|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 2, 2004
doi: 10.1242/10.1242/dev.01282


1 Institut de Génétique et de Biologie Moléculaire et
Cellulaire, CNRS UMR7104, BP 10142-67404 Illkirch Cedex, CU de Strasbourg,
France
2 DIBIT, H San Raffaele, Via Olgettina 58, 20132 Milano, Italy
3 Laboratoire de Génétique et Physiologie du Développement,
IBDM, CNRS/INSERM/Université de la Méditerranée, Campus
de Luminy, 13288 Marseille Cedex 9, France
4 Department of Animal Biology, University of Modena and Reggio Emilia, via
Campi 213/D, 41100 Modena, Italy
5 Department of Cell and Molecular Biology, Karolinska Institute, S-171 77
Stockholm, Sweden
6 CNRS UMR8542, Ecole Normale Supérieure, Département de Biologie,
75005 Paris, France
Author for correspondence (e-mail:
rijli{at}igbmc.u-strasbg.fr)
Accepted 13 May 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Hoxb1, Hoxb2, Nkx2.2, Pbx1a, Prep1, Motoneuron, Hindbrain, Transcriptional activation, Derepression, Ternary complex, PH and P/M binding sites, AP and DV integration
| Introduction |
|---|
|
|
|---|
In vertebrates, distinct sets of spatially restricted homeodomain (HD)
transcription factors provide transcriptional readouts of AP and DV positional
addresses in neural progenitors. Along the AP axis, distinct progenitor
domains are generated by the nested expression patterns of the Hox
HD-containing genes (Lumsden and Krumlauf,
1996
). In the ventral neural tube, DV positional addresses are
instead conferred by Nkx-, Dbx-, Pax- and Irx-class HD proteins
(Briscoe et al., 2000
). Along
both axes, auto- and crossregulatory activities among HD factors are required
to refine and/or maintain progenitor domains
(Briscoe et al., 2000
;
Dasen et al., 2003
;
Maconochie et al., 1997
;
Popperl et al., 1995
). The
combined activity of HD genes is thought to activate other sets of
transcription factors that, in turn, regulate the expression of unique
neuronal phenotypes (Lee and Pfaff,
2001
). Neuronal identity is therefore the result of a complex
regulatory network of transcription factors acting sequentially. Despite the
increasing knowledge about genetic cascades and epistatic relationships among
HD factors, little is known about their direct downstream targets and how AP
and DV molecular inputs are integrated for precise spatiotemporal
transcriptional regulation.
Hox genes are involved in the specification of motoneuron (MN) subtype
identities along the AP axis, both at spinal cord and hindbrain levels
(Barrow and Capecchi, 1996
;
Cooper et al., 2003
;
Dasen et al., 2003
;
Davenne et al., 1999
;
Gaufo et al., 2000
;
Gaufo et al., 2003
;
Gavalas et al., 1997
;
Goddard et al., 1996
;
Guidato et al., 2003
;
Jungbluth et al., 1999
;
Pattyn et al., 2003a
;
Studer et al., 1996
;
Tiret et al., 1998
). In
ventral r4, for example, the development of facial branchiomotor (BM) neurons
depends on Hoxb1 and Hoxb2 functions, raising the question
of their direct molecular target(s). Transcriptional specificity of Hox
factors is achieved upon heterodimerization with Pbx HD factors, murine
homologs of Drosophila extradenticle (exd), and binding of
bipartite PH sites (Chan et al.,
1994
; Maconochie et al.,
1997
; Mann and Affolter,
1998
; Mann and Chan,
1996
; Popperl et al.,
1995
). Pbx-Hox binding and transcriptional activity are further
enhanced by Prep or Meis proteins, murine homologs of Drosophila
homothorax (hth), and additional members of the TALE (three-amino
acid-loop-extension) class of HD factors
(Burglin, 1997
). By binding of
distinct P/M sites in the vicinity of PH sites and direct interaction with
Pbx, Prep/Meis/Hth proteins facilitate the formation of transcriptionally
active ternary complexes (Berthelsen et
al., 1998a
; Berthelsen et al.,
1998b
; Ferretti et al.,
2000
; Gebelein et al.,
2002
; Jacobs et al.,
1999
; Ryoo et al.,
1999
). For example, Hox-Pbx-Prep complexes are involved in the
maintenance of Hoxb1 and Hoxb2 transcription in r4
(Ferretti et al., 2000
;
Jacobs et al., 1999
;
Maconochie et al., 1997
;
Popperl et al., 1995
). Despite
these insights into the regulation of Hox-mediated transcription, and Hox gene
involvement in MN development, so far no direct Hox target gene has been
identified that is required for MN specification and/or differentiation.
In the ventral neural tube, specification of neuronal progenitors requires
HD factors that function as repressors of other repressors, that is by
transcriptional derepression of downstream targets
(Briscoe et al., 2000
;
Muhr et al., 2001
). Similar
derepression strategies have been conserved in various tissues or animal
systems, indicating that they are efficient ways of keeping control of target
gene expression (Barolo and Posakony,
2002
). Nonetheless, a derepression strategy involves the existence
of transcriptional activators driving neuronal specification in suitably
derepressed environments. Recently, retinoic acid signaling was identified as
one of such activator pathways, involved in somatic MN (sMN) specification in
the spinal cord (Novitch et al.,
2003
). While providing a rationale for how activators and
repressors may interact to drive cell fate in a specific progenitor domain,
the molecular mechanisms that allow switching from transcriptional repression
to activation of target genes remain poorly understood. It is also important
to investigate whether neuronal specification in other regions of the
vertebrate CNS may rely on similar mechanisms. In the hindbrain, for example,
it is unknown how the repressor activities of Nkx HD proteins may integrate
with Hox factors to achieve spatially restricted regulation of MN programs and
downstream targets.
Here, we have investigated the transcriptional regulation of the paired HD
transcription factor Phox2b. In the mouse hindbrain, Phox2b
is expressed in longitudinal columns, spanning several rhombomeres, that
identify distinct populations of neural progenitors and postmitotic neurons
(Pattyn et al., 1997
).
