|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 7 July 2004
doi: 10.1242/dev.01241
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Howard Hughes Medical Institute and Department of Cell and Developmental
Biology, University of Pennsylvania School of Medicine, Philadelphia, PA
19104, USA
2 Department of Biology, University of Pennsylvania, Philadelphia, PA 19104,
USA
* Author for correspondence (e-mail: bartolom{at}mail.med.upenn.edu)
Accepted 26 April 2004
| SUMMARY |
|---|
|
|
|---|
65%) exhibited biallelic expression, while others
maintained imprinted H19 expression. Loss of H19 imprinting
persisted in mid-gestation conceptuses. Placental tissues displayed activation
of the normally silent allele for H19, Ascl2, Snrpn, Peg3 and
Xist while in the embryo proper imprinted expression for the most
part was preserved. Loss of imprinted expression was associated with a
decrease in methylation at the H19 and Snrpn imprinting
control regions. These results indicate that tissues of trophectoderm origin
are unable to restore genomic imprints and suggest that mechanisms that
safeguard imprinting might be more robust in the embryo than in the
placenta.
Key words: Imprinting, DNA methylation, Placenta, H19, Snrpn, Peg3, Ascl2, Xist, Mouse
| Introduction |
|---|
|
|
|---|
Imprinting may be envisaged as a multi-step process that begins in the
parental gametes, where epigenetic modifications differentially mark the
parental alleles. These parental-specific marks must then be stably maintained
during cellular division and differentiation, including during preimplantation
development, and finally they must be translated into parental-specific
monoallelic expression (Pfeifer,
2000
). Disruptions in any of these steps may lead to loss of
parental-specific expression.
We and others have previously demonstrated that imprinting can be disrupted
during preimplantation development; in vitro preimplantation culture of
embryos resulted in biallelic expression of the H19 gene
(Doherty et al., 2000
;
Sasaki et al., 1995
). These
results support the hypothesis that gametic imprints are labile, for at least
one imprinted gene, during this dynamic period of development. However, a
comprehensive analysis of loss of imprinting arising during preimplantation
development has not been conducted in any species. Many questions remain
unanswered, such as: whether all blastocysts or only a subset lose
H19 imprinting; whether blastocysts that lose imprinted expression
are able to restore imprinting of the H19 gene during
postimplantation development; whether other imprinted genes and epigenetic
processes display long-term effects of epigenetic errors; and finally, whether
loss of imprinting depends on tissue type.
To address these questions we undertook a detailed analysis of
allele-specific expression and DNA methylation of imprinted genes after in
vitro preimplantation culture of mouse embryos. At the single embryo level,
only a subset of individual, Whitten's cultured blastocysts (
65%)
displayed biallelic expression, while others maintained allele-specific
H19 expression. Analysis of mid-gestation conceptuses revealed that
loss of H19 imprinting persisted postimplantation. Placental tissues
displayed biallelic expression for multiple imprinted genes, including
H19 and Snrpn, while in the embryo proper, imprinted
expression was mainly preserved, suggesting that there may be tissue-specific
epigenetic disruptions that occurred during preimplantation development. Loss
of imprinted expression was associated with reduced methylation at the
H19 and Snrpn imprinting control regions (ICRs). These
results indicate that genomic imprints are labile in tissues of trophectoderm
origin and may be perturbed during preimplantation development.
| Materials and methods |
|---|
|
|
|---|
Embryos were recovered at the 2-cell stage and cultured in Whitten's medium
or in KSOM augmented with amino acids as described
(Doherty et al., 2000
). For
postimplantation analysis, cultured blastocysts were transferred to
stage-matched pseudopregnant recipients, and embryos and placentas were
recovered at embryonic day (E) 9.5.
Allele-specific expression analysis of blastocyst-stage embryos
Individual blastocysts or pools of blastocysts (
10) were placed in 100
µl Dynal Lysis Buffer, vortexed and stored at -80°C. Dynabeads Oligo
(dT)25 (Dynal) were equilibrated with 100 µl Dynal Lysis Buffer
according to the manufacturer's instructions. Isolation of mRNA and reverse
transcription, or generation of Dynabead Oligo (dT)25
covalently-linked cDNA libraries and second strand synthesis were performed as
described (Mann et al.,
2003
).
The H19 and Snrpn expression assays were conducted on
cDNA using the LightCycler Real Time PCR System (Roche Molecular Biochemicals)
as described (Mann et al.,
2003
) except for the Snrpn assay, for which Genset
hybridization probes were used, DMSO was omitted, and amplification and
melting curve analysis was performed as follows. After an initial denaturation
step at 95°C for 2 minutes, amplification was performed for 45 cycles at
95°C for 1 second, 50°C for 15 seconds and 72°C for 6 seconds.
After amplification, a final denaturation and annealing step was conducted
(95°C for 0 seconds, 45°C for 15 seconds) then the temperature was
increased from 45 to 85°C in 0.2°C increments. Alternatively, Idaho
Technologies probes were employed, DMSO was omitted, amplification was
performed for 45 cycles and the melting curve analysis was performed as
follows. A final denaturation step was conducted at 95°C for 4 minutes,
followed by annealing at 35°C for 3 minutes, 40°C for 1 minute and
45°C for 1 minute, and melting curve analysis with fluorescence
acquisition occurred continuously as the temperature was increased from 45 to
85°C in 0.5°C increments.
For the Peg3 analysis, Peg3 primers (final concentration 0.3 µM), Peg11 (5'AAGGCTCTGGTTGACAGTCGTG3') and Peg12 (5'TTCTCCTTGGTCTCACGGGC3'), amplified a 239 bp fragment (95°C for 2 minutes followed by 34 cycles at 95°C for 15 seconds, 52°C for 10 seconds and 72°C for 20 seconds) containing a polymorphism between B6 (A) and CAST (G) (position 3451, AF038939). Restriction digestion with TaaI resulted in 224 bp and 16 bp fragments in B6 and 148, 76 and 16 bp fragments in CAST. Parental allele-specific expression patterns for all genes were calculated as the percentage expression of the B6 or CAST allele relative to the total expression of both alleles.
