|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 14 July 2004
doi: 10.1242/dev.01275
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Genetics, Harvard Medical School, Boston, MA 02115, USA
* Author for correspondence (e-mail: tabin{at}genetics.med.harvard.edu)
Accepted 17 May 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Somite, Syndetome, Sclerotome, Tendon, Scleraxis, FGF, Ets, Pea3, Erm
| Introduction |
|---|
|
|
|---|
It has now been shown, however, through analysis of the expression pattern
of the tendon-specific bHLH transcription factor scleraxis (Scx)
(Brent et al., 2003
;
Cserjesi et al., 1995
;
Schweitzer et al., 2001
), that
the tendon progenitors arise from a fourth somitic compartment, termed the
syndetome (Brent et al., 2003
),
which occupies a unique location within that region of the dorsal sclerotome
closest to the anterior and posterior edges of the myotome. Molecularly
defined by expression of Scx, the position of the syndetome is
determined when fibroblast growth factors (FGFs) secreted from the center of
the myotome induce the anterior and posterior sclerotome abutting the myotome
to adopt a tendon cell fate (Brent et al.,
2003
). Thus, interactions between the somitic muscle and cartilage
cell lineages lead to specification of the tendon lineage placing the
tendon progenitors at the interface of the two tissue layers they must
ultimately join. Yet, while FGF signaling between myotome and sclerotome has
been shown to be both necessary and sufficient for Scx expression in
the syndetome (Brent et al.,
2003
), it is unclear whether this signaling acts cell autonomously
within the future Scx-expressing cells, or indirectly through a
secondary signal. The mechanism responsible for restricting Scx
expression to only that region of the anterior and posterior sclerotome
abutting the myotome is also puzzling, particularly in light of experiments
showing that overexpression of Fgf8 during somite development leads
to ectopic Scx expression throughout the sclerotome
(Brent et al., 2003
)
hence demonstrating that the entire sclerotome is competent to express
Scx in response to FGF signaling. In the current study, we set out to
understand the molecular basis for this competency, as well as the mechanism
by which myotomal FGFs determine the restricted position of the syndetome, by
asking if the circumscribed Scx domain could be a reflection of
localized FGF signal transduction.
To explore our hypothesis, we looked at the expression of several members
of the Fgf8 synexpression group, a set of genes known to be induced
in regions of active Fgf8 signaling and thought to either transduce
or modulate the FGF signaling pathway. During signaling, the secreted FGF
ligand binds to the extracellular domain of the Fgf receptor
(Fgfr), a protein with a tyrosine kinase intracellular domain.
Ligand-binding causes receptor dimerization, autophosphorylation and
activation of the intracellular tyrosine kinase domains. A number of
intracellular signaling cascades follow, in particular, the RAS-MAPK/ERK
pathway, in which sequential phosphorylation of a series of protein kinases
ultimately activates MAPK/ERK to control a variety of downstream responses,
including gene transcription. Among the Fgf8 synexpression group
members are the transcription factors Pea3 and Erm, and the
inhibitors MAPK phosphatase 3 (Mkp3), similar expression to FGF
(Sef) and sprouty (Spry). Pea3 and Erm are
defined by the presence of an evolutionarily conserved Ets domain that
mediates DNA binding (Sharrocks et al.,
1997
). FGF signaling is both necessary and sufficient for their
expression (Firnberg and Neubuser,
2002
; Kawakami et al.,
2003
; Raible and Brand,
2001
; Roehl and
Nusslein-Volhard, 2001
), and as both have been shown to be present
at regions of FGF signaling in several developmental contexts, they are
thought to be general transcriptional targets of FGF signaling
(Raible and Brand, 2001
;
Roehl and Nusslein-Volhard,
2001
). Moreover, it has been demonstrated in vitro that DNA
binding of Pea3 and Erm to their targets is activated
following phosphorylation by MAPK/ERKs
(Janknecht et al., 1996
;
Munchberg and Steinbeisser,
1999
; O'Hagan et al.,
1996
). Thus, in addition to being potential transcriptional
targets of FGF signaling, Pea3 and Erm function as
transcriptional effectors within cells to transduce FGF signals. By contrast,
Mkp3, Sef and Spry act within cells as negative feedback
inhibitors, modulating and restricting the levels and extent of FGF signaling.
FGFs are both necessary and sufficient to control their expression, and the
three are known to be present at sites of Fgf8 signaling
(Chambers and Mason, 2000
;
Dickinson et al., 2002
;
Eblaghie et al., 2003
;
Furthauer et al., 2002
;
Kawakami et al., 2003
;
Mailleux et al., 2001
;
Minowada et al., 1999
;
Ozaki et al., 2001
;
Tsang et al., 2002
).