Phox2b is an obligatory determinant of cranial BM and visceral motor
(VM) neuron specification (Dubreuil et
al., 2002
; Pattyn et al.,
2000
). BM and VM neurons collectively referred to as vMN
innervate the muscles of the branchial arches and the parasympathetic
ganglia, respectively. All vMNs are generated from a common ventral progenitor
domain, pMNv, which is equivalent to the spinal p3 domain generating V3
interneurons (Briscoe et al.,
2000
; Pattyn et al.,
2003a
; Pattyn et al.,
2003b
). Throughout the hindbrain, the pMNv domain expresses
Nkx2.2 and Nkx2.9, as well as Nkx6.1 and
Nkx6.2 (Briscoe et al.,
2000
; Pattyn et al.,
2003b
). However, the distribution of vMN subtypes is rhombomere
specific. Rhombomere 1 does not generate vMNs, r2-4 generate only BM neurons,
whereas r5-7 generate both BM and VM neurons. In Phox2b knockout
mice, vMN progenitors either do not exit the cell cycle or switch to a
serotonergic fate (Dubreuil et al.,
2000
; Pattyn et al.,
2000
; Pattyn et al.,
2003a
). Thus, Phox2b acts as a binary switch in the
selection of vMN or serotonergic fate. In Hoxb1 and Hoxb2
knockout mice, maintenance of Phox2b expression is impaired and this
results in facial BM to serotonergic fate switch in ventral r4
(Pattyn et al., 2003a
).
We show that Phox2b is a direct target of Hoxb1 and Hoxb2. We identify a conserved Phox2b enhancer containing separate PH and P/M sites, both of which are essential for ventral r4 regulation. We further show that transcriptional cooperation among Hox, Pbx, Prep factors and Nkx2.2, via a derepression mechanism, is an important component of Phox2b enhancer activity. In addition, cooperation between Hox paralogs 1 or 2 and Nkx2 factors is required in vivo to generate ectopic Phox2b-expressing vMNs. These findings provide a molecular rationale to explain how AP and DV inputs are integrated on the Phox2b promoter to drive restricted expression in the r4 pMNv domain and facial MN fate.
| Materials and methods |
|---|
|
|
|---|
TN
(Muhr et al., 2001
PM/lacZ and P2b_0.38mPM/lacZ were generated
with the Stratagene QuickChangeTM Site-directed Mutagenesis Kit. To
introduce nucleotide changes in the PH site the following primers were used:
5'TTCCAAGTAGCGTCGTTCGATTAAAGGGCAGGAGCTGGTTAGAAG3' (sense) and
5'CTTCTAACCAGCTCCTGCCCTTTAATCGAACGACGCTACTTGGAA3' (antisense). To
introduce mutations in the P/M site the following primers were used:
5'GCCCAATAGACGGATGAGTTAGTAAAAAGCGCCAGCAATAAG3' (sense) and
5'CTTATTGCTGGCGCTTTTTACTAACTCATCCGTCTATTGGGC3' (antisense) for
P2b_0.38
PM/lacZ; and
5'GCCCAATAGACGGATGAGTTATCTGTATGTAAAAAGGCGCAGC3' (sense) and
5'GCTGGCGCTTTTTACATACAGATAACTCATCCGTCTATTGGGC3' (antisense) for
P2b_0.38mPM/lacZ. To construct P2b_10
PH/lacZ, a 1.3
kb NheI-XmaI fragment containing the P2b_0.38 enhancer was
subcloned from the P2b_10/lacZ into pBluescript KS (Stratagene).
Deletion of 11 bp, including the PH site was obtained by using the following
primers: 5'TCATTATTTCCAAGTAGCGTAGGGCAGGAGCTGGTTAGAA3' (sense) and
5'TTCTAACCAGCTCCTGCCCTACGCTACTTGGAAATAATG3' (antisense). The
wild-type 1.3 kb fragment in P2b_10/lacZ was replaced by the fragment
including the PH deletion to obtain P2b_10
PH/lacZ. The
p3xPH/Luc and p3xPH/lacZ reporter plasmids were obtained by
cloning into the NheI site of p-ßglob-Luc or the
XbaI site of BGZ40, respectively, the following double stranded
fragment containing three copies of the PH site and adjacent sequences (17
bp):
5'ACTTACTAGTCGTGATTGAATTAAAGGCGTGATTGAATTAAAGGCGTGATTGAATTAAAGGACTAGTACTT3'
with its complementary antiparallel oligonucleotide. The reporter plasmid
p3xmPH/Luc was constructed as p3xPH/Luc, except that the PH
site was mutated as in P2b_0.38mPH/Luc and
P2b_0.38mPH/lacZ.
|
Transient transfection assays
P19 embryonic carcinoma cells were cultured in Dulbecco minimal essential
media supplemented by 5% fetal calf serum and 5% delipidated fetal calf serum.
Cells were seeded, incubated for 36 hours and transient transfections were
performed using Lipofectamine 2000 (Invitrogen) according to the
manufacturer's protocol. In a typical experiment, 500 ng of reporter plasmid,
250-500 ng of each expression construct and 100 ng of pCMV-ß-gal (as a
control of transfection efficiency) were used per well in six-well plates.
Cells were lysed 40-45 hours after transfection then assayed for luciferase
activity. Values were normalized by ß-gal activity. Data represent means
of duplicate values from representative experiments. All transfections were
independently repeated at least three times.
Transient transgenic analysis in mouse embryos
Generation of mouse transgenic embryos was performed as described
(Popperl et al., 1995
).
Embryos were harvested at E10.5. ß-Gal was detected either by whole-mount
in situ hybridization with a lacZ probe (a kind gift of M. Kmita) or
by X-Gal staining.
Electrophoretic mobility shift assays (EMSAs)
Proteins were in vitro translated using the coupled TNT
transcription/translation system (Promega) in the presence of 35S
methionine. Proteins were visualized by SDS-PAGE, followed by autoradiography.