E9.5 embryo and placental RNA isolation and expression assays
Embryos and placentas were recovered at E9.5 and RNA was isolated using the
HighPure RNA Tissue Kit (Roche Molecular Biochemicals), with minor
modifications to the manufacturer's recommendations. cDNA synthesis was
performed as described (Percec et al.,
2002
).
Allele-specific H19 and Snrpn expression assays were
conducted on E9.5 embryo and placental cDNA using the LightCycler Real Time
PCR System as described above. For Peg3 and Ascl2, PCR
amplification was conducted on cDNA under conditions specific for each primer
set. To a Ready-To-Go PCR Bead, 0.3 µM of each primer and
[
-32P]dCTP (1 µCi) were added. PCR amplification was
performed for 30 cycles as described above
(Mann et al., 2003
). Products
were resolved on a 7% polyacrylamide gel. After exposure (approximately 15
hours), the relative band intensities were quantified using ImageQuant
(Molecular Dynamics). The Xist expression assay was conducted on E9.5
embryo and placental cDNA using the LightCycler Real Time PCR System as
described (Percec et al.,
2002
).
Genotyping the sex of E9.5 conceptuses
DNA was extracted from E9.5 yolk sacs and amplified using primers for
Zfy to determine embryo sex (i.e. the presence of the Y chromosome)
and for Mkrn3 to control for DNA extraction as described
(Yamazaki et al., 2003
).
Allele-specific DNA methylation analysis
DNA was isolated from pools of 25-30 blastocysts and from individual
embryos and placentas obtained at E9.5, subjected to bisulfite modification,
PCR amplification, subcloning and sequencing as previously described for the
H19 differentially methylated domain (DMD) (1304-1726 bp, U19619) and
Snurf-Snrpn (herein referred to as Snrpn) promoter-exon 1
region (2073-2601 bp, AF081460) (Davis et
al., 1999
; Mann et al.,
2003
). Alternatively, bisulfite mutagenesis sequencing with
agarose embedding was conducted on whole blastocysts
(Olek et al., 1996
;
Schoenherr et al., 2003
). At
least two independent PCRs were performed on each sample. H19 and
Snrpn parental alleles were distinguished by single nucleotide
polymorphisms as previously reported
(Lucifero et al., 2002
;
Mann et al., 2003
;
Tremblay et al., 1997
).
| Results |
|---|
|
|
|---|
|
|
These genotypic effects led us to hypothesize that strain-specific
modifiers might affect maintenance of the H19 imprint. In
Peromyscus mice, an imprinting modifier is linked to Peg3
(Vrana et al., 2000
) and in
humans, the orthologous region is linked to an imprinting defect that gives
rise to recurrent biparental, complete hydatidiform moles
(Moglabey et al., 1999
). Thus,
the proximal portion of Mus musculus chromosome 7 containing the
Peg3 gene may harbor a presumptive modifier that offers `protection'
from environmental stress when inherited from a B6 mother. To test this, we
compared maintenance of H19 imprinted expression in B6(CAST7) mice
(CAST for entire chromosome 7) and B6(CAST27-t) mice (B6 proximal,
CAST central and distal portions) following culture in Whitten's medium. No
difference was observed in the number of blastocysts with H19
biallelic expression, indicating that the putative modifier likely resides
elsewhere in the genome.
Parental-specific expression was next assayed in pools and individual B6(CAST7)XB6, B6(CAST27-t)XB6 and B6XB6(CAST7) embryos for two paternally transcribed genes, Snrpn and Peg3. Similarly to our previous study, embryos cultured in Whitten's medium or in KSOMaa maintained monoallelic expression of Snrpn (Table 1; data not shown). Likewise, the paternally expressed Peg3 gene also maintained imprinted expression after culture in KSOMaa and in Whitten's media, suggesting that expression of this gene is fairly resistant to epigenetic disturbances at the blastocyst stage (Table 1; data not shown).
Allele-specific methylation analysis of ICRs in cultured blastocysts
As methylation of distinct CpG-rich regions around imprinted genes plays an
important role in the control of monoallelic expression, methylation at the
H19 and Snrpn ICRs was assayed by bisulfite mutagenesis
analysis in cultured blastocysts. The H19 ICR (designated the
differentially methylated domain, or DMD) is paternally hypermethylated
(Tremblay et al., 1997
),
whereas the Snrpn promoter-exon 1 region is maternally
hypermethylated (J. Trasler and M. Toppings, personal communication) in in
vivo-derived blastocysts. Our analysis revealed that a large proportion of
paternal H19 strands lacked significant methylation in blastocysts
cultured in Whitten's medium; only 59% of paternal H19 strands
displayed the expected pattern of hypermethylation (defined as >50% CpGs on
a given strand methylated) (Fig.
2A). By comparison, in blastocysts cultured in KSOMaa, 77% of
paternal strands were methylated. One explanation for the proportion of
paternal hyper- and hypomethylated strands is the composition of blastocysts
within the pool; some blastocysts have maintained, while others have lost,
H19 imprinting. To test this hypothesis, we examined methylation of
the Snrpn ICR with the expectation that Snrpn monoallelic
expression would correlate with preservation of the methylation imprint.
Surprisingly, substantial loss of methylation was observed at the ICR of this
gene following Whitten's culture; similarly to H19, only 40% of
maternal Snrpn strands were hypermethylated, while the remaining
strands were hypomethylated (Fig.