We present evidence that the FGF signal responsible for inducing the Scx expression domain can be directly received by the anterior and posterior sclerotome, that the Fgf8 synexpression group members Pea3, Erm, Mkp3, Sef and Spry are co-expressed with Scx, and that the activity of the transcription factors Pea3 and Erm is necessary and sufficient for FGF-dependent induction of Scx. Importantly, we found that overexpression of Pea3 led to ectopic expression of Scx in both the sclerotome and dermomyotome but only in those regions within effective signaling range of the myotomal FGFs. Our results suggest that the domain of Scx expression, and hence the unique location of the syndetome, is dependent on the combined conditions of the restricted expression pattern of Pea3 and Erm within the anterior and posterior sclerotome, and the distances that FGFs secreted from the center of the myotome are able to travel. It is thus the interplay of factors that act downstream of the FGFR that defines the boundaries of Scx expression.
| Materials and methods |
|---|
|
|
|---|
Immunohistochemistry
Immunohistochemistry was performed as previously described
(Brent et al., 2003
).
Phosphorylated MAPK/ERK was detected with phospho-p44/42 map kinase
(Thr202/Tyr204) antibody (diluted 1:500; Cell Signaling Technology #9101),
myosin heavy chain with MF20 [diluted 1:100; Developmental Studies Hybridoma
Bank (DSHB), Iowa City, IA, USA] and RCAS infection with AMV-3C2 (1:5; DSHB).
Primary antibodies were followed by either Cy2- or Cy3-conjugated secondary
antibodies (Jackson Immunoresearch).
Cloning of retroviral constructs and viral misexpression
Cloning of retroviral constructs using SLAX13 and transfection and growth
of RCAS viruses was performed as previously described
(Logan and Tabin, 1998
;
Morgan and Fekete, 1996
).
RCASBP (A) constructs included full-length chick Fgf8 (gift of Connie
Cepko), full-length mouse Pea3 (RT-PCR product using primers 5'
ACGGGTCTCCCATGGAGCGGAGGATGAAAG 3' and 5'
ACGGAATTCCTAGTAAGAATATCCACCTCTG 3'), and the mouse Pea3 Ets DNA
binding domain (RT-PCR product using primers 5'
ACGGTTCTCCCATGCAGCGCCGGGGTGCCTTAC 3' and 5'
ACGGAATTCCGGCTCGCACACAAACTTGTAC 3'). Pea3EnR was made by cloning the
Pea3 Ets DNA-binding domain into the SLAX-EnR vectors. Psm infection
was performed as previously described
(Brent et al., 2003
).
Bead implants
Heparin beads (Sigma) were washed in PBS and incubated on ice for 1 hour in
FGF8 protein (Peprotech) (1 mg/ml). Bead implants were performed as previously
described (Brent et al.,
2003
).
Dermomyotome ablation
Psm injections were performed on Hamburger Hamilton (HH)
(Hamburger and Hamilton, 1951
)
stage 12 embryos. Following 9 hours of incubation, dermomyotomes were removed
from somite stages V and VI as previously described
(Brent et al., 2003
).
Trunk cultures
Trunks (including thoracic and limb levels) of HH stage 16 embryos were
isolated and cultured on nucleopore filters in chick embryo media (DMEM, 10%
chicken serum, 5% fetal calf serum, 1% pen-strep, 1% L-glut)
(Palmeirim et al., 1997
) with
30 µM SU5402 (Calbiochem, dissolved in DMSO) or an equivalent amount of
DMSO. Following 24 hours of incubation, trunks were fixed in 4%
paraformaldehyde and processed for whole-mount in situ hybridization.
| Results |
|---|
|
|
|---|
|
|
Scx is co-expressed with several members of the Fgf8 synexpression group
If FGFs secreted by the myotome can directly signal to the
sclerotome, the receptor most likely to be receiving the signal is
Fgfr1; yet, as earlier pointed out, the broad expression pattern of
Fgfr1 throughout the somite challenges us to understand why FGF
signaling within the sclerotome is nonetheless restricted to only the anterior
and posterior regions, and excluded from the middle section abutting the
myotome. An expression screen for transcription factors in mouse indicated
that two members of the Fgf8 synexpression group, Pea3 and
Erm, are expressed in the anterior and posterior somites (A. P.
