spacer gif spacer gif spacer gif spacer gif ARCHIVE ANNOUNCEMENT! spacer gif
QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

Corrigendum for Yokota et al., Development 130 (10) 2199-2212.
First published online July 19, 2004

Development 131, 3821 (2004)
Published by The Company of Biologists 2004
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Search for Related Content

Corrigendum

A novel role for a nodal-related protein; Xnr3 regulates convergent extension movements via the FGF receptor

Chika Yokota, Matt Kofron, Mike Zuck, Douglas W. Houston, Harry Isaacs, Makoto Asashima, Chris C. Wylie and Janet Heasman Development 130, 2199-2212.

On p. 2200, the sequence of Xnr3 morpholino oligo is incorrect. The correct sequence is 5' TCTCTGGGTAGATTTGTGGTGACTC 3'.

The authors apologise to readers for this mistake.





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Search for Related Content