|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 27 July 2004
doi: 10.1242/dev.01286
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Biology, McGill University, 1205 Avenue Docteur Penfield, Montréal, Québec H3A 1B1, Canada
* Author for correspondence (e-mail: paul.lasko{at}mcgill.ca)
Accepted 27 May 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Translation, Germ cells, DEAD-box, Axis-patterning, Gurken, Drosophila, cIF2, Vasa
| Introduction |
|---|
|
|
|---|
signaling molecule
Gurken (Grk) establishes polarity within the oocyte along both the
anteroposterior and dorsoventral axes
(Neuman-Silberberg and Schüpbach,
1993
osk, grk and nos RNAs are all under complex translational
regulation in the developing oocyte, mediated through cis-acting elements in
their untranslated regions (UTRs). Genetic and biochemical analyses in
Drosophila ovaries and embryos have identified several translational
regulatory proteins. Bruno (Bru) is involved in repressing translation of
osk and grk (Kim-Ha et
al., 1995
; Webster et al.,
1997
; Filardo and Ephrussi,
2003
; Nakamura et al.,
2004
), and Smaug (Smg) is involved in repressing translation of
nos (Smibert et al.,
1996
; Dahanukar et al.,
1999
; Nelson et al.,
2004
). Although recent work has linked both Bru and Smg to the
cap-binding step of translation initiation
(Wilhelm et al., 2003
;
Nakamura et al., 2004
;
Nelson et al., 2004
),
translational repression of osk, grk and nos probably
targets multiple steps of translation (Lie
and Macdonald, 1999
; Clark et
al., 2000
; Nakamura et al.,
2004
). In general, details of the mechanisms of translational
derepression and activation for specific transcripts remain obscure. In
several organisms, translational activation of maternal mRNAs involves
cytoplasmic polyadenylation. The activity of the Drosophila
cytoplasmic polyadenylation element-binding protein, called oo18 RNA-binding
protein or Orb (Lantz et al.,
1992
) is implicated in activating translation of osk and
possibly of other mRNAs (Chang et al.,
1999
; Castagnetti and Ephrussi,
2003
).
Our work addresses the function of the highly conserved DEAD-box RNA
helicase Vas, which is required for the progression of oogenesis and for pole
plasm assembly (Schüpbach and
Wieschaus, 1986
; Hay et al.,
1988
; Lasko and Ashburner,
1988
; Liang et al.,
1994
). Based on sequence similarity with yeast Ded1p (reviewed by
Linder, 2003
), and the finding
that expression of several proteins is reduced in vas mutants, Vas
has been suggested to function in translational regulation (reviewed by
Johnstone and Lasko, 2001
).
Females bearing hypomorphic vas mutations complete oogenesis but
produce embryos lacking germ cells and lacking posterior segments, indicating
an essential role for vas in both processes
(Schüpbach and Wieschaus,
1986
). An earlier function for Vas, during oogenesis, was also
demonstrated through the study of null mutations that are viable but produce
no embryos (Styhler et al.,
1998
; Tomancak et al.,
1998
). Although vas-null oocytes display minimal
disruption of grk RNA accumulation, Grk protein levels are severely
reduced, leading to the hypothesis that Vas could play a role in grk
translational control (Styhler et al.,
1998
; Tomancak et al.,
1998
). Vas also appears to represent an important link between
meiotic cell cycle progression and developmental events such as establishment
of polarity. In response to a meiotic checkpoint, activated by a delay in DNA
double-strand break (DSB) repair during oogenesis, Vas is post-translationally
modified, and this corresponds to a downregulation in Grk protein accumulation
(Ghabrial and Schüpbach,
1999
).
In previous work, we identified a translation factor dIF2, now called
eIF5B, as a Vas-binding protein (Carrera et
al., 2000
). A genetic interaction between null alleles of
dIF2 and vas suggested a functional link between these two
proteins. eIF5B/dIF2 has since been demonstrated in mammalian systems to be
required for all cellular translation and to act at the 60S ribosomal subunit
joining step of translation initiation
(Pestova et al., 2000b
).