McMahon, J. Yu and T. Tenzen, unpublished). We thought a closer look at the
temporal and spatial expression patterns of these two transcription factors,
as well as three FGF-regulated inhibitors, Mkp3, Sef and
Spry2, in chick embryos at HH stage 20, might provide further insight
into the restricted Scx domain. We found that Pea3 and
Erm were expressed, like Scx, in the anterior and posterior
sclerotome (Fig. 3A-C),
occupying a domain that overlaps with but is also much larger than that of
Scx (Fig. 3D-F). As in
other regions where Pea3 and Erm are expressed, the two form
a nested pattern, with Erm the broader of the two a
configuration that perhaps reflects their dependence on different levels of
FGF signaling (Fig. 3E,F)
(Firnberg and Neubuser, 2002
;
Raible and Brand, 2001
;
Roehl and Nusslein-Volhard,
2001
). Additionally, Pea3 and Erm are expressed
in the anterior and posterior ventral dermomyotome
(Fig. 3E,F, red arrows).
Mkp3, Sef and Spry2 are similarly expressed in the anterior
and posterior sclerotome and dermomyotome
(Fig. 3G-L), and Spry2
is also expressed at the center of the myotome, where FGFs are found
(Fig. 3I,L). The presence of
both phosphorylated MAPK/ERK (Fig.
2E) and Fgf8 synexpression group members within the
anterior and posterior dermomyotome (Fig.
3E,F,J-L, red arrows) suggests that this region is a site of
active FGF signaling. Moreover, closer investigation of Scx
expression reveals the presence of a small group of Scx-positive
cells in the anterior and posterior dermomyotome
(Fig. 3D, red arrow). Thus,
Scx expression closely parallels that of the members of the
Fgf8 synexpression group examined here.
|
|
Ectopic expression of Pea3 is sufficient to induce Scx expression within range of an FGF signal
Our observation that transcriptional activation by the Ets transcription
factors is required for induction of Scx suggests that the restricted
Scx domain reflects the localization of Pea3 and
Erm within the somite. But can the restricted expression of the Ets
transcription factors sufficiently account for the restricted expression of
Scx? To answer this question, we decided to look at the effect on
Scx when the expression domain of the Ets transcription factors was
expanded. Using a retrovirus encoding full-length Pea3 (RCAS-Pea3),
we overexpressed Pea3 throughout the somites. Upregulation of
Scx was seen (Fig.
5A); however, strikingly, this ectopic Scx expression did
not resemble that observed after overexpression of Fgf8, when
Scx was induced throughout the sclerotome
(Fig. 5F). By contrast,
widespread overexpression of Pea3 led to expanded Scx
expression only in the dorsalmost sclerotome abutting the myotome, but not in
the more ventral sclerotome [we confirmed that this absence was not due to
limited infection by observing extensive viral spread throughout the
dermomyotome, myotome and sclerotome (Fig.
5D)]. Pea3 misexpression also differed from that of
Fgf8 in that Pea3 misexpression resulted in additional
ectopic Scx expression within the dermomyotome
(Fig. 5C).
|
To test whether ectopic expression of Scx following RCAS-Pea3 infection indeed requires the presence of FGFs, we blocked FGF signaling in embryos injected with RCAS-Pea3. Sixteen hours after infection, trunks of injected embryos were placed in culture in either the presence or absence of the FGFR inhibitor, SU5402. As expected, Scx was expressed normally in uninjected trunks (Fig. 5I) but completely lost in the presence of SU5402 (Fig. 5J). By contrast, however, neither Fgf8 (Fig. 5O,P) nor any other examined genes expressed during somite development, such as Myf5 (Fig. 5M,N), were affected, demonstrating that culturing embryos in the presence of SU5402 does not result in general defects in somite development, nor in loss of myotomal FGFs. Embryos injected with RCAS-Pea3 showed upregulation of Scx when cultured in DMSO (Fig. 5K), but in embryos exposed to SU5402, RCAS-Pea3-mediated ectopic induction of Scx was blocked (Fig. 5L), further supporting our conclusion that Pea3 activity requires exposure to FGF signaling.
If Pea3 is necessary for induction of Scx, we reasoned
that we would expect Pea3 to be present in any instance where
overexpression of FGFs resulted in ectopic expression of Scx. As
several studies have shown that transcription of Pea3 and
Erm is induced in response to FGF signaling
(Firnberg and Neubuser, 2002
;
Raible and Brand, 2001
;
Roehl and Nusslein-Volhard,
2001
), we decided to look at the effect of RCAS-FGF8 infection on
Pea3 expression. Following infection, we found Pea3
expressed throughout the sclerotome (Fig.
5G,H), but not expanded in the dermomyotome coinciding
with and thereby providing a basis for understanding the ectopic expression
pattern of Scx in response to the same manipulation
(Fig. 5E,F). It thus appears
that overexpression of Fgf8 regulates ectopic Scx expression
on two levels: Pea3 is activated, and then, within the context of
continued FGF signaling, Pea3 goes on to activate Scx.