EMSA was performed according to (Ferretti
et al., 2000
). Antibodies used are polyclonal anti-Hoxb1 (Babco),
polyclonal anti-Pbx1 and anti-Prep1 (Santa Cruz Biotechnology).
Immunostaining and in situ hybridization
Monoclonal anti-Isl1/2 (Developmental Studies Hybridoma Bank) was used for
immunohistochemistry, as described
(Tsuchida et al., 1994
). Chick
Phox2b (Ernsberger et al.,
1995
), Isl2 (Tsuchida
et al., 1994
) and Hb9
(Lee and Pfaff, 2001
) probes
were used for in situ hybridization as described previously
(Gavalas et al., 1997
).
| Results |
|---|
|
|
|---|
Characterization of a conserved proximal enhancer and analysis of its regulatory potential in the chick neural tube
To identify conserved cis-regulatory elements within the 2.8 kb fragment
potentially involved in r4 restricted regulation, we compared its sequence
with Phox2b genomic sequences from other organisms. A stretch of 376
base pairs (bp) in the mouse proximal promoter region (GenBank Accession
Number AY 640178) was highly conserved in human and rat (97% at the nucleotide
level), as well as pufferfish (Fugu) and zebrafish (Danio) Phox2b
genomic regions (Fig. 2A,B). To
test for regulatory potential of this conserved region, we used in ovo
electroporation in the chick hindbrain. This is a suitable system to study
conservation of transcriptional regulatory mechanisms (e.g.
Itasaki et al., 1999
;
Manzanares et al., 2001
). We
electroporated a lacZ reporter construct carrying the mouse 376 bp
Phox2b conserved enhancer (P2b_0.38/lacZ) into
neuroepithelial cells along one side of the neural tube of stage HH10-12 chick
embryos. High reporter expression levels were restricted to r4 and, to a
lesser extent, to r2, whereas only weak activation was found in other
hindbrain regions or rostral spinal cord
(Fig. 3C). In r4, expression
always extended more ventrally than in r2 (arrow,
Fig. 3C). Electroporation of a
control construct without the enhancer did not result in any activation (data
not shown).
|
|
Transactivation of the Phox2b enhancer by Hox proteins and Pbx and Prep co-factors
To investigate transactivation by Hox transcription factors, we transfected
murine embryonal carcinoma P19 cells, a suitable system for the analysis of
the transcriptional activity of Hox proteins
(Di Rocco et al., 2001
;
Saleh et al., 2000
). A
Luciferase reporter construct driven by the conserved Phox2b
enhancer in front of a minimal promoter (P2b_0.38/Luc) was
co-transfected along with Hoxb1, HOXB2 or Hoxa2 expression vectors. A three-
to fourfold increase of P2b_0.38/Luc basal transcriptional activity
was observed with either one of the Hox vectors
(Fig. 3A; not shown). To extend
these findings in vivo, we co-electroporated Hox vectors with
P2b_0.38/lacZ (Fig.
3E,G,I) in the chick neural tube. We observed a marked
upregulation of P2b_0.38/lacZ activity in the hindbrain and rostral
spinal cord of embryos co-electroporated with either Hoxb1 (n=21/32),
HOXB2 (n=10/12) or Hoxa2 (n=12/18), when compared with
P2b_0.38/lacZ alone (Fig.
3C). Unlike the modest transactivation observed in P19 cells
(Fig. 3A), this robust effect
indicated that the in vivo activity of electroporated Hox proteins may be
enhanced by the presence of endogenous co-factors. We therefore tested whether
Hox transcriptional activity on P2b_0.38/Luc was improved by
co-transfections with Pbx1a and Prep1 expression vectors
(Fig. 3A). Pbx1a or Prep1 alone
were unable to stimulate the reporter activity more than two- to threefold. By
contrast, co-transfection of either Hoxb1, HOXB2 or Hoxa2 with Pbx1a and Prep1
co-factors resulted in a significant 13-14-fold enhancement of transcription
(Fig. 3A; and not shown).
In summary, the Phox2b conserved enhancer can be transactivated by Hoxb1, HOXB2 or Hoxa2 both in cultured cells and chick neural tube. Furthermore, the observed Hox-mediated transcriptional activity is enhanced by the co-factors Pbx1a and Prep1. These results strongly suggest that DNA binding site(s) for Hox proteins and their co-factors are present in the P2b_0.38 enhancer.
The Phox2b enhancer contains conserved Pbx-Hox and Prep/Meis binding sites
Indeed, sequencing of the Phox2b enhancer revealed the presence of
a putative bipartite PH-binding site (TGATTGAA)
(Fig. 2B). Notably, its
nucleotide sequence was identical to that of the low-affinity PH binding site
of repeat 2 (R2) of the Hoxb1 autoregulatory (b1-ARE) r4 enhancer
(Popperl et al., 1995
)
(Fig. 2C). Moreover, it shared
fairly high conservation with the PH site present in the Hoxb2 r4
enhancer, also regulated by Hoxb1
(Ferretti et al., 2000
;
Jacobs et al., 1999
;
Maconochie et al., 1997
)
(Fig. 2C). Similar to the
Hoxb1 and Hoxb2 r4 enhancers, we also found a conserved P/M
site (TTGTCATG), downstream of the PH site
(Fig. 2B,C). The
Phox2b P/M site and its flanking nucleotides exactly matched the
sequence found in the Hoxb1 r4 enhancer and shared six out of eight
nucleotides with that in the Hoxb2 r4 enhancer
(Ferretti et al., 2000
;
Jacobs et al., 1999
).
Interestingly, unlike the previously identified PH and P/M sites lying in
relative proximity to each other, the Phox2b P/M site was 147
nucleotides distant from the PH site (Fig.
2B).
Hox, Pbx, and Prep proteins form a ternary complex on the Phox2b enhancer
To test for direct binding, we run EMSA assays using Hox, Pbx1a and/or
Prep1 in vitro translated proteins on a 30 bp oligonucleotide probe containing
the Phox2b PH site and flanking sequences, or on a PCR-amplified
radiolabeled fragment (233 bp) including both PH and P/M sites in their native
context (Fig. 4A,B). As for the
Hoxb1 and Hoxb2 r4 enhancers
(Berthelsen et al., 1998a
;
Ferretti et al., 2000
;
Jacobs et al., 1999
;
Popperl et al., 1995
), the
PH-containing probe (Fig. 4A)
was readily bound by Pbx-Prep heterodimers, whereas no binding was observed
with Pbx or Prep on their own (Fig.