2B). Blastocysts cultured in KSOMaa exhibited 82% maternal
hypermethylation; a loss of methylation comparable to that of
H19.
|
|
To determine whether there were global preimplantation culture effects on imprinting, two additional genes were examined in the E9.5 conceptuses. Similar to H19 and Snrpn, loss of imprinted expression of Ascl2 and Peg3 occurred in B6(CAST7)XB6 preimplantation Whitten's cultured placentas. By contrast to expectations, Peg3 was biallelically expressed in placentas from both crosses, suggesting that this gene is sensitive to preimplantation culture in Whitten's medium regardless of genetic background. Furthermore, expression of H19 and Ascl2 was also susceptible to disruption after preimplantation development in KSOMaa. Taken together, these data indicate that the effects of perturbations in preimplantation embryos can be seen long after they have been removed from the culture medium.
Analysis of individual genes revealed that not all placentas exhibited loss of imprinted expression, consistent with the observation that not all blastocysts expressed H19 biallelically. However, no single pattern emerged with respect to loss or maintenance of imprinted expression when all genes were considered, suggesting a stochastic response to preimplantation Whitten's culture. Occasionally, biallelic expression was observed in the embryo proper (Fig. 3, see W113 as an example), suggesting that although more resilient, imprinting in tissues arising from inner cell mass (ICM) might also be lost during preimplantation development. Loss of imprinted gene expression was independent of the sex of the embryo. Finally, no correlation was observed between the developmental phenotype of cultured embryos and loss of imprinted expression for the four genes examined.
Methylation analyses of ICRs in E9.5 conceptuses following preimplantation culture
Methylation associated with the ICRs of H19 and Snrpn was
assessed in preimplantation cultured and in vivo-derived conceptuses recovered
at E9.5. As predicted from the expression data, the paternal H19
allele was hypermethylated in B6(CAST7)XB6 Whitten's cultured E9.5 embryos
(100%, 100% and 83% strands for W35, W36 and W321, respectively)
(Fig. 4A). By contrast, one
B6(CAST7)XB6 Whitten's cultured E9.5 placenta (W35) exhibited a partial loss
of methylation with 63% paternal strands hypermethylated and placentas from
the other conceptuses displayed a substantial loss of methylation with 13%
(W36) and 10% (W321) paternal hypermethylation. Although different fetuses
were analyzed for imprinted methylation and expression, generally paternal
methylation loss (37-90%) correlated with the level of paternal activation
(
23-75%, to consider only paternal allelic contributions, percentage of
paternal expression was multiplied by 2). Allele-specific methylation was
preserved in a control B6XB6(CAST7) embryo (WBC5) with 100% paternal strands
hypermethylated, while in the placenta lower levels were observed (63%). All
paternal strands were hypermethylated in embryos and placentas that were in
vivo-derived or subjected to preimplantation KSOMaa culture, consistent with
the silent state of this allele.
|
53-100%, maternal expression multiplied by
2) than would have been predicted from the loss of maternal-specific
methylation (11-33%). By comparison, in vivo-derived and control B6XB6(CAST7)
placentas, and all embryos, maintained 100% Snrpn hypermethylation,
which correlated with maternal allele silencing.
Effects of in vitro culture on Xist expression
X-inactivation is an epigenetic process whereby one X chromosome is
inactivated in female cells. In embryonic tissues, X-inactivation occurs in a
random manner, while in extra-embryonic tissues there is preferential
inactivation of the paternal X chromosome
(Plath et al., 2002
). The
X-inactivation process is partly regulated by the X-inactive-specific
transcript (Xist). Xist is expressed from the inactive X
chromosome in females but not in males, where the sole X chromosome remains
active. To determine whether regulation of another epigenetic process was
affected under conditions that resulted in loss of imprinting, Xist
expression was examined in embryonic and placental tissues of E9.5 conceptuses
after preimplantation culture (Table
2). As female B6(CAST7)XB6 mice possess two B6 X chromosomes,
effects of preimplantation development in culture on Xist expression
was determined for males only. Male placental tissues from embryos that were
cultured to the blastocyst stage in Whitten's medium, and a proportion that
were cultured in KSOMaa, inappropriately expressed the Xist gene,
with the levels generally falling within the range observed for female
tissues, perhaps indicating that the imprinted form of X-inactivation was
disrupted. An absence of ectopic Xist expression in B6(CAST7)XB6 male
embryonic tissues suggests that the machinery regulating the random form of
X-inactivation was unaffected during preimplantation development or was
corrected as development proceeded. Thus, errors arising during
preimplantation can result in general epigenetic dysregulation in
trophectoderm lineages.
|
| Discussion |
|---|
|
|
|---|
In our initial study (Doherty et al.,
2000
), we proposed that H19 is hypersensitive to
environmental stress, as analysis of a second imprinted gene, Snrpn,
revealed that its imprinting is preserved in blastocysts after preimplantation
development in culture. However, biallelic expression of several imprinted
genes in postimplantation placentas, including Snrpn, after culture
in Whitten's medium indicates a more global effect on imprinting. This is
supported by the partial loss of methylation that was observed at the
Snrpn ICR in mid-gestation placentas that were derived from cultured
blastocysts. The less dramatic loss of methylation at Snrpn in
comparison with H19 and the lack of correlation between
Snrpn imprinted expression and methylation in blastocysts may
indicate that disruptions in methylation are not solely responsible for the
inability to maintain imprinted expression at this gene.