We previously showed that application of an Fgf8-soaked bead can
induce ectopic expression of Scx in the sclerotome as early as 4
hours after implantation (Brent et al.,
2003
). If FGF-dependent induction of Scx is mediated by
the Ets transcription factors, we hypothesized that we would be able to
observe their induction, following bead implantation, prior to that of
Scx. To test our assumption, we implanted Fgf8-soaked beads
into the somites of HH stage 18 embryos, and then observed expression of
Pea3, Erm and Scx at different times. As expected, all three
were strongly induced at 12 hours following implantation
(Fig. 6A-C). However, after 4
hours, only weak Scx expression
(Fig. 6F), and stronger
expression of Pea3 and Erm
(Fig. 6D,E), were observed.
Moreover, 3 hours after bead implantation, while Pea3 and
Erm were still detectable, Scx was not
(Fig. 6G-I), indicating that
Pea3 and Erm are indeed induced prior to Scx.
Interestingly, we observed that after bead implantation, the Erm
expression domain was broader than that of Pea3, mirroring the
endogenous nested domains of Pea3 and Erm expression in the
somite.
|
|
As previously reported, expression of Scx in the anterior and
posterior dorsal sclerotome is clearly seen by somite stage XVI
(Fig. 7G) (Brent et al., 2003
), and
persists in this domain as morphogenesis of the axial tendons occurs
(Brent et al., 2003
). To
determine if Scx induction is, like that of Pea3, also
associated with an accumulation of Fgf8 in the myotome, we decided to
look for Scx expression at earlier somite stages. Continued staining
indeed revealed expression in the more posterior somites, albeit quite weak.
By somite stage XII, Scx is detected in the anterior and posterior
sclerotome (Fig. 7G,J, blue
arrow), after Fgf8 becomes restricted to the myotome
(Fig. 7H) and Pea3 to
the sclerotome (Fig. 7I). In
addition, by somite stage XII, Scx is seen in the anterior and
posterior dermomyotome (Fig.
7J, red arrows). Interestingly, the sclerotome domains of
Scx and Pea3 in somite stages XII and XIII
(Fig. 7I,J) appear much broader
than those in and after somite stage XVI
(Fig. 3D,E), an observation
that possibly reflects the expression patterns of Fgf8 at these same
somite stages. Expression of Fgf8 thus initially occupies a greater
proportion of myotome (Fig.
7H), perhaps allowing the secreted FGFs to reach further ventrally
into the sclerotome. But by somite stage XVI, Fgf8 expression becomes
localized to the center of the myotome
(Fig. 1B), thereby limiting the
distance that the secreted FGFs can travel. There is also some detectable
Scx expression in the newly formed somites, in a domain coinciding
with that of Fgf8 and Pea3 during somitogenesis (data not
shown); however, because the level of expression in these posterior-most
somites is so weak, it is difficult to determine whether Scx remains
on after somite formation and continues to follow the dynamic expression
patterns of Fgf8 and Pea3, or turns off and then on again at
a later somite stage. In either case, by somite stage XII Scx is
detectable within the sclerotomal domain that it will occupy throughout axial
tendon development. A comparison of the spatial and temporal dynamics of
Fgf8, Pea3 and Scx thus suggests that it is the myotomal
expression domain of Fgf8 that plays a role in establishing
expression first of Pea3 in the anterior and posterior dermomyotome
and sclerotome, and then of Scx in the same domain.
| Discussion |
|---|
|
|
|---|
|
Finally, in addition to the syndetome, we note here that a small population of Scx-expressing cells can be seen in the anterior and posterior ventral dermomyotome (Fig. 8C). It is at this point unclear whether these Scx-expressing cells represent a dermomyotomal population of tendon progenitors, or whether they are an extension of cells from the syndetome. In either case, these Scx-expressing cells overlap with Pea3 and Erm in the anterior and posterior ventral dermomyotome (Fig. 8C), and analysis of phosphorylated MAPK/ERK expression suggests that active FGF signaling is also taking place. It will be interesting to determine which components of the axial tendons, if any, arise from this additional domain.
Overexpression of Pea3 reveals regional competence for Scx expression
Overexpression of Fgf8 during somite development results in
ectopic expression of Scx throughout the sclerotome, but not in the
dermomyotome or myotome (Brent et al.,
2003
), demonstrating that, upon exposure to FGF signaling, the
entire sclerotome is competent to adopt a tendon cell fate. Our present study
builds upon this finding by showing that ectopic induction of Scx in
the sclerotome following overexpression of Fgf8 is triggered by
FGF-induced expansion of Pea3 within the sclerotome, combined with
the expanded FGF signaling needed to activate Pea3. By contrast,
overexpression of Pea3 results in ectopic expression of Scx
not only in the sclerotome but throughout the dermomyotome a result
never seen after Fgf8 overexpression. The inability of overexpressed
FGFs to upregulate Pea3 in the dermomyotome may be at least partially
responsible for the restriction of ectopic Scx induction to the
sclerotome. Because the ability of Pea3 to control expression of
target genes requires activation by the FGF signaling pathway, the induction
of Scx throughout the dorsal sclerotome, as well as in the
dermomyotome following overexpression of Pea3, provides a readout for
the minimal distances to which myotomal FGFs can diffuse within the somite.