4A, lane 4 arrow; not shown). Moreover, nucleotide changes of the
PH site (same mutation as in Fig.
3B,D and
6B,D; see below) abrogated
binding of the Pbx-Prep heterodimer (not shown). By contrast, we did not
detect Hoxb1-Pbx1a heterodimers nor Hoxb1-Pbx1a-Prep1 heterotrimers,
indicating low in vitro binding affinity of the PH site for Hox-containing
multimeric complexes (Fig. 4A,
lanes 3,5). Such binding behavior was consistent with that of the PH site in
the R2 of the b1-ARE r4 enhancer (Popperl
et al., 1995
), which did not show cooperative binding of Pbx-Hox
complexes in vitro, while contributing to Hoxb1 r4 expression in vivo
(Popperl et al., 1995
) (see
Discussion).
|
|
|
The PH and P/M sites are both essential for Phox2b enhancer activity in ventral r4
To test the involvement of the PH site in the activity and spatial
regulation of the Phox2b enhancer, we introduced nucleotide mutations
changing TGATTGAA to TcgTTcgA, while leaving the rest of the enhancer
unaltered. Similar nucleotide changes were previously shown to impair PH site
activity in the Hoxb1 and Hoxb2 enhancers
(Ferretti et al., 2000
).
A Luc construct carrying the mutated enhancer (P2b_0.38mPH/Luc) was co-transfected in P19 cells along with Hoxb1, HOXB2, Hoxa2, Pbx1a and/or Prep1 vectors. The transcriptional activity of P2b_0.38mPH/Luc induced by each protein alone remained just above the basal level (compare Fig. 3A with 3B; and not shown). Notably, the enhanced transcriptional response induced by Hox/Pbx or Hox/Pbx/Prep combinations on the wild-type enhancer (Fig. 3A) was abrogated on the P2b_0.38mPH/Luc construct (Fig. 3B).
To investigate the PH site requirement for Hox-mediated spatial regulation, a lacZ construct carrying the mutated Phox2b enhancer (P2b_0.38mPH/lacZ) was electroporated in the neural tube of stage HH10-12 chick embryos. Twenty-four hours later, two main expression differences were observed with the mutant P2b_0.38mPH/lacZ construct, when compared with the wild-type P2b_0.38/lacZ (compare Fig. 3C,D). First, a general decrease of ß-gal expression levels and/or number of expressing cells throughout the expression domain. Second, the ventral domain of r4 expression was invariably lost or severely impaired (n=34/34; arrow, Fig. 3D). Mutation of the PH site also severely reduced Hox-induced upregulation of the enhancer, as assessed by co-electroporation of P2b_0.38mPH/lacZ and Hoxb1 or Hox paralog group 2 vectors (compare Fig. 3E,F; data not shown). Thus, the PH site is an essential component of Hox-mediated regulation in ventral r4.
As the PH site contributes to ventral r4 expression in the context of the Phox2b enhancer, we next asked whether it was also sufficient to direct spatially restricted expression in the chick hindbrain. However, unlike the full enhancer (Fig. 3C), the p3xPH/lacZ construct, driven by three copies of a 17 bp oligonucleotide containing the Phox2b PH site and flanking sequences, was weakly active and did not display spatially restricted reporter expression in electroporated embryos (n=32/32, Fig. 6E; see Discussion). Thus, interactions with additional sequences within the Phox2b enhancer are required for the PH site to fully function in vivo. To determine if the P/M motif also contributes to enhancer activity, we generated a six-nucleotide deletion (Fig. 3H) or a four-nucleotide exchange (Fig. 3J; same mutation that abolishes ternary complex binding in vitro in Fig. 4) of the P/M site in the Phox2b enhancer and tested their effects on reporter activity in chick electroporation. Notably, both P/M mutations phenocopied the PH mutation and abrogated ventral reporter expression in r4 (n=30/30, Fig. 3H; n=12/12, Fig. 3J).
Thus, the PH and P/M sites are both essential for Hox-mediated transcriptional regulation of the Phox2b enhancer activity in ventral r4, strongly supporting the involvement of a Hox-Pbx-Prep transcriptionally active ternary complex in vivo.
An intact PH site is essential for Phox2b regulation in the mouse ventral r4 progenitor domain
To investigate the relevance of the PH motif to Hox-mediated regulation of
mouse Phox2b, we generated an 11 bp deletion of the PH site (same
mutation that abolishes ternary complex formation in vitro;
Fig. 4) in the context of the
10 kb Phox2b genomic construct (P2b_10
PH/lacZ), and
tested it in mouse transgenic embryos (Fig.
5). Analysis of whole-mount hindbrains of E10.5 transgenic embryos
did not reveal overt differences in reporter expression between mutated and
wild-type constructs (compare Fig.
5A,B; Fig. 1B; data
not shown), indicating that the establishment of the major domains of
Phox2b expression in the hindbrain does not depend on an intact PH
site. However, a selective, spatially restricted, difference was detected in
ventral r4 upon sectioning of embryos carrying the mutant construct
(Fig. 5D). B-gal expression in
the pMNv progenitor domain was eliminated (six out of 11 embryos) or severely
reduced (the five remaining embryos; Fig.
5D), whereas mantle layer (ML) expression was not significantly
affected (Fig. 5B,D; data not
shown).
The effect of the PH site deletion precisely mirrored the loss or reduction
of Phox2b expression in the r4 pMNv progenitor domain of E10.5
Hoxb1/ or
Hoxb2/ mutant embryos, respectively
(Davenne et al., 1999
;
Gaufo et al., 2000
) (see
Pattyn et al., 2003a
). In
these mutants, ventral r4 expression of Phox2b at E10.5 is not
properly maintained, leading to a facial MN to serotonergic switch of
progenitor fate. Our results therefore strongly suggest that maintenance of
Phox2b expression by Hoxb1 and/or Hoxb2 in ventral r4 progenitors is
directly regulated through the PH site. Moreover, the PH site appears to
integrate both AP and DV regulatory inputs as its mutation affects ventral
regulation in r4.