Loss of imprinted expression is also observed for Ascl2, an
imprinted gene that is normally biallelically expressed in blastocyst-stage
embryos but is monoallelically expressed in placentas. This result suggests
that culture in Whitten's medium either disrupted the imprinting mechanism
that regulates this gene at later stages or it did not allow the normal
imprinting control mechanism to initiate allele-specific expression at the
appropriate time in development. Interestingly, imprinted regulation of
Ascl2 operates in a methylation-independent manner
(Caspary et al., 1998
;
Tanaka et al., 1999
). The
Xist gene and its antisense transcript, Tsix, also lack
germline-derived methylation imprints
(McDonald et al., 1998
;
Prissette et al., 2001
). This
suggests either that imprinting is disrupted through different mechanisms for
distinct genes or that a uniform process upstream of methylation operates at
all imprinted loci, resulting in disruptions to both imprinted gene expression
and methylation.
In mice, loss of Tsix expression results in ectopic activation of
Xist from the normally silent maternal chromosome in females and
males (Lee, 2000
;
Sado et al., 2001
). In our
study, aberrant expression of the Xist gene in male placentas might
indicate that the antisense Tsix transcript is inactivated or that
transcription is not initiated, thereby resulting in ectopic Xist
expression. Alternatively, the Xist gene itself might be susceptible
to culture conditions, independent of the Tsix antisense transcript.
In either case, these results demonstrate that disturbances arising during
preimplantation can result in general epigenetic dysregulation in
trophectoderm lineages.
Placental tissues appear to be particularly sensitive to an imbalance of
imprinted gene expression. This has been clearly observed in parthenogenetic
and androgenetic embryos, in fetuses that underwent round spermatid injection
and in interspecific hybrids of Peromyscus mice
(Barton et al., 1984
;
McGrath and Solter, 1984
;
Shamanski et al., 1999
;
Vrana et al., 2000
;
Vrana et al., 1998
). We
propose that loss of imprinting is a consequence of the failure to maintain
imprinting in the preimplantation embryo and that trophectodermal cells might
be more sensitive to preimplantation epigenetic upset than ICMs. We can
formulate several explanations for the differential response of placental
tissues to preimplantation development in culture; trophectoderm cells are in
closer contact with the culture medium, are the first cells to differentiate
in the embryo and/or have less redundancy in epigenetic modifications that
maintain imprints.
Initial studies to determine whether loss of methylation imprints occurs
selectively in the trophectoderm revealed that ICMs isolated using
immunosurgery and subjected to bisulfite mutagenesis analysis experience a
similar loss of methylation to DNA from intact blastocysts (data not shown).
While this suggests that loss of methylation might occur randomly in the
preimplantation embryo, we cannot rule out the possibility that loss of
imprinting within the ICM occurs in cells that have differentiated into or are
destined to become primitive endoderm, an extra-embryonic cell-type. Thus, we
envision two different scenarios. In the first, extra-embryonic cells are more
affected by culture and this translates into loss of imprinting in
mid-gestation placentas. In the second, loss of imprinting may also occur in
cells destined to become the embryo. Later, these cells are able to restore
imprinted expression and methylation. Consistent with this, biallelic
expression was occasionally observed in the embryo, suggesting that mechanisms
that safeguard imprinting might be more robust in the embryo than in the
placenta. Of note is that there is a wave of de novo methylation that is
lineage-restricted, occurring in ICM but not in trophectoderm lineages
(Monk et al., 1987
;
Santos et al., 2002
). DNA
methyltransferases and methyl-binding domain proteins are probable key players
in this process and are transcribed in mouse and human blastocysts and
embryonic stem (ES) cells (Chen et al.,
2003
; Huntriss et al.,
2004
; Okano et al.,
1998
). While the somatic form of DNMT1 maintains methylation in ES
cells and postimplantation embryos, DNMT3a and 3b probably have roles in both
de novo-related and maintenance-related methylation of imprinted genes
(Chen et al., 2003
;
Lei et al., 1996
;
Okano et al., 1998
).
Interestingly, DNMT3b localizes exclusively to the ICM and its derivates at
E4.5 to 7.0 (Watanabe et al.,
2002
). Therefore, lack of this protein in trophectoderm cells
might offer one explanation for their inability to restore methylation
imprints in the placenta.
The results reported here might be relevant to the treatment of human
infertility by assisted reproductive technologies (ART). Our data indicate
that loss of imprinting occurs after the 2-cell stage and prior to the
blastocyst stage. As reductions in the level of transcript abundance of
non-housekeeping genes following Whitten's culture were present as early as
the 8-cell stage (Ho et al.,
1995
), epigenetic dysregulation in general might be an early
event. In humans, ART has been linked to a higher incidence of interuterine
growth retardation, premature birth and low birth weight
(Maher et al., 2003a
),
suggesting a loss of epigenetic regulation during preimplantation development.
Recently, ART procedures have also become suspect in the generation of
sporadic epigenetic errors that result in the development of two imprinting
disorders, Angelman and Beckwith-Wiedemann syndromes
(Cox et al., 2002
;
DeBaun et al., 2003
;
Gicquel et al., 2003
;
Maher et al., 2003b
;
Orstavik et al., 2003
).
Furthermore, an increased incidence of monozygotic twinning occurs in the
latter with the affected twin exhibiting loss of imprinting
(Weksberg et al., 2002
),
intimating a period of sensitivity during early embryogenesis. Pinpointing the
timing of epigenetic misregulation in mice and humans may reveal a common
pathway in mechanisms that maintain imprinting during preimplantation
development.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bartolomei, M. S. and Tilghman, S. M. (1997). Genomic imprinting in mammals. Annu. Rev. Genet. 31,493 -525.[CrossRef][Medline]
Barton, S. C., Surani, M. A. H. and Norris, M. L. (1984). Role of paternal and maternal genomes in mouse development. Nature 311,374 -376.[CrossRef][Medline]
Bowman, P. and McLaren, A. (1970). Viability and growth of mouse embryos after in vitro culture and fusion. J. Embryol. Exp. Morphol. 23,693 -704.[Medline]
Caspary, T., Cleary, M. A., Baker, C. C., Guan, X.-J. and
Tilghman, S. M. (1998). Multiple mechanisms regulate
imprinting of the mouse distal chromosome 7 gene cluster. Mol. Cell
Biol. 18,3466
-3474.