Subsequent work has indicated that translation can be regulated at the stage
of subunit joining (Ostareck et al.,
2001
; Searfoss et al.,
2001
). These results suggest that Vas could function as a
translational regulator of specific mRNAs through interaction with eIF5B.
To test this hypothesis, we created specific vas mutations that severely reduce its interaction with eIF5B. These mutant forms of Vas still localize correctly, allowing us to investigate which developmental functions of Vas require an interaction with eIF5B, and are therefore likely to involve a translational regulatory role. We found that the Vas-eIF5B interaction was essential for the progression of oogenesis, and for normal expression of Grk. In addition, we found that the interaction between Vas and eIF5B was crucial for germ cell specification, but we observed a much less stringent requirement for this interaction in posterior somatic segmentation. We conclude that interaction with eIF5B is essential for Vas function, and propose that Vas achieves translational regulation in the germline through eIF5B binding. The Vas-eIF5B interaction represents a significant opportunity to investigate how a tissue-specific regulator may control the ribosomal subunit joining step of translation initiation to activate the translation of specific transcripts.
| Materials and methods |
|---|
|
|
|---|
616-618,
5' TTTCTACGCACCTGTGGTGCC and 3' AGTCTGGCCAGATCCCTCCAAG;
616, 5' CCGGACTTTCTACGCACCTGTG and 3' (same as for
616-618);
617, 5' GACTTTCTACGCACCTGTGGTG and 3'
AACAGTCTGGCCAGATCCCTC;
618, 5' (same as for
616-618) and
3' CGGAACAGTCTGGCCAGATCC. Mutagenesis was followed by blunt-end
ligation, and was verified by sequencing. Each vas-coding region was
then digested out of pBluescript using XhoI and NotI, and
subcloned into a XhoI/NotI digested plasmid
P[w+ Pvas-gfp]
(Nakamura et al., 2001
Yeast interaction trap assays
The yeast strain EGY48 was co-transformed with `bait' constructs cloned in
pEG202, `prey' constructs cloned in pJG4-5, and a lacZ reporter
plasmid pSH18-34. ß-Galactosidase activity was monitored using a
plate-based assay as described previously
(Golemis et al., 1997
) and in
liquid culture (Reynolds et al.,
1997
).
Protein expression and western blotting
Preparation of yeast protein extracts was performed according to the Yeast
Protocols Handbook (Clontech). For every transformed strain, a 5 ml overnight
culture in selective media was used to inoculate a 50 ml culture in YPD media,
incubated at 30°C with shaking (220-250 rpm) until
OD600=0.4-0.6. Cells were centrifuged at 1000 g for
5 minutes at 4°C, resuspended in 50 ml cold H2O, centrifuged at
1000 g for 5 minutes at 4°C and frozen in liquid nitrogen.
Pellets were thawed in pre-warmed Cracking Buffer (8 M Urea, 5% SDS, 40 mM
Tris-HCl [pH6.8], 0.1 mM EDTA, 0.4 mg/ml Bromophenol Blue), supplemented with
1 mM PMSF, 1 x protease inhibitor cocktail (Roche Diagnostics) and 10
µl ß-mercaptoethanol/ml buffer. Samples were transferred into
microcentrifuge tubes containing glass beads, and heated at 70°C for 10
minutes. They were then vortexed for 1 minute, and centrifuged at 20,000
g for 5 minutes at 4°C. Supernatants were kept on ice
while pellets were boiled at 100°C for 3-5 minutes, vortexed for 1 minute
and centrifuged at 20,000 g for 5 minutes at 4°C, and then
combined with the first supernatants. Drosophila ovarian proteins
were extracted by homogenization in phosphate-buffered saline (PBS)/1 mM
PMSF/1 x protease inhibitor cocktail (Roche Diagnostics). Samples were
centrifuged at 18,000 g for 15 minutes at 4°C, and
supernatants were combined with SDS loading buffer. For western blotting,
proteins were resolved on SDS-PAGE gels and transferred onto nitrocellulose
membranes, blocked overnight at 4°C in PBS/2% skim milk/0.05% Tween-20
(PBSTM). Membranes were incubated for 1 hour at room temperature with primary
antibodies diluted in PBSTM, washed with PBSTM, then incubated for 1 hour at
room temperature with HRP-conjugated secondary antibodies (Amersham Pharmacia)
diluted 1:5000 in PBSTM. Membranes were washed with PBSTM and proteins were
detected by chemiluminescence (NEN). Rabbit anti-Vas was used at 1:5000. Mouse
anti-actin (ICN Biomedicals) was used at 1:5000. Mouse anti-
-Tubulin
(Sigma) was used at 1:5000. Rabbit anti-4EBP was used at 1:2000.