Transcriptional cooperation of Hox and Nkx2 proteins on the Phox2b enhancer
Nkx2 proteins are good candidates for providing DV regulatory inputs that
restrict Phox2b expression to the pMNv domain. In fact,
Nkx2.2/2.9 and Phox2b expression patterns are co-extensive
in the pMNv domain (Pattyn et al.,
2003a
). Moreover, gain-of-function studies have involved Nkx2
proteins in ectopic Phox2b activation
(Pattyn et al., 2003b
). Thus,
Nkx2 patterning factors may interact with Hox and their co-factors to allow
high Phox2b expression levels specifically in the ventral r4
progenitor domain. To test whether Hox and Nkx2 factors transcriptionally
cooperate to regulate the Phox2b enhancer, we first examined the
transcriptional activity of Nkx2 factors on P2b_0.38/Luc in P19
cells. Co-transfection of Nkx2.2 or Nkx2.9 vectors alone did not stimulate
reporter activity more than two- to threefold, comparable with the modest
activity induced by Hoxb1 alone (Fig.
6A; data not shown). Co-transfection of Nkx2.2 with Pbx and Prep,
in the absence of Hoxb1, did not stimulate reporter activity more than
fourfold (Fig. 6A). Notably,
when Hoxb1 was co-expressed with Nkx2.2, reporter activity was cooperatively
stimulated up to tenfold. Further addition of Pbx and Prep co-factors resulted
in a synergistic enhancement of transcription up to 20-fold, significantly
exceeding the transcriptional enhancement observed with only Hox, Pbx and Prep
(Fig. 6A). Importantly,
mutation of the PH site within the context of the full enhancer abolished the
transcriptional cooperation between Hox, its HD co-factors and Nkx2.2
(P2b_0.38mPH/Luc; Fig.
6B).
Transcriptional activation by Hox factors is enhanced by Nkx2.2-mediated derepression
In principle, the transcriptional enhancement mediated by Nkx2.2 in the
presence of Hoxb1 and its co-factors may require DNA binding on the conserved
Phox2b enhancer. However, in EMSA assays Nkx2.2 did not bind any
potential Nkx consensus binding site or core HD-binding sequence from the
Phox2b enhancer (data not shown). Most compellingly, co-transfection
of a Nkx2.2HD-VP16 chimeric construct, consisting of the HD of Nkx2.2
(Nkx2.2HD) coupled to the VP16 activator domain
(Muhr et al., 2001
), did not
stimulate transcription of P2b_0.38/Luc
(Fig. 6A), in keeping with the
idea that Nkx2.2 does not bind the enhancer.
In the ventral neural tube, Nkx transcription factors work as
transcriptional repressors (Muhr et al.,
2001
). However, on the Phox2b enhancer Nkx2.2 stimulates
transcriptional activation, even though only in the presence of Hoxb1 and its
co-factors (Fig. 6A). In
principle, this positive effect could also be the result of Nkx2.2 acting as a
repressor, by relieving an inhibition on the transcriptional activation
stimulated by Hox and co-factors.
We therefore examined the activity of a hybrid construct consisting of
Nkx2.2HD coupled to the Engrailed repressor domain (Nkx2.2HD-EnR). This
construct functions as a repressor in transfection assays, and mimics the
repressive ability of full-length Nkx2.2 in the chick neural tube
(Muhr et al., 2001
).
Strikingly, co-transfection of Nkx2.2HD-EnR in the presence of Hoxb1, Pbx1a
and Prep1 led to a 25-fold stimulation of the P2b_0.38/Luc reporter
transcription, while co-transfection of Nkx2.2HD-EnR alone had no effect
(Fig. 6A). Thus, the observed
Nkx2.2-mediated enhancement of Hox, Pbx and Prep-induced transcription is
accounted for by its repressor activity, as it can be mimicked by the EnR
domain.
Next, we asked whether the PH site is sufficient to mediate Hox and Nkx2.2
cooperation. Co-transfection in P19 cells of the p3xPH/Luc construct,
which contains three copies of a 17 bp oligonucleotide including the PH site
and its flanking sequences, along with Hoxb1, Pbx1a, Nkx2.2 or Nkx2.2HD-EnR
vectors alone did not stimulate reporter activity more than twofold
(Fig. 6C). Co-expression of
Hoxb1 and Pbx1a enhanced p3xPH/Luc activation by about sevenfold.
Importantly, co-transfection of Hoxb1 and Pbx1a with Nkx2.2 or Nkx2.2HD-EnR
resulted in a robust synergistic stimulation of reporter activity by 14-fold
and 20-fold, respectively (Fig.
6C), reproducing the effect observed with the full enhancer. This
effect was abolished upon mutation of the PH site (p3xmPH/Luc;
Fig. 6D). Notably,
co-expression of Hoxb1 and Pbx1a with a truncated version of Nkx2.2 lacking
the N-terminal TN domain (Nkx2.2
TN), which mediates interaction with
co-repressors of the Groucho (Gro)/TLE family
(Muhr et al., 2001
), almost
abolished transcriptional synergy (Fig.
6C).
Finally, the modest activity observed with Nkx2.2 (or Nkx2.2HD-EnR) when
co-transfected alone with p3xPH/Luc
(Fig. 6C), suggested that
Nkx2.2 is not sufficient on its own to stimulate transcription at the PH site
in the absence of Hox and Pbx co-factors, the endogenous levels of which are
low in P19 cells (Saleh et al.,
2000
). We therefore tested whether overexpressing Nkx2.2
stimulated transcriptional activity at the PH site in the chick neural tube, a
context in which Hox and its co-factors are endogenously available.