Thus, although FGFs can reach the entire dermomyotome and dorsalmost
sclerotome, Scx is not normally expressed throughout those regions,
at least in part because Pea3 and Erm are not present
(Fig. 8C).
If overexpression of Pea3 reveals that endogenous myotomal FGFs are able to reach the entire dermomyotome at levels sufficiently high to induce ectopic Scx expression, why is the expression of Pea3 and Erm, which appear to require lower levels of FGFs for their induction, not normally found in the dermomyotome? Likewise, if the Ets transcription factors are induced in response to FGF signaling, why does overexpression of Fgf8 fail to result in ectopic expression of Pea3 throughout the dermomyotome? Although we do not yet know the molecular mechanisms underlying these observations, they do suggest that there are additional levels of regulation within the dermomyotome that control the ability of its cells to respond to FGFs by activating target genes such as Pea3 and Erm. As the dermomyotome is clearly competent to express Scx when Pea3 is present, that same regulating mechanism which prevents the entire dermomyotome from expressing Pea3 and Erm is also functioning to prevent those dermomyotome cells from expressing markers for a tendon cell fate.
It is particularly striking that, following overexpression of
Pea3, the ectopic expression of Scx in the dermomyotome
extends a greater distance from the source of the myotomal FGFs than does the
ectopic expression of Scx in the dorsal sclerotome. This difference
suggests either that the myotomal FGFs are able to diffuse more freely in the
dermomyotome, or that the endogenous myotomal FGFs lack the capacity to
override the cartilage-inducing signals that direct the ventral somite to
adopt its cartilage fate. In either case, overexpression of Pea3
reveals that, just as the majority of the dermomyotome appears to have
mechanisms in place to block the expression of Pea3, Erm and
Scx in response to the myotomal FGFs, the sclerotome has mechanisms
in place to prevent the myotomal FGFs from extending too far ventrally, thus
possibly interfering with cartilage formation. In fact, limiting the number of
cells that can adopt a tendon cell fate in the sclerotome may be an important
aspect of somite patterning. Previously, we have shown that the two lineages
arising from sclerotome, the cartilage and tendons, are mutually exclusive,
and that cartilage-inducing signals function to repress tendon-inducing
signals and vice versa (Brent et al.,
2003
). In particular, we have found that FGF signaling negatively
regulates expression of Pax1, a cartilage marker, underscoring that
the extent of exposure of the sclerotome to FGF signaling may be critical.
The possibility that regulation of the levels of FGF signaling plays a role
in Scx induction is supported by our observation that three
intracellular inhibitors of FGF signaling, Mkp3, Sef and
Spry2, are co-expressed with Scx, thus perhaps functioning
to lower the level of signaling in the Pea3- and
Erm-expressing cells. These inhibitors might also act to restrict the
extent of Scx expression in the anterior and posterior sclerotome.
Although all three inhibitors are thought to act intracellularly in cells
receiving FGF signals, Spry has additionally been shown in
Drosophila to have indirect non-cell autonomous effects on
surrounding regions (Hacohen et al.,
1998
). Such downstream responses might also function during somite
development to control the FGF signaling range.
Interestingly, overexpression of Pea3 does not appear to result in
Scx expression within the myotome where FGF signaling is also
active. The inability of the myotome to express Scx could be
indicative either of its early acquisition of a determined state relative to
the sclerotome (Dockter and Ordahl,
1998
; Williams and Ordahl,
1997
), or of its exposure to higher levels of FGFs. In the case of
the latter, high levels of FGFs might be required to control proliferation and
differentiation in the myotome (Kahane et
al., 2001
; Marics et al.,
2002
), while lower levels in the sclerotome could be necessary for
tendon progenitor formation. However, the different outcomes of FGF signaling
could be a reflection of the diverse activities of the FGFRs. As both
Frek/Fgfr4 and Fgfr1 are expressed in the myotome, signaling
through both receptors might regulate myotomal functions, whereas, in the
sclerotome, signaling solely through Fgfr1 could result in induction
of Scx.