Immunohistochemistry and in situ hybridization
Immunostaining of ovaries and embryos with rabbit anti-Nos (1:1000), rabbit
anti-Osk (1:500), rabbit anti-Tud (1:250) and rat anti-Vas (1:2000) was
performed as described previously
(Kobayashi et al., 1999
).
Fluorescent antibody staining was detected using goat anti-rabbit
Alexa546nm, anti-rat Alexa633nm and anti-mouse
Alexa568nm secondary antibodies (Molecular Probes). Immunostaining
with mouse anti-Grk (1:10) in ovaries was performed as follows: ovaries were
dissected in PBST (PBS/0.3% Triton) and fixed for 20 minutes in 200 µl of
4% formaldehyde/PBS + 600 µl heptane. Samples were rinsed with PBST, and
blocked for 1 hour in PBS/1.0% Triton/3% BSA. Samples were incubated with
primary antibodies diluted in PBST for 1 hour at room temperature, rinsed and
then washed overnight in PBST. Samples were then incubated with secondary
antibodies for 1 hour at room temperature, washed in PBST, incubated for 20
minutes in 0.5 µg/ml DAPI, washed in PBST and then mounted in 70%
glycerol/PBS. In situ hybridization was performed as described previously
(Kobayashi et al., 1999
),
except that DMSO was omitted during fixation, and PBS/0.1% Tween-20 was used
instead of MAB throughout the protocol.
Fly strains and techniques
yw flies were used for P element-mediated germline transformation.
vas alleles used for subsequent analyses were
vasPD (Schüpbach
and Wieschaus, 1986
) and vasPH165
(Styhler et al., 1998
). To
visualize GFP in ovaries, they were dissected in PBS and fixed in 4%
formaldehyde/PBS/0.2% Tween-20. Samples were washed in PBS and mounted in 70%
glycerol/PBS. For live GFP visualization in embryos, they were collected on a
sieve and washed with H2O, then dechorionated with bleach and
washed again with H2O. Embryos were then mounted in Halocarbon oil
(series 400) and examined immediately. For visualization of dorsal appendages,
eggs were collected on a sieve and washed with H2O, then mounted in
Hoyer's medium and incubated overnight at 60°C.
| Results |
|---|
|
|
|---|
|
616-618), as well as each residue individually (
616,
617
and
618), and tested these in the yeast two-hybrid system against
eIF5B, using a liquid assay for ß-galactosidase activity to quantify the
level of interaction. All of these mutant forms of Vas expressed protein
efficiently and stably in yeast (Fig.
2A). We found that the
616-618 deletion completely
eliminated detectable interaction with eIF5B
(Fig. 2B). The single amino
acid deletions also all showed a reduction in eIF5B-interaction relative to
the full-length Vas protein,
1.7-fold for
616, tenfold for
617 and 20-fold for
618 (Fig.
2B). In order to verify that these mutations in Vas affected
eIF5B-interaction specifically and not interaction between Vas and Osk, which
is crucial for pole plasm assembly
(Breitwieser et al., 1996
616-618 showed a modest (less
than twofold) reduction in Osk interaction. The single amino acid deletions,
however, showed no reduction of this interaction
(Fig. 2C). We conclude that
these individual Vas deletions specifically disrupt interaction with eIF5B
without affecting the interaction between Vas and Osk. Furthermore, the
interaction site of a third known Vas-binding protein, Gustavus (Gus) maps to
a region near the N terminus of Vas
(Styhler et al., 2002
|
616-618,
616
and
618 proteins were always expressed at lower levels than the
wild-type transgenic protein, when each was compared with levels of endogenous
Vas (Fig. 3F,I,O). However, the
617 transgenic protein was expressed at levels comparable with the
wild-type transgenic protein (Fig.
