mouse spermatids. Human Reprod. 14,1050 -1056.[Abstract/Free Full Text]
Tanaka, M., Puchyr, M., Gertsenstein, M., Harpal, K., Jaenisch, R., Rossant, J. and Nagy, A. (1999). Parental origin-specific expression of Mash2 is established at the time of implantation with its imprinting mechanism highly resistant to genome-wide demethylation. Mech. Dev. 87,129 -142.[CrossRef][Medline]
Tremblay, K. D., Duran, K. L. and Bartolomei, M. S. (1997). A 5' 2-kilobase-pair region of the imprinted mouse H19 gene exhibits exclusive paternal methylation throughout development. Mol. Cell Biol. 17,4322 -4329.[Abstract]
Verona, R. I., Mann, M. R. and Bartolomei, M. S. (2003). Genomic imprinting: intricacies of epigenetic regulation in clusters. Annu. Rev. Cell Dev. Biol. 19,237 -259.[CrossRef][Medline]
Vrana, P. B., Guan, X. J., Ingram, R. S. and Tilghman, S. M. (1998). Genomic imprinting is disrupted in interspecific Peromyscus hybrids. Nat. Genet. 20,362 -365.[CrossRef][Medline]
Vrana, P. B., Fossella, J. A., Matteson, P., del Rio, T., O'Neill, M. J. and Tilghman, S. M. (2000). Genetic and epigenetic incompatibilities underlie hybrid dysgenesis in Peromyscus. Nat. Genet. 25,120 -124.[CrossRef][Medline]
Watanabe, D., Suetake, I., Tada, T. and Tajima, S. (2002). Stage- and cell-specific expression of Dnmt3a and Dnmt3b during embryogenesis. Mech. Dev. 118,187 -190.[CrossRef][Medline]
Weksberg, R., Shuman, C., Caluseriu, O., Smith, A. C., Fei, Y. L., Nishikawa, J., Stockley, T. L., Best, L., Chitayat, D., Olney, A. et al. (2002). Discordant KCNQ1OT1 imprinting in sets of monozygotic twins discordant for Beckwith-Wiedemann syndrome. Hum. Mol. Genet. 11,1317 -1325.[Abstract/Free Full Text]
Yamazaki, Y., Mann, M. R., Lee, S. S., Marh, J., McCarrey, J. R., Yanagimachi, R. and Bartolomei, M. S. (2003). Reprogramming of primordial germ cells begins before migration into the genital ridge, making these cells inadequate donors for reproductive cloning. Proc. Natl. Acad. Sci. USA 100,12207 -12212.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related articles in Development:

An imprint that lasts

Development 2004 131: e1506. [Full Text]  



This article has been cited by other articles:


Home page
Hum ReprodHome page
C.-G. Liang, Z. Han, Y. Cheng, Z. Zhong, and K. E. Latham
Effects of ooplasm transfer on paternal genome function in mice
Hum. Reprod., November 1, 2009; 24(11): 2718 - 2728.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Katari, N. Turan, M. Bibikova, O. Erinle, R. Chalian, M. Foster, J. P. Gaughan, C. Coutifaris, and C. Sapienza
DNA methylation and gene expression differences in children conceived in vitro or in vivo
Hum. Mol. Genet., October 15, 2009; 18(20): 3769 - 3778.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
P. C. Haycock and M. Ramsay
Exposure of Mouse Embryos to Ethanol During Preimplantation Development: Effect on DNA Methylation in the H19 Imprinting Control Region
Biol Reprod, October 1, 2009; 81(4): 618 - 627.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. Li, Z. Chen, Z. Liu, J. Huang, W. Zhang, L. Zhou, D. L. Keefe, and L. Liu
Correlation of expression and methylation of imprinted genes with pluripotency of parthenogenetic embryonic stem cells
Hum. Mol. Genet., June 15, 2009; 18(12): 2177 - 2187.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
F. L. Lopes, A. L. Fortier, N. Darricarrere, D. Chan, D. R. Arnold, and J. M. Trasler
Reproductive and epigenetic outcomes associated with aging mouse oocytes
Hum. Mol. Genet., June 1, 2009; 18(11): 2032 - 2044.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
R. Fernandez-Gonzalez, J. de Dios Hourcade, I. Lopez-Vidriero, A. Benguria, F. R. De Fonseca, and A. Gutierrez-Adan
Analysis of gene transcription alterations at the blastocyst stage related to the long-term consequences of in vitro culture in mice
Reproduction, February 1, 2009; 137(2): 271 - 283.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
D. J. Amor and J. Halliday
A review of known imprinting syndromes and their association with assisted reproduction technologies
Hum. Reprod., December 1, 2008; 23(12): 2826 - 2834.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
Y. S. Lee, K. E. Latham, and C. A. VandeVoort
Effects of in vitro maturation on gene expression in rhesus monkey oocytes
Physiol Genomics, October 8, 2008; 35(2): 145 - 158.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
H. D. Morgan, X. L. Jin, A. Li, E. Whitelaw, and C. O'Neill
The Culture of Zygotes to the Blastocyst Stage Changes the Postnatal Expression of an Epigentically Labile Allele, Agouti Viable Yellow, in Mice
Biol Reprod, October 1, 2008; 79(4): 618 - 623.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
R. Hirasawa, H. Chiba, M. Kaneda, S. Tajima, E. Li, R. Jaenisch, and H. Sasaki
Maternal and zygotic Dnmt1 are necessary and sufficient for the maintenance of DNA methylation imprints during preimplantation development
Genes & Dev., June 15, 2008; 22(12): 1607 - 1616.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. L. Fortier, F. L. Lopes, N. Darricarrere, J. Martel, and J. M. Trasler
Superovulation alters the expression of imprinted genes in the midgestation mouse placenta
Hum. Mol. Genet., June 1, 2008; 17(11): 1653 - 1665.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. J. Watkins, A. Wilkins, C. Cunningham, V. H. Perry, M. J. Seet, C. Osmond, J. J. Eckert, C. Torrens, F. R. A. Cagampang, J. Cleal, et al.
Low protein diet fed exclusively during mouse oocyte maturation leads to behavioural and cardiovascular abnormalities in offspring
J. Physiol., April 15, 2008; 586(8): 2231 - 2244.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
V. Duranthon, A. J Watson, and P. Lonergan
Preimplantation embryo programming: transcription, epigenetics, and culture environment
Reproduction, February 1, 2008; 135(2): 141 - 150.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Wagschal, H. G. Sutherland, K. Woodfine, A. Henckel, K. Chebli, R. Schulz, R. J. Oakey, W. A. Bickmore, and R. Feil
G9a Histone Methyltransferase Contributes to Imprinting in the Mouse Placenta
Mol. Cell. Biol., February 1, 2008; 28(3): 1104 - 1113.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
R. M. Rivera, P. Stein, J. R. Weaver, J. Mager, R. M. Schultz, and M. S. Bartolomei
Manipulations of mouse embryos prior to implantation result in aberrant expression of imprinted genes on day 9.5 of development
Hum. Mol. Genet., January 1, 2008; 17(1): 1 - 14.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
A. Thurston, J. Taylor, J. Gardner, K. D Sinclair, and L. E Young
Monoallelic expression of nine imprinted genes in the sheep embryo occurs after the blastocyst stage
Reproduction, January 1, 2008; 135(1): 29 - 40.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
K.-P. Kim, A. Thurston, C. Mummery, D. Ward-van Oostwaard, H. Priddle, C. Allegrucci, C. Denning, and L. Young
Gene-specific vulnerability to imprinting variability in human embryonic stem cell lines
Genome Res., December 1, 2007; 17(12): 1731 - 1742.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
P. J. Rugg-Gunn, A. C. Ferguson-Smith, and R. A. Pedersen
Status of genomic imprinting in human embryonic stem cells as revealed by a large cohort of independently derived and maintained lines
Hum. Mol. Genet., October 15, 2007; 16(R2): R243 - R251.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. M. Schultz
Of light and mouse embryos: Less is more
PNAS, September 11, 2007; 104(37): 14547 - 14548.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Takenaka, T. Horiuchi, and R. Yanagimachi
Effects of light on development of mammalian zygotes
PNAS, September 4, 2007; 104(36): 14289 - 14293.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. Rosenwaks and K. Bendikson
Further evidence of the safety of assisted reproductive technologies
PNAS, April 3, 2007; 104(14): 5709 - 5710.
[Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S. Markoulaki, M. Kurokawa, S.-Y. Yoon, S. Matson, T. Ducibella, and R. Fissore
Comparison of Ca2+ and CaMKII responses in IVF and ICSI in the mouse