Direct versus indirect FGF signaling
Based on our observations that FGFs can activate Scx in the
absence of myotome, and that transducers of FGF signaling are co-expressed
with Scx, we believe that FGFs most probably signal directly to the
Scx-expressing cells; because, to our knowledge, FGFR1 is
the only receptor expressed in the sclerotome, we conclude that Scx
expression is activated in the sclerotome through this receptor. The broad
expression pattern of Fgfr1, combined with our observation that,
following overexpression of Pea3, FGFs are able to extend beyond the
Scx expression domain in both the sclerotome and dermomyotome,
suggest that other components of the FGF signaling cascade undergo
localization in order to prevent widespread Scx induction. Indeed, if
downstream effectors of Fgf signaling, such as Pea3 and
Erm, were not restricted, FGFs would be able to signal directly
through the broadly expressed FGFR1, consequently activating target
genes, such as Scx, in inappropriate regions. Interestingly, there
does appear to be an upregulation of Fgfr1 at the site of
Scx expression, perhaps reflecting either an additional mechanism for
restriction of Scx to that region, or a positive-feedback effect of
increased FGF signaling.
Nonetheless, although our findings implicate Fgfr1 in the
regulation of Scx expression, a role for Frek/Fgfr4 cannot
be ruled out. Several studies have attempted to sort out the different
functions controlled by the individual receptors, using either
dominant-negative truncated (Brent et al.,
2003
; Itoh et al.,
1996
) or soluble receptors
(Marics et al., 2002
). Each,
however, may have nonspecific effects: truncated receptors can dimerize with
and block signaling through the other FGF receptors, and soluble receptors can
interfere with the activities of any other FGF receptor binding to the same
ligand. Because both Fgfr1 and Frek/Fgfr4 are expressed in
the somites and are likely to bind to the same FGF ligands, neither approach
is capable of distinguishing their individual functions. It thus remains
possible that in addition to the likely role of Fgfr1 in directly
receiving the FGF signal within the sclerotome, Frek/Fgfr4 may also
play a part, perhaps regulating the expression or position of Scx in
the sclerotome, or even preventing Scx expression in the myotome in
response to FGF signaling.
Myotomal FGF signaling regulates gene expression in the syndetome
As has been demonstrated in several systems, FGF signaling in the somite is
both necessary and sufficient to establish the nested expression domains of
Pea3 and Erm. Once their domains are in place, Pea3
and Erm continue to depend on FGF signaling to activate expression of
their target genes. Thus, FGF signaling makes two important contributions to
tendon progenitor formation: controlling expression of Pea3 and
Erm, and regulating their activity as transcriptional effectors
(Fig. 8A,B). Interestingly,
expression of Pea3, Erm, and Scx in the anterior and
posterior sclerotome and dermomyotome appears to be a response to myotomal
expression of Fgf8: while Fgf8 is expressed throughout
somite development, Pea3, Erm and Scx only become restricted
to their respective sclerotomal and dermomyotomal domains after Fgf8
has become localized in the myotome. In mouse, it has been shown that
expression of FGFs in the myotome is directly controlled by a myotome-specific
enhancer activated by the myogenic determinancy factors Myf5 and
Myod; thus, it is only upon differentiation that the myofibers
express FGFs (Fraidenraich et al.,
2000
; Grass et al.,
1996
). Additionally, there is evidence in both mouse and chick
that sonic hedgehog signaling arising from the ventral midline is required for
expression of the myotomal FGFs
(Fraidenraich et al., 2000
;
Huang et al., 2003
).