Interestingly, although weakly active alone
(Fig. 6E; see above), the
p3xPH/lacZ reporter expression was significantly stimulated by
co-electroporation of either Nkx2.2 or Nkx2.2HD-EnR vectors (n=14/16,
Fig. 6F; n=10/12,
Fig. 6G).
Altogether, these data indicate that Nkx2.2-mediated derepression, partially regulated through interaction with Gro corepressor(s), alleviates a repressive activity at, or in the vicinity of, the PH site, allowing transcriptional activation by Hox and Pbx factors (Fig. 6H,I; see Discussion). These data provide a molecular framework for understanding how AP and DV molecular inputs are integrated on the Phox2b enhancer and have relevance for the mechanism of generation of vMNs at specific hindbrain locations.
In vivo cooperation of Hox and Nkx2 factors generates ectopic Phox2b-expressing branchiomotor neurons
The ectopic expression of Hoxb1 or Hoxa2 in r1, an area
normally devoid of BM neurons, led to the generation of ectopic facial or
trigeminal BM neurons, respectively
(Jungbluth et al., 1999
).
However, ectopic BM neurons were only detected ventrally, despite widespread
Hox expression throughout the dorsoventral extent of r1, suggesting
the requirement for an additional ventral input for BM neuron specification
(Jungbluth et al., 1999
). Nkx2
proteins could provide this ventral regulatory input, since electroporation of
Nkx2.2 in the chick hindbrain is sufficient to induce ectopic
Phox2b expression and generation of BM neurons at dorsal neural tube
levels (Pattyn et al.,
2003b
).
To investigate in vivo cooperation of Hox and Nkx2 factors in ectopic BM neuron generation, we first evaluated the AP distribution of ectopic Phox2b-expressing cells induced by forced Nkx2.2 expression. Stage HH10-12 embryos were electroporated and analyzed 48 hours later. Interestingly, ectopic Phox2b-expressing cells were detected at dorsal levels but only up to r2, i.e. within the Hox+ domain, and never in r1 (Fig. 7C). Conversely, forced Hoxb1 or Hoxa2 expression throughout the hindbrain resulted in ectopic Phox2b-expressing cells in r1, but only ventrally, i.e. within the Nkx2.2+ domain (Fig. 7A,B). No ectopic Phox2b expression was detected at dorsal levels (the dorsoventral extent of electroporation was assessed by GFP co-injection; data not shown). Interestingly, only the combination of either Hoxb1/Nkx2.2 or Hoxa2/Nkx2.2 vectors could stimulate the generation of ectopic Phox2b+, Isl1+, Isl2, Hb9 vMNs in dorsal r1 (Fig. 7D-I; data not shown).
|
| Discussion |
|---|
|
|
|---|
We have focused on the regulation of Phox2b expression in the pMNv
domain of ventral r4. The r4 pMNv domain gives rise to the facial BM and inner
ear efferent neurons of the VIIth cranial nerve
(Bruce et al., 1997
;
Pattyn et al., 2003a
;
Simon and Lumsden, 1993
;
Tiveron et al., 2003
), and
analysis of knockout mice revealed that Hoxb1 and Hoxb2 are required for
maintenance of the late phase of Phox2b expression in this progenitor
domain (Pattyn et al., 2003a
).
We provide several lines of evidence supporting a direct regulation by Hoxb1
and/or Hoxb2, involving Pbx and Prep/Meis proteins as co-factors. First,
ectopic expression of Hoxb1 or Hox paralog group 2 in the
chick neural tube can induce ectopic Phox2b expression
(Fig. 7). Second, a conserved
376 bp enhancer, enclosed within a 2.8 kb Phox2b genomic fragment
that drives ventrally restricted r4 expression in the mouse
(Fig. 1), contains separate PH
and P/M sites whose conserved sequences are hallmarks of Hox-mediated
transcriptional regulation in r4 (Fig.
2) (Ferretti et al.,
2000
; Jacobs et al.,
1999
; Popperl et al.,
1995
). An intact PH site is required for Hoxb1-, HOXB2- or
Hoxa2-mediated transactivation of the Phox2b enhancer, in both P19
cells and chick hindbrain (Fig.
3). Importantly, both the PH and P/M motifs are essential for
binding in vitro of a Hox-Pbx-Prep ternary complex and for enhancer activity
in ventral r4 of chick embryos. Finally, mutation of the PH site selectively
impairs the regulation of a mouse 10 kb Phox2b transgenic construct,
recapitulating endogenous Phox2b expression
(Fig. 1), in the ventral r4
pMNv domain (Fig. 5). Moreover,
the effect of the PH mutation faithfully mimics the endogenous Phox2b
downregulation observed in Hoxb1 and Hoxb2 knockout mice
(Pattyn et al., 2003a
).
Our results further suggest that Hoxa2 could also directly
regulate the Phox2b enhancer. However, analysis in Hoxa2
knockout mice did not reveal obvious Phox2b expression defects in
ventral r4, indicating a major role for Hoxb1 and Hoxb2 at
that level. By contrast, in Hoxa2 mutants Phox2b expression
is lost in the r2-r3 dorsal columns
(Davenne et al., 1999
).
Sequences mediating regulation by Hoxa2 in dorsal columns may reside outside
the 2.8 kb Phox2b genomic construct, as this fragment drives only
ventral expression in transgenic mice (Fig.
1C).
Altogether, our data lead us to conclude that, in the ventral r4 pMNv domain, Phox2b is a direct target of Hoxb1 and Hoxb2.
Functional differences between PH-P/M modules in the Phox2b and other Hox-regulated r4 enhancers
Similar to the Hoxb1 and Hoxb2 r4 enhancers, we found
separate PH and P/M sites embedded within the Phox2b enhancer.
Nevertheless, the in vivo output of Hox regulation on these three enhancers is
rather different, as the Phox2b PH or P/M sites mediate a
transcriptional response restricted to ventral progenitors, despite widespread
Hoxb1 and Hoxb2 distribution throughout r4. This is in keeping with the
observation that endogenous Phox2b expression is upregulated in sharp
columns of selected progenitor domains at distinct DV levels. Comparing the
nature and function of bipartite PH and P/M sites in the context of the
Hoxb1, Hoxb2 and Phox2b enhancers may therefore provide
clues of how Phox2b regulation is spatially constrained.