Chen, T., Ueda, Y., Dodge, J. E., Wang, Z. and Li, E.
(2003). Establishment and maintenance of genomic methylation
patterns in mouse embryonic stem cells by Dnmt3a and Dnmt3b. Mol.
Cell Biol. 23,5594
-5605.
Cox, G. F., Burger, J., Lip, V., Mau, U. A., Sperling, K., Wu, B. L. and Horsthemke, B. (2002). Intracytoplasmic sperm injection may increase the risk of imprinting defects. Am. J. Hum. Genet. 71,162 -164.[CrossRef][Medline]
Davis, T. L., Trasler, J. M., Moss, S. B., Yang, G. J. and Bartolomei, M. S. (1999). Acquisition of the H19 methylation imprint occurs differentially on the parental alleles during spermatogenesis. Genomics 58, 18-28.[CrossRef][Medline]
Dean, W., Bowden, L., Aitchison, A., Klose, J., Moore, T., Meneses, J. J., Reik, W. and Feil, R. (1998). Altered imprinted gene methylation and expression in completely ES cell-derived mouse fetuses: association with aberrant phenotypes. Development 125,2273 -2282.[Abstract]
DeBaun, M. R., Niemitz, E. L. and Feinberg, A. P. (2003). Association of in vitro fertilization with Beckwith-Wiedemann syndrome and epigenetic alterations of LIT1 and H19. Am. J. Hum. Genet. 72,156 -160.[CrossRef][Medline]
Doherty, A. S., Mann, M. R. W., Tremblay, K. D., Bartolomei, M.
S. and Schultz, R. M. (2000). Differential effects of culture
on imprinted H19 expression in the preimplantation mouse embryo.
Biol. Reprod. 62,1526
-1535.
Gicquel, C., Gaston, V., Mandelbaum, J., Siffroi, J. P., Flahault, A. and Le Bouc, Y. (2003). In vitro fertilization may increase the risk of Beckwith-Wiedemann syndrome related to the abnormal imprinting of the KCN1OT gene. Am. J. Hum. Genet. 72,1338 -1341.[CrossRef][Medline]
Ho, Y., Wigglesworth, K., Eppig, J. J. and Schultz, R. M. (1995). Preimplantation development of mouse embryos in KSOM: augmentation by amino acids and analysis of gene expression. Mol. Reprod. Dev. 41,232 -238.[CrossRef][Medline]
Huntriss, J., Hinkins, M., Oliver, B., Harris, S. E., Beazley, J. C., Rutherford, A. J., Gosden, R. G., Lanzendorf, S. E. and Picton, H. M. (2004). Expression of mRNAs for DNA methyltransferases and methyl-CpG-binding proteins in the human female germ line, preimplantation embryos, and embryonic stem cells. Mol. Reprod. Dev. 67,323 -336.[CrossRef][Medline]
Khosla, S., Dean, W., Brown, D., Reik, W. and Feil, R.
(2001). Culture of preimplantation mouse embryos affects fetal
development and the expression of imprinted genes. Biol.
Reprod. 64,918
-926.
Lee, J. T. (2000). Disruption of imprinted X inactivation by parent-of-origin effects at Tsix. Cell 103,17 -27.[CrossRef][Medline]
Lei, H., Oh, S. P., Okano, M., Juttermann, R., Goss, K. A., Jaenisch, R. and Li, E. (1996). De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development 122,3195 -3205.[Abstract]
Lucifero, D., Mertineit, C., Clarke, H. J., Bestor, T. H. and Trasler, J. M. (2002). Methylation dynamics of imprinted genes in mouse germ cells. Genomics 79,530 -538.[CrossRef][Medline]
Maher, E. R. and Reik, W. (2000). Beckwith-Wiedemann syndrome: imprinting in clusters revisited. J. Clin. Invest. 105,247 -252.[Medline]
Maher, E. R., Afnan, M. and Barratt, C. L.
(2003a). Epigenetic risks related to assisted reproductive
technologies: epigenetics, imprinting, ART and icebergs? Hum.
Reprod. 18,2508
-2511.
Maher, E. R., Brueton, L. A., Bowdin, S. C., Luharia, A.,
Cooper, W., Cole, T. R., Macdonald, F., Sampson, J. R., Barratt, C. L., Reik,
W. et al. (2003b). Beckwith-Wiedemann syndrome and assisted
reproduction technology (ART). J. Med. Genet.
40, 62-64.
Mann, M. R. W., Chung, Y. G., Nolen, L. D., Verona, R. I.,
Latham, K. E. and Bartolomei, M. S. (2003). Disruption of
imprinted gene methylation and expression in cloned preimplantation stage
mouse embryos. Biol. Reprod.
69,902
-914.
McDonald, L. E., Paterson, C. A. and Kay, G. F. (1998). Bisulfite genomic sequencing-derived methylation profile of the xist gene throughout early mouse development. Genomics 54,379 -386.[CrossRef][Medline]
McGrath, J. and Solter, D. (1984). Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell 37,179 -183.[CrossRef][Medline]
Moglabey, Y. B., Kircheisen, R., Seoud, M., El Mogharbel, N.,
Van den Veyver, I. and Slim, R. (1999). Genetic mapping of a
maternal locus responsible for familial hydatidiform moles. Hum.
Mol. Genet. 8,667
-671.
Monk, M., Boubelik, M. and Lehnert, S. (1987). Temporal and regional changes in DNA methylation in the embryonic, extraembryonic and germ cell lineages during mouse embryo development. Development 99,371 -382.[Abstract]
Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W. and Roder,
J. C. (1993). Derivation of completely cell culture-derived
mice from early-passage embryonic stem cells. Proc. Natl. Acad.