Mol. Hum. Reprod., April 1, 2007; 13(4): 265 - 272.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Caperton, P. Murphey, Y. Yamazaki, C. A. McMahan, C. A. Walter, R. Yanagimachi, and J. R. McCarrey
From the Cover: Assisted reproductive technologies do not alter mutation frequency or spectrum
PNAS, March 20, 2007; 104(12): 5085 - 5090.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
A. Pesty, F. Miyara, P. Debey, B. Lefevre, and C. Poirot
Multiparameter assessment of mouse oogenesis during follicular growth in vitro
Mol. Hum. Reprod., January 1, 2007; 13(1): 3 - 9.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
A. Sato, E. Otsu, H. Negishi, T. Utsunomiya, and T. Arima
Aberrant DNA methylation of imprinted loci in superovulated oocytes
Hum. Reprod., January 1, 2007; 22(1): 26 - 35.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S Rossignol, V Steunou, C Chalas, A Kerjean, M Rigolet, E Viegas-Pequignot, P Jouannet, Y Le Bouc, and C Gicquel
The epigenetic imprinting defect of patients with Beckwith--Wiedemann syndrome born after assisted reproductive technology is not restricted to the 11p15 region
J. Med. Genet., December 1, 2006; 43(12): 902 - 907.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. Lucifero, J. Suzuki, V. Bordignon, J. Martel, C. Vigneault, J. Therrien, F. Filion, L. C. Smith, and J. M. Trasler
Bovine SNRPN Methylation Imprint in Oocytes and Day 17 In Vitro-Produced and Somatic Cell Nuclear Transfer Embryos
Biol Reprod, October 1, 2006; 75(4): 531 - 538.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
W. Y. Kwong, D. J Miller, E. Ursell, A. E Wild, A. P Wilkins, C. Osmond, F. W Anthony, and T. P Fleming
Imprinted gene expression in the rat embryo-fetal axis is altered in response to periconceptional maternal low protein diet.
Reproduction, August 1, 2006; 132(2): 265 - 277.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
D. Feil, M. Lane, C. T. Roberts, R. L. Kelley, L. J. Edwards, J. G. Thompson, and K. L. Kind
Effect of culturing mouse embryos under different oxygen concentrations on subsequent fetal and placental development
J. Physiol., April 1, 2006; 572(1): 87 - 96.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
L. J. Van Winkle, J. K. Tesch, A. Shah, and A. L. Campione
System B0,+ amino acid transport regulates the penetration stage of blastocyst implantation with possible long-term developmental consequences through adulthood
Hum. Reprod. Update, March 1, 2006; 12(2): 145 - 157.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
C. De Geyter, M. De Geyter, S. Steimann, H. Zhang, and W. Holzgreve
Comparative birth weights of singletons born after assisted reproduction and natural conception in previously infertile women
Hum. Reprod., March 1, 2006; 21(3): 705 - 712.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. L. Thorvaldsen, A. M. Fedoriw, S. Nguyen, and M. S. Bartolomei
Developmental Profile of H19 Differentially Methylated Domain (DMD) Deletion Alleles Reveals Multiple Roles of the DMD in Regulating Allelic Expression and DNA Methylation at the Imprinted H19/Igf2 Locus
Mol. Cell. Biol., February 15, 2006; 26(4): 1245 - 1258.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
B. W. Sun, A. C. Yang, Y. Feng, Y. J. Sun, Y. f. Zhu, Y. Zhang, H. Jiang, C. L. Li, F. R. Gao, Z. H. Zhang, et al.
Temporal and parental-specific expression of imprinted genes in a newly derived Chinese human embryonic stem cell line and embryoid bodies
Hum. Mol. Genet., January 1, 2006; 15(1): 65 - 75.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
R. M Schultz
From egg to embryo: a peripatetic journey
Reproduction, December 1, 2005; 130(6): 825 - 828.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
J. Sommovilla, W. B Bilker, T. Abel, and R. M Schultz
Embryo culture does not affect the longevity of offspring in mice
Reproduction, November 1, 2005; 130(5): 599 - 601.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
T. Li, T. H. Vu, G. A. Ulaner, E. Littman, J.-Q. Ling, H.-L. Chen, J.-F. Hu, B. Behr, L. Giudice, and A. R. Hoffman
IVF results in de novo DNA methylation and histone methylation at an Igf2-H19 imprinting epigenetic switch
Mol. Hum. Reprod., September 1, 2005; 11(9): 631 - 640.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. Gallou-Kabani and C. Junien
Nutritional Epigenomics of Metabolic Syndrome: New Perspective Against the Epidemic
Diabetes, July 1, 2005; 54(7): 1899 - 1906.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. M. Roberts
Embryo Culture Conditions: What Embryos Like Best
Endocrinology, May 1, 2005; 146(5): 2140 - 2141.
[Full Text] [PDF]


Home page
EndocrinologyHome page
C. Sjoblom, C. T. Roberts, M. Wikland, and S. A. Robertson
Granulocyte-Macrophage Colony-Stimulating Factor Alleviates Adverse Consequences of Embryo Culture on Fetal Growth Trajectory and Placental Morphogenesis
Endocrinology, May 1, 2005; 146(5): 2142 - 2153.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. J. Edwards, K. L. Kind, D. T. Armstrong, and J. G. Thompson
Effects of recombinant human follicle-stimulating hormone on embryo development in mice
Am J Physiol Endocrinol Metab, May 1, 2005; 288(5): E845 - E851.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. R. Maher
Imprinting and assisted reproductive technology
Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R133 - R138.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
M. Benchaib, V. Braun, D. Ressnikof, J. Lornage, P. Durand, A. Niveleau, and J.F. Guerin
Influence of global sperm DNA methylation on IVF results
Hum. Reprod., March 1, 2005; 20(3): 768 - 773.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.01241v1
131/15/3727    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Development
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mann, M. R. W.
Right arrow Articles by Bartolomei, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mann, M. R. W.
Right arrow Articles by Bartolomei, M. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?