In the Hoxb2 enhancer, only one PH site is present that shows
cooperative binding of Hoxb1 and Pbx/Exd proteins in vitro and is required for
r4 expression in vivo (Maconochie et al.,
1997
). By contrast, the b1-ARE enhancer contains three PH motifs
(R1-R3). Mutational analysis in the mouse indicated that all three PH sites
are cooperatively required for high levels of r4 expression
(Popperl et al., 1995
),
although with distinct individual contributions. Among the three
Hoxb1 PH sites, the R2 sequence precisely matches that of the
Phox2b PH octamer core (Fig.
2C). Like the Phox2b PH site, the R2 repeat did not bind
Hoxb1/Exd heterodimers in vitro, nor Hoxb1 or Exd alone, although it is
necessary for optimal r4 activity (Popperl
et al., 1995
). Thus, the Hoxb1 R2 repeat requires
cooperative interactions with adjacent sequences in the b1-ARE to fully
function in vivo. Similarly, a trimerized Phox2b PH site was not
sufficient on its own to direct r4 restricted expression in the chick
hindbrain (Fig. 6E), unlike the
sufficiency for r4 expression of multimerized Hoxb1 R3 or
Hoxb2 high-affinity PH sites
(Maconochie et al., 1997
;
Popperl et al., 1995
).
Nonetheless, the PH motif was necessary, in the context of the Phox2b
enhancer, for mediating the transcriptional cooperation of Hox, Pbx and
Prep/Meis co-factors and for in vivo regulation in ventral r4 both in chick
and mouse hindbrain (Figs 3,
5). Thus, the Phox2b
low-affinity PH site, while representing a necessary site of integration of r4
activity, operates in vivo mainly through cooperative interactions with its
surrounding regulatory environment, even in the presence of high endogenous
levels of binding factors.
Cooperative interactions of PH sites with nearby sequences are important
for in vivo specificity of Hox-Pbx complexes in both vertebrate and
invertebrate Hox-regulated enhancers
(Jacobs et al., 1999
;
Ferretti et al., 2000
;
Manzanares et al., 2001
;
Di Rocco et al., 2001
;
Mann and Affolter, 1998
). We
show that a distant P/M site makes an essential contribution to the binding
specificity of the PH element, allowing formation of a Hox-Pbx-Prep complex in
vitro, as ternary complexes were not observed on DNA probes containing
mutations of either PH or P/M sites (Fig.
4). Moreover, regulation of the Phox2b enhancer in
ventral r4 requires the integrity of both PH and P/M sites
(Fig. 3), indicating the
formation of transcriptionally active Hox-Pbx-Prep complexes in vivo. Although
this functional behavior is reminiscent of that of the P/M element in the
Hoxb2 r4 enhancer, it differs from that of the Hoxb1 P/M
motif, functionally redundant with the R1-R3 elements
(Jacobs et al., 1999
;
Ferretti et al., 2000
). In
addition, it should be noted that the Hoxb1, Hoxb2 and
Phox2b enhancers differ in the spacing and relative orientations of
their P/M and PH motifs. Although the Hoxb2 and Hoxb1 (R2)
P/M sites are located close to the 5' and 3' ends of their PH
sites, respectively, the mouse Phox2b P/M element is located 147
nucleotides 3' to the PH motif (Fig.
2). Different configurations and spacing might correlate with
distinct spatial and/or levels of activity of Hox-regulated r4 enhancers
(Jacobs et al., 1999
). In this
respect, the organization of PH-P/M modules in the Hoxb1 and
Hoxb2 enhancers vary among vertebrate species that show fine
regulatory differences in r4 and its derivatives
(Popperl et al., 1995
;
Scemama et al., 2002
). The
permissivity of the different PH-P/M spacing could be explained by looping-out
or bending of the intervening DNA (Fig.
6I), to allow formation of a trimeric complex. In the
Phox2b enhancer, the unusual spacing of the P/M site might introduce
further constraint on the ability of the low-affinity PH site to be activated
in vivo, despite high endogenous Hoxb1, Hoxb2 and co-factor levels.
In conclusion, unlike the Hoxb1 or the Hoxb2 r4 enhancers that contain multiple and/or high-affinity PH sites readily activated by threshold levels of endogenous Hox proteins and their co-factors, the low-affinity Phox2b PH motif must integrate additional inputs in order to be fully functional in vivo. It is tempting to speculate that similar low-affinity PH sites are present in the enhancers of Hox target genes, the expression of which is tightly regulated in sharp columns in the hindbrain and the activation of which outside their normal domains would have deleterious consequences for neuronal patterning.
Maintenance of Hox target gene expression in r4 through PH-P/M modules
Our data strongly suggest that the Phox2b PH-P/M module is
involved in the maintenance of high Phox2b expression levels in
ventral r4. First, inactivation of the Phox2b PH site mirrors the
effect of Hoxb1 or Hoxb2 loss-of-function in mice, i.e. the
lack of maintenance of Phox2b expression in the r4 pMNv domain
(Pattyn et al., 2003a
).
Second, other conserved PH-P/M cis-regulatory modules in Hoxb1, Hoxb2,
Hoxa3 and Hoxb4 enhancers are all involved in Hox-dependent
maintenance of rhombomere-restricted expression
(Popperl et al., 1995
;
Jacobs et al., 1999
;
Ferretti et al., 2000
;
Maconochie et al., 1997
;
Manzanares et al., 2001
;
Gould et al., 1997
). Clearly,
other elements must then be required for the initiation of Phox2b
expression in the pMNv domain. In this respect, forced expression of Hox and
Nkx2 factors is sufficient to induce ectopic Phox2b expression and
generates ectopic BM neurons in the chick hindbrain
(Fig. 7), indicating that these
factors could also mediate Phox2b activation through additional
sequences other than the identified PH or P/M sites.