Sci. USA 90,8424
-8428.
Nicholls, R. D. and Knepper, J. L. (2001). Genome organization, function, and imprinting in Prader-Willi and Angelman syndromes. Annu. Rev. Genomics Hum. Genet. 2, 153-175.[CrossRef][Medline]
Okano, M., Xie, S. and Li, E. (1998). Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases. Nat. Genet. 19,219 -220.[CrossRef][Medline]
Olek, A., Oswald, J. and Walter, J. (1996). A
modified and improved method for bisulphite based cytosine methylation
analysis. Nucleic Acids Res.
24,5064
-5066.
Orstavik, K. H., Eiklid, K., van der Hagen, C. B., Spetalen, S., Kierulf, K., Skjeldal, O. and Buiting, K. (2003). Another case of imprinting defect in a girl with Angelman syndrome who was conceived by intracytoplasmic semen injection. Am. J. Hum. Genet. 72,218 -219.[CrossRef][Medline]
Percec, I., Plenge, R. M., Nadeau, J. H., Bartolomei, M. S. and
Willard, H. F. (2002). Autosomal dominant mutations affecting
X inactivation choice in the mouse. Science
296,1136
-1139.
Pfeifer, K. (2000). Mechanisms of genomic imprinting. Am. J. Hum. Genet. 67,777 -787.[CrossRef][Medline]
Plath, K., Mlynarczyk-Evans, S., Nusinow, D. A. and Panning, B. (2002). Xist RNA and the mechanism of X chromosome inactivation. Annu. Rev. Genet. 36,233 -278.[CrossRef][Medline]
Prissette, M., El-Maarri, O., Arnaud, D., Walter, J. and Avner,
P. (2001). Methylation profiles of DXPas34 during the onset
of X-inactivation. Hum. Mol. Genet.
10, 31-38.
Reik, W., Rîmer, I., Barton, S. C., Surani, M. A., Howlett, S. K. and Klose, J. (1993). Adult phenotype in the mouse can be affected by epigenetic events in the early embryo. Development 119,933 -942.[Abstract]
Sado, T., Wang, Z., Sasaki, H. and Li, E. (2001). Regulation of imprinted X-chromosome inactivation in mice by Tsix. Development 128,1275 -1286.[Abstract]
Santos, F., Hendrich, B., Reik, W. and Dean, W. (2002). Dynamic reprogramming of DNA methylation in the early mouse embryo. Dev. Biol. 241,172 -182.[CrossRef][Medline]
Sasaki, H., Ferguson-Smith, A. C., Shum, A. S. W., Barton, S. C. and Surani, M. A. (1995). Temporal and spatial regulation of H19 imprinting in normal and uniparental mouse embryos. Development 121,4195 -4202.[Abstract]
Schoenherr, C. J., Levorse, J. M. and Tilghman, S. M. (2003). CTCF maintains differential methylation at the Igf2/H19 locus. Nat. Genet. 33,66 -69.[CrossRef][Medline]
Shamanski, F. L., Kimura, Y., Lavoir, M.-C., Pedersen, R. A. and
Yanagimachi, R. (1999). Status of genomic imprinting in mouse
spermatids. Human Reprod.
14,1050
-1056.
Tanaka, M., Puchyr, M., Gertsenstein, M., Harpal, K., Jaenisch, R., Rossant, J. and Nagy, A. (1999). Parental origin-specific expression of Mash2 is established at the time of implantation with its imprinting mechanism highly resistant to genome-wide demethylation. Mech. Dev. 87,129 -142.[CrossRef][Medline]
Tremblay, K. D., Duran, K. L. and Bartolomei, M. S. (1997). A 5' 2-kilobase-pair region of the imprinted mouse H19 gene exhibits exclusive paternal methylation throughout development. Mol. Cell Biol. 17,4322 -4329.[Abstract]
Verona, R. I., Mann, M. R. and Bartolomei, M. S. (2003). Genomic imprinting: intricacies of epigenetic regulation in clusters. Annu. Rev. Cell Dev. Biol. 19,237 -259.[CrossRef][Medline]
Vrana, P. B., Guan, X. J., Ingram, R. S. and Tilghman, S. M. (1998). Genomic imprinting is disrupted in interspecific Peromyscus hybrids. Nat. Genet. 20,362 -365.[CrossRef][Medline]
Vrana, P. B., Fossella, J. A., Matteson, P., del Rio, T., O'Neill, M. J. and Tilghman, S. M. (2000). Genetic and epigenetic incompatibilities underlie hybrid dysgenesis in Peromyscus. Nat. Genet. 25,120 -124.[CrossRef][Medline]
Watanabe, D., Suetake, I., Tada, T. and Tajima, S. (2002). Stage- and cell-specific expression of Dnmt3a and Dnmt3b during embryogenesis. Mech. Dev. 118,187 -190.[CrossRef][Medline]
Weksberg, R., Shuman, C., Caluseriu, O., Smith, A. C., Fei, Y.
L., Nishikawa, J., Stockley, T. L., Best, L., Chitayat, D., Olney, A. et
al. (2002). Discordant KCNQ1OT1 imprinting in sets of
monozygotic twins discordant for Beckwith-Wiedemann syndrome. Hum.
Mol. Genet. 11,1317
-1325.
Yamazaki, Y., Mann, M. R., Lee, S. S., Marh, J., McCarrey, J.
R., Yanagimachi, R. and Bartolomei, M. S. (2003).
Reprogramming of primordial germ cells begins before migration into the
genital ridge, making these cells inadequate donors for reproductive cloning.
Proc. Natl. Acad. Sci. USA
100,12207
-12212.