3L).
|
616-618 transgenic protein
(Fig. 3D,E), the GFP signal was
weak because of low protein expression, but even in this case, correct
localization could be detected. From these data, we conclude that eIF5B
interaction is not required to achieve Vas localization.
To avoid complications resulting from dose effects, we chose to focus the
remainder of our analysis on the vas
617 mutation
because of its high level of protein expression and the strong effect of this
mutation on eIF5B interaction. Comparing the wild-type
vas+ and the vas
617 transgenes
allowed us to determine the phenotypic consequences of specifically reducing
eIF5B interaction, and to separate the functions of Vas that require that
interaction from those that depend solely on its localization and
expression.
Vas-eIF5B interaction is required for female fertility and for grk regulation
In order to investigate the requirement of the Vas-eIF5B interaction during
oogenesis, we examined the vas
617 transgene in the
background of a vas null allele, vasPH165
(Styhler et al., 1998
). The
wild-type vas+ transgene, and the
vas
617 transgene express comparable levels of
protein in the vas null background
(Fig. 4A). Most
vasPH165 egg chambers arrest early in oogenesis, producing
few mature eggs, none of which hatches into embryos
(Styhler et al., 1998
)
(Fig. 4B). Strikingly,
vasPH165;P{vas
617} females
exhibit a very similar arrest in oogenesis to that of
vasPH165 itself, producing few mature eggs that do not
hatch (Fig. 4D). In both
vasPH165 and
vasPH165;P{vas
617} females of
the same age (3-4 days), the number of stage 14 eggs per ovary ranges widely
from 0-32 with an average of nine, roughly a third the average of wild-type.
Examples of severely atrophied vasPH165 and
vasPH165;P{vas
617} ovaries are
shown in Fig. 4B,D. Similar to
vasPH165 (Styhler et
al., 1998
), eggs produced by
vasPH165;P{vas
617} females
sometimes exhibit a duplicated micropyle at both the anterior and posterior
ends (data not shown). By contrast, ovaries from
vasPH165;P{vas+} females produce
abundant mature eggs that can hatch into viable embryos
(Fig. 4C). Thus, the
vas
617 transgene does not rescue the oogenesis
arrest caused by the vasPH165 mutation, indicating that
interaction between Vas and eIF5B is crucial for the progression of
oogenesis.
|
617} females, 67%
of eggs exhibited one semi-fused or fused dorsal appendage
(Fig. 5C-E), 11% formed no
dorsal appendages (Fig. 5F) and
22% had two dorsal appendages (Fig.
5B). Conversely, 82% of control
vasPH165;P{vas+} eggs had two dorsal
appendages (Fig. 5A). Thus, the
vas
617 transgene does not rescue the ventralization
phenotype of the vasPH165 mutation.
|
617} ovaries, and
found that it also was indistinguishable in early stages of development from
that observed for vasPH165
(Fig. 5H,I,K,L) (Styhler et al., 1998
617 transgene does not support efficient
expression of Grk in a vas-null background. We conclude that the
requirements for Vas for the progression of oogenesis, for dorsoventral
patterning of the egg chamber, and for grk regulation, all rely on
its interaction with eIF5B.
Pole plasm components assemble in vasPD;P{vas
617} ovaries
Pole plasm assembly requires the sequential posterior localization of
multiple proteins and RNAs (reviewed by
Mahowald, 2001
). Osk, which is
at the top of a complex hierarchy of factors involved in pole plasm assembly,
is required for recruitment of Vas to the posterior
(Lasko and Ashburner, 1990
).
Downstream of Vas localization, Tud protein is recruited
(Bardsley et al., 1993
), and
Osk, Vas and Tud are required for pole cell formation and posterior
segmentation. In order to investigate the requirement for the Vas-eIF5B
interaction in pole plasm assembly, we examined the
vas
617 transgene in the background of a hypomorphic
vas allele, vasPD, as