In conclusion, three key r4 targets of Hox paralog 1 and 2 genes, i.e. Phox2b, Hoxb1 and Hoxb2 bear conserved PH-P/M modules, arguing for a cis-regulatory signature that could be shared by a more ample collection of Hox direct targets requiring temporal maintenance in r4.
Integration of AP and DV transcriptional inputs via Nkx2-mediated derepression at the Phox2b PH site
We discussed how formation of a Hox-Pbx-Prep ternary complex results in
transcriptional cooperation and contributes to overcome insufficient
activation at the low-affinity PH site
(Fig. 3A). However, as Hox, Pbx
and Prep factors are present throughout r4
(Ferretti et al., 1999
;
Popperl et al., 1995
;
Schnabel et al., 2001
), this
model cannot solely explain how Phox2b expression is sharply
restricted in ventral r4 to the pMNv progenitor domain. Our results indicate
that cooperation with Nkx2.2 is an additional component of the regulation of
the Phox2b enhancer.
How does Nkx2.2 contribute to the Phox2b enhancer regulation?
First, Nkx2.2 binding to the Phox2b enhancer is not required
(Fig. 6A; data not shown).
Second, transcriptional activation by Hox and co-factors is further enhanced
by the activity of Nkx2.2 as a repressor
(Fig. 6A). Third, an intact PH
site is an essential component of the Hox and Nkx2.2 cooperation on the
Phox2b enhancer (Fig.
6B). Moreover, a trimerized PH site is sufficient to respond to
Nkx2.2 activity in the presence of Hox factors, both in P19 cells and chick
hindbrain (Fig. 6C,F,G). Nkx2.2
activity is mediated in part through association with the Gro/TLE class of
co-repressors, as deletion of the TN interacting domain impairs Nkx2.2
activity on the Phox2b enhancer
(Fig. 6C). One possibility is
that Nkx2.2/Gro could transcriptionally repress, or sequester, a putative
repressor (R) normally bound at, or in the vicinity of, the PH site
(Fig. 6H). In the absence of
Nkx2 proteins, i.e. dorsal to the pMNv domain, R could prevent the formation
of a Hox-Pbx-Prep ternary complex and consequently the activation of high
Phox2b expression levels. Within the pMNv progenitor domain, the
presence of Nkx2.2 would relieve repression by blocking the activity or the
expression of R acting on the Phox2b enhancer
(Fig. 6I). After recruitment of
Hoxb1 or Hoxb2 by Pbx and binding of Prep1 to the P/M site
(Ferretti et al., 2000
;
Jacobs et al., 1999
), a
ternary complex would then form and stimulate high levels of transcription
(Fig. 6I).
Nonetheless, in the chick hindbrain reporter expression driven by the Phox2b enhancer was not restricted in a columnar pattern (Fig. 3C), unlike endogenous Phox2b. Thus, although the PH and P/M sites embedded within the 376 bp enhancer are required for ventral r4 regulation (Figs 3, 5), additional inhibitory inputs from regulatory regions outside the enhancer are also needed to achieve columnar regulation. In this respect, ventral restriction of reporter expression is obtained with the 2.8 kb construct (Fig. 1C). Therefore, the proposed repressor (Fig. 6H), although required, may not be sufficient to restrain the Phox2b enhancer activity outside the pMNv domain, when the enhancer is tested in isolation from its genomic context. Although an important site of integration of AP and DV regulatory inputs, the Phox2b enhancer may require interaction with distant regulatory elements for precise columnar regulation.
In conclusion, our results take a first significant step in understanding how the transcriptional activity of repressors and activators converges on a specific target gene promoter to direct expression in a specific progenitor domain in the mammalian central nervous system.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Radiation Genetics and Chemical Mutagenesis, Leiden
University Medical Centre, 2333 AL Leiden, The Netherlands ![]()
| REFERENCES |
|---|
|
|
|---|
Barolo, S. and Posakony, J. W. (2002). Three
habits of highly effective signaling pathways: principles of transcriptional
control by developmental cell signaling. Genes Dev.
16,1167
-1181.
Barrow, J. R. and Capecchi, M. R. (1996). Targeted disruption of the Hoxb-2 locus in mice interferes with expression of Hoxb-1 and Hoxb-4. Development 122,3817 -3828.[Abstract]
Berthelsen, J., Zappavigna, V., Ferretti, E., Mavilio, F. and Blasi, F. (1998a). The novel homeoprotein Prep1 modulates Pbx-Hox protein cooperativity. EMBO J. 17,1434 -1445.[CrossRef][Medline]
Berthelsen, J., Zappavigna, V., Mavilio, F. and Blasi, F. (1998b). Prep1, a novel functional partner of Pbx proteins. EMBO J. 17,1423 -1433.[CrossRef][Medline]
Bertrand, N., Castro, D. S. and Guillemot, F. (2002). Proneural genes and the specification of neural cell types. Nat. Rev. Neurosci. 3, 517-530.[CrossRef][Medline]
Briscoe, J., Pierani, A., Jessell, T. M. and Ericson, J. (2000). A homeodomain protein code specifies progenitor cell identity and neuronal fate in the ventral neural tube. Cell 101,435 -445.[CrossRef][Medline]
Bruce, L. L., Kingsley, J., Nichols, D. H. and Fritzsch, B. (1997). The development of vestibulocochlear efferents and cochlear afferents in mice. Int. J. Dev. Neurosci. 15,671 -692.[CrossRef][Medline]
Brunet, J. F. and Pattyn, A. (2002). Phox2 genes - from patterning to connectivity. Curr. Opin. Genet. Dev. 12,435 -440.[CrossRef][Medline]
Burglin, T. R. (1997). Analysis of TALE
superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel
domain conserved between plants and animals. Nucleic Acids
Res. 25,4173
-4180.
Capovilla, M., Brandt, M. and Botas, J. (1994). Direct regulation of decapentaplegic by Ultrabithorax and its role in Drosophila midgut morphogenesis. Cell 76,461 -475.[CrossRef][Medline]
Capovilla, M., Kambris, Z. and Botas, J. (2001). Direct regulation of the muscle-identity gene apterous by a Hox protein in the somatic mesoderm. Development 128,1221 -1230.[Abstra