Related articles in Development:
This article has been cited by other articles:
![]() |
C. Li, Z. Chen, Z. Liu, J. Huang, W. Zhang, L. Zhou, D. L. Keefe, and L. Liu Correlation of expression and methylation of imprinted genes with pluripotency of parthenogenetic embryonic stem cells Hum. Mol. Genet., June 15, 2009; 18(12): 2177 - 2187. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. L. Lopes, A. L. Fortier, N. Darricarrere, D. Chan, D. R. Arnold, and J. M. Trasler Reproductive and epigenetic outcomes associated with aging mouse oocytes Hum. Mol. Genet., June 1, 2009; 18(11): 2032 - 2044. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Fernandez-Gonzalez, J. de Dios Hourcade, I. Lopez-Vidriero, A. Benguria, F. R. De Fonseca, and A. Gutierrez-Adan Analysis of gene transcription alterations at the blastocyst stage related to the long-term consequences of in vitro culture in mice Reproduction, February 1, 2009; 137(2): 271 - 283. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Amor and J. Halliday A review of known imprinting syndromes and their association with assisted reproduction technologies Hum. Reprod., December 1, 2008; 23(12): 2826 - 2834. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. S. Lee, K. E. Latham, and C. A. VandeVoort Effects of in vitro maturation on gene expression in rhesus monkey oocytes Physiol Genomics, October 8, 2008; 35(2): 145 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. D. Morgan, X. L. Jin, A. Li, E. Whitelaw, and C. O'Neill The Culture of Zygotes to the Blastocyst Stage Changes the Postnatal Expression of an Epigentically Labile Allele, Agouti Viable Yellow, in Mice Biol Reprod, October 1, 2008; 79(4): 618 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hirasawa, H. Chiba, M. Kaneda, S. Tajima, E. Li, R. Jaenisch, and H. Sasaki Maternal and zygotic Dnmt1 are necessary and sufficient for the maintenance of DNA methylation imprints during preimplantation development Genes & Dev., June 15, 2008; 22(12): 1607 - 1616. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Fortier, F. L. Lopes, N. Darricarrere, J. Martel, and J. M. Trasler Superovulation alters the expression of imprinted genes in the midgestation mouse placenta Hum. Mol. Genet., June 1, 2008; 17(11): 1653 - 1665. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Watkins, A. Wilkins, C. Cunningham, V. H. Perry, M. J. Seet, C. Osmond, J. J. Eckert, C. Torrens, F. R. A. Cagampang, J. Cleal, et al. Low protein diet fed exclusively during mouse oocyte maturation leads to behavioural and cardiovascular abnormalities in offspring J. Physiol., April 15, 2008; 586(8): 2231 - 2244. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Duranthon, A. J Watson, and P. Lonergan Preimplantation embryo programming: transcription, epigenetics, and culture environment Reproduction, February 1, 2008; 135(2): 141 - 150. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wagschal, H. G. Sutherland, K. Woodfine, A. Henckel, K. Chebli, R. Schulz, R. J. Oakey, W. A. Bickmore, and R. Feil G9a Histone Methyltransferase Contributes to Imprinting in the Mouse Placenta Mol. Cell. Biol., February 1, 2008; 28(3): 1104 - 1113. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Rivera, P. Stein, J. R. Weaver, J. Mager, R. M. Schultz, and M. S. Bartolomei Manipulations of mouse embryos prior to implantation result in aberrant expression of imprinted genes on day 9.5 of development Hum. Mol. Genet., January 1, 2008; 17(1): 1 - 14. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Thurston, J. Taylor, J. Gardner, K. D Sinclair, and L. E Young Monoallelic expression of nine imprinted genes in the sheep embryo occurs after the blastocyst stage Reproduction, January 1, 2008; 135(1): 29 - 40. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Horii, M. Kimura, S. Morita, Y. Nagao, and I. Hatada Loss of Genomic Imprinting in Mouse Parthenogenetic Embryonic Stem Cells Stem Cells, January 1, 2008; 26(1): 79 - 88. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-P. Kim, A. Thurston, C. Mummery, D. Ward-van Oostwaard, H. Priddle, C. Allegrucci, C. Denning, and L. Young Gene-specific vulnerability to imprinting variability in human embryonic stem cell lines Genome Res., December 1, 2007; 17(12): 1731 - 1742. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Rugg-Gunn, A. C. Ferguson-Smith, and R. A. Pedersen Status of genomic imprinting in human embryonic stem cells as revealed by a large cohort of independently derived and maintained lines Hum. Mol. Genet., October 15, 2007; 16(R2): R243 - R251. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Schultz Of light and mouse embryos: Less is more PNAS, September 11, 2007; 104(37): 14547 - 14548. [Full Text] [PDF] |
||||
![]() |
M. Takenaka, T. Horiuchi, and R. Yanagimachi Effects of light on development of mammalian zygotes PNAS, September 4, 2007; 104(36): 14289 - 14293. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Hansson, G. Helgesson, R. Wessman, and R. Jaenisch Commentary: Isolated Stem Cells--Patentable as Cultural Artifacts? Stem Cells, June 1, 2007; 25(6): 1507 - 1510. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Rosenwaks and K. Bendikson Further evidence of the safety of assisted reproductive technologies PNAS, April 3, 2007; 104(14): 5709 - 5710. [Full Text] [PDF] |
||||
![]() |