It is clear that FGF expression in the myotome is central to the regulation of gene expression in the syndetome, and that the localized activity of factors acting downstream of the activated FGFR, such as Pea3 and Erm, results in restricted expression of genes such as Scx within the syndetome, thereby defining the boundaries of the syndetome. We have shown that despite widespread expression of Fgfr1, once Pea3 and Erm have become circumscribed to the anterior and posterior dorsal sclerotome encompassing the syndetome, their restricted expression, combined with the presence of continued FGF signaling, restricts Scx activation to the syndetome. But although we have identified a role for Pea3 and Erm acting downstream of FGF signaling to produce restricted activation of target genes, it must be emphasized that, in addition to transducing FGF signaling, Pea3 and Erm actually depend on FGFs for their own induction. Thus, a new question is introduced: how does myotomal FGF signaling regulate expression of Pea3 and Erm within the anterior and posterior sclerotome and dermomyotome? The combined expression, only within the anterior and posterior dorsal sclerotome, and ventral dermomyotome, of Scx, members of the Fgf8 synexpression group and phosphorylated MAPK/ERK, suggests that there is a very specific region of localized, active FGF signaling in the somite. But what is striking is that while the focus of this signaling within the anterior and posterior dorsal sclerotome and ventral dermomyotome does not correspond with the source of the ligand at the center of the myotome, the secreted FGFs from the center of the myotome nonetheless activate FGF signal transduction only within the anterior and posterior somite to produce restricted expression of Pea3 and Erm. The fact that FGF signaling is most active in and around the syndetome suggests that the induction of Pea3 and Erm within the anterior and posterior sclerotome is not the result of a simple diffusion gradient of FGFs from the center of the myotome. Instead, these observations indicate a good deal of complexity underlying when and where FGFRs are activated in the somites, and suggest that additional mechanisms for regulating FGF signaling must be present to ensure reception specifically in the anterior and posterior somite encompassing the syndetome. One of these mechanisms might involve control of FGF translation and secretion. Although Fgf8 mRNA is localized to the center of the myotome, it remains possible that FGF8 protein is either specifically expressed in the anterior and posterior myotome, or preferentially secreted from those regions of the myotome, thus increasing the exposure of the anterior and posterior sclerotome and dermomyotome to FGF signals. Other levels of regulation might include either localized expression within the anterior and posterior somite of a co-receptor required for FGFR activation, or localized expression of components of the extracellular matrix, such as heparan sulfate proteoglycans, that could act to restrict or potentiate FGF signaling within those domains. Finally, it remains possible that the upregulation of FGFR1 expression within the syndetome is sufficient to restrict FGF signaling to this region. Although it is as yet uncertain which, if any, of these mechanisms for controlling the spatial distribution of active FGF signaling plays a role during activation of Pea3, Erm and, later, Scx within the syndetome, it is clear that the domains of these three FGF-responsive genes are dependent on more than just the expression patterns of ligand and receptor.
Anterior and posterior localization of somitic tendon progenitors and formation of the vertebral motion segment
The fact that the future muscle lineage signals to the future cartilage
lineage to induce the tendon progenitors at the border between the two,
ensures that the developing axial tendons will be in position to form the
attachments associated with the axial musculoskeletal system. Motility of the
vertebral column is ensured during differentiation of the somite derivatives
through the process of somite resegmentation, in which the position of the
future vertebrae relative to the somite boundaries shifts one half segment
(Brand-Saberi and Christ,
2000
). Chick-quail chimera and cell-labeling experiments have
shown that a single somite gives rise to the anterior and posterior halves of
two adjacent vertebral bodies as well as the intervertebral tissues
(Aoyama and Asamoto, 2000
;
Bagnall et al., 1988
;
Huang et al., 2000
;
Huang et al., 1996
). By
contrast, the myotome and syndetome do not undergo resegmentation, with the
result that a single somite provides the information for one segmental epaxial
muscle, including its tendon attachments
(Aoyama and Asamoto, 2000
;
Bagnall et al., 1988
;
Brent et al., 2003
;
Huang et al., 2000
;
Huang et al., 1996
). Because
the connection of one epaxial segmental muscle to two adjacent vertebrae
allows for free movement of the vertebral column, the somite has been
described as generating the `vertebral motion segment' a functional unit
consisting of two adjacent vertebrae, the intervertebral tissues, and the
tendons, ligaments and muscles that act on that segment
(Huang et al., 1996
). But in
order for the segmented epaxial muscles derived from a single somite to
properly attach to the resegmented vertebrae, it is crucial that the tendons
develop at the anterior and posterior ends of the segmented muscle. Thus, the
restriction of FGF-dependent induction of Scx to the anterior and
posterior somite is essential to proper development of a functional and fully
motile axial musculoskeletal system.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Aoyama, H. and Asamoto, K. (2000). The developmental fate of the rostral/caudal half of a somite for vertebra and rib formation: experimental confirmation of the resegmentation theory using chick-quail chimeras. Mech. Dev. 99, 71-82.[CrossRef][Medline]
Bagnall, K. M., Higgins, S. J. and Sanders, E. J. (1988). The contribution made by a single somite to the vertebral column: experimental evidence in support of resegmentation using the chick-quail chimaera model. Development 103, 69-85.[Abstract]
Bojovic, B. B. and Hassell, J. A. (2001). The
PEA3 Ets transcription factor comprises multiple domains that regulate
transactivation and DNA binding. J. Biol. Chem.
276,4509
-4521.
Brand-Saberi, B. and Christ, B. (2000). Evolution and development of distinct cell lineages derived from somites. Curr. Top. Dev. Biol. 48, 1-42.[Medline]
Brent, A. E. and Tabin, C. J. (2002). Developmental regulation of somite derivatives: muscle, cartilage and tendon. Curr. Opin. Genet. Dev. 12,548 -557.[CrossRef][Medline]
Brent, A. E., Schweitzer, R. and Tabin, C. J. (2003). A somitic compartment of tendon progenitors. Cell 113,235 -248.[CrossRef][Medline]
Chambers, D. and Mason, I. (2000). Expression of sprouty2 during early development of the chick embryo is coincident with known sites of FGF signalling. Mech. Dev. 91,361 -364.[CrossRef][Medline]
Corson, L. B., Yamanaka, Y., Lai, K. M. and Rossant, J.