S. Markoulaki, M. Kurokawa, S.-Y. Yoon, S. Matson, T. Ducibella, and R. Fissore Comparison of Ca2+ and CaMKII responses in IVF and ICSI in the mouse Mol. Hum. Reprod., April 1, 2007; 13(4): 265 - 272. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Caperton, P. Murphey, Y. Yamazaki, C. A. McMahan, C. A. Walter, R. Yanagimachi, and J. R. McCarrey From the Cover: Assisted reproductive technologies do not alter mutation frequency or spectrum PNAS, March 20, 2007; 104(12): 5085 - 5090. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pesty, F. Miyara, P. Debey, B. Lefevre, and C. Poirot Multiparameter assessment of mouse oogenesis during follicular growth in vitro Mol. Hum. Reprod., January 1, 2007; 13(1): 3 - 9. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sato, E. Otsu, H. Negishi, T. Utsunomiya, and T. Arima Aberrant DNA methylation of imprinted loci in superovulated oocytes Hum. Reprod., January 1, 2007; 22(1): 26 - 35. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Rossignol, V Steunou, C Chalas, A Kerjean, M Rigolet, E Viegas-Pequignot, P Jouannet, Y Le Bouc, and C Gicquel The epigenetic imprinting defect of patients with Beckwith--Wiedemann syndrome born after assisted reproductive technology is not restricted to the 11p15 region J. Med. Genet., December 1, 2006; 43(12): 902 - 907. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lucifero, J. Suzuki, V. Bordignon, J. Martel, C. Vigneault, J. Therrien, F. Filion, L. C. Smith, and J. M. Trasler Bovine SNRPN Methylation Imprint in Oocytes and Day 17 In Vitro-Produced and Somatic Cell Nuclear Transfer Embryos Biol Reprod, October 1, 2006; 75(4): 531 - 538. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Y. Kwong, D. J Miller, E. Ursell, A. E Wild, A. P Wilkins, C. Osmond, F. W Anthony, and T. P Fleming Imprinted gene expression in the rat embryo-fetal axis is altered in response to periconceptional maternal low protein diet. Reproduction, August 1, 2006; 132(2): 265 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Feil, M. Lane, C. T. Roberts, R. L. Kelley, L. J. Edwards, J. G. Thompson, and K. L. Kind Effect of culturing mouse embryos under different oxygen concentrations on subsequent fetal and placental development J. Physiol., April 1, 2006; 572(1): 87 - 96. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Armstrong, M. Lako, W. Dean, and M. Stojkovic Epigenetic Modification Is Central to Genome Reprogramming in Somatic Cell Nuclear Transfer Stem Cells, April 1, 2006; 24(4): 805 - 814. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Van Winkle, J. K. Tesch, A. Shah, and A. L. Campione System B0,+ amino acid transport regulates the penetration stage of blastocyst implantation with possible long-term developmental consequences through adulthood Hum. Reprod. Update, March 1, 2006; 12(2): 145 - 157. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. De Geyter, M. De Geyter, S. Steimann, H. Zhang, and W. Holzgreve Comparative birth weights of singletons born after assisted reproduction and natural conception in previously infertile women Hum. Reprod., March 1, 2006; 21(3): 705 - 712. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Thorvaldsen, A. M. Fedoriw, S. Nguyen, and M. S. Bartolomei Developmental Profile of H19 Differentially Methylated Domain (DMD) Deletion Alleles Reveals Multiple Roles of the DMD in Regulating Allelic Expression and DNA Methylation at the Imprinted H19/Igf2 Locus Mol. Cell. Biol., February 15, 2006; 26(4): 1245 - 1258. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Sun, A. C. Yang, Y. Feng, Y. J. Sun, Y. f. Zhu, Y. Zhang, H. Jiang, C. L. Li, F. R. Gao, Z. H. Zhang, et al. Temporal and parental-specific expression of imprinted genes in a newly derived Chinese human embryonic stem cell line and embryoid bodies Hum. Mol. Genet., January 1, 2006; 15(1): 65 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M Schultz From egg to embryo: a peripatetic journey Reproduction, December 1, 2005; 130(6): 825 - 828. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sommovilla, W. B Bilker, T. Abel, and R. M Schultz Embryo culture does not affect the longevity of offspring in mice Reproduction, November 1, 2005; 130(5): 599 - 601. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Li, T. H. Vu, G. A. Ulaner, E. Littman, J.-Q. Ling, H.-L. Chen, J.-F. Hu, B. Behr, L. Giudice, and A. R. Hoffman IVF results in de novo DNA methylation and histone methylation at an Igf2-H19 imprinting epigenetic switch Mol. Hum. Reprod., September 1, 2005; 11(9): 631 - 640. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Boiani, L. Gentile, V. V. Gambles, F. Cavaleri, C. A. Redi, and H. R. Scholer Variable Reprogramming of the Pluripotent Stem Cell Marker Oct4 in Mouse Clones: Distinct Developmental Potentials in Different Culture Environments Stem Cells, September 1, 2005; 23(8): 1089 - 1104. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gallou-Kabani and C. Junien Nutritional Epigenomics of Metabolic Syndrome: New Perspective Against the Epidemic Diabetes, July 1, 2005; 54(7): 1899 - 1906. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Roberts Embryo Culture Conditions: What Embryos Like Best Endocrinology, May 1, 2005; 146(5): 2140 - 2141. [Full Text] [PDF] |
||||
![]() |
C. Sjoblom, C. T. Roberts, M. Wikland, and S. A. Robertson Granulocyte-Macrophage Colony-Stimulating Factor Alleviates Adverse Consequences of Embryo Culture on Fetal Growth Trajectory and Placental Morphogenesis Endocrinology, May 1, 2005; 146(5): 2142 - 2153. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Edwards, K. L. Kind, D. T. Armstrong, and J. G. Thompson Effects of recombinant human follicle-stimulating hormone on embryo development in mice Am J Physiol Endocrinol Metab, May 1, 2005; 288(5): E845 - E851. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. R. Maher Imprinting and assisted reproductive technology Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R133 - R138. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Benchaib, V. Braun, D. Ressnikof, J. Lornage, P. Durand, A. Niveleau, and J.F. Guerin Influence of global sperm DNA methylation on IVF results Hum. Reprod., March 1, 2005; 20(3): 768 - 773. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||