(2003). Spatial and temporal patterns of ERK signaling during
mouse embryogenesis. Development
130,4527
-4537.
Cserjesi, P., Brown, D., Ligon, K. L., Lyons, G. E., Copeland, N. G., Gilbert, D. J., Jenkins, N. A. and Olson, E. N. (1995). Scleraxis: a basic helix-loop-helix protein that prefigures skeletal formation during mouse embryogenesis. Development 121,1099 -1110.[Abstract]
Dickinson, R. J., Eblaghie, M. C., Keyse, S. M. and Morriss-Kay, G. M. (2002). Expression of the ERK-specific MAP kinase phosphatase PYST1/MKP3 in mouse embryos during morphogenesis and early organogenesis. Mech. Dev. 113,193 -196.[CrossRef][Medline]
Dockter, J. L. and Ordahl, C. P. (1998). Determination of sclerotome to the cartilage fate. Development 125,2113 -2124.[Abstract]
Dubrulle, J., McGrew, M. J. and Pourquie, O. (2001). FGF signaling controls somite boundary position and regulates segmentation clock control of spatiotemporal Hox gene activation. Cell 106,219 -232.[CrossRef][Medline]
Eblaghie, M. C., Lunn, J. S., Dickinson, R. J., Munsterberg, A. E., Sanz-Ezquerro, J. J., Farrell, E. R., Mathers, J., Keyse, S. M., Storey, K. and Tickle, C. (2003). Negative feedback regulation of FGF signaling levels by Pyst1/MKP3 in chick embryos. Curr. Biol. 13,1009 -1018.[CrossRef][Medline]
Firnberg, N. and Neubuser, A. (2002). FGF signaling regulates expression of Tbx2, Erm, Pea3, and Pax3 in the early nasal region. Dev. Biol. 247,237 -250.[CrossRef][Medline]
Fraidenraich, D., Iwahori, A., Rudnicki, M. and Basilico, C. (2000). Activation of fgf4 gene expression in the myotomes is regulated by myogenic bHLH factors and by sonic hedgehog. Dev. Biol. 225,392 -406.[CrossRef][Medline]
Furthauer, M., Lin, W., Ang, S. L., Thisse, B. and Thisse, C. (2002). Sef is a feedback-induced antagonist of Ras/MAPK-mediated FGF signalling. Nat. Cell Biol. 4, 170-174.[CrossRef][Medline]
Grass, S., Arnold, H. H. and Braun, T. (1996). Alterations in somite patterning of Myf-5-deficient mice: a possible role for FGF-4 and FGF-6. Development 122,141 -150.[Abstract]
Hacohen, N., Kramer, S., Sutherland, D., Hiromi, Y. and Krasnow, M. A. (1998). sprouty encodes a novel antagonist of FGF signaling that patterns apical branching of the Drosophila airways. Cell 92,253 -263.[CrossRef][Medline]
Hamburger, V. and Hamilton, H. L. (1951). A series of normal stages in the development of the chick embryo. J. Morphol. 88,49 -92.[CrossRef]
Huang, R., Zhi, Q., Neubuser, A., Muller, T. S., Brand-Saberi, B., Christ, B. and Wilting, J. (1996). Function of somite and somitocoele cells in the formation of the vertebral motion segment in avian embryos. Acta Anat. 155,231 -241.[Medline]
Huang, R., Zhi, Q., Brand-Saberi, B. and Christ, B. (2000). New experimental evidence for somite resegmentation. Anat. Embryol. 202,195 -200.[CrossRef][Medline]
Huang, R., Stolte, D., Kurz, H., Ehehalt, F., Cann, G. M., Stockdale, F. E., Patel, K. and Christ, B. (2003). Ventral axial organs regulate expression of myotomal Fgf-8 that influences rib development. Dev. Biol. 255, 30-47.[CrossRef][Medline]
Itoh, N., Mima, T. and Mikawa, T. (1996). Loss of fibroblast growth factor receptors is necessary for terminal differentiation of embryonic limb muscle. Development 122,291 -300.[Abstract]
Janknecht, R., Monte, D., Baert, J. L. and de Launoit, Y. (1996). The ETS-related transcription factor ERM is a nuclear target of signaling cascades involving MAPK and PKA. Oncogene 13,1745 -1754.[Medline]
Kahane, N., Cinnamon, Y., Bachelet, I. and Kalcheim, C. (2001). The third wave of myotome colonization by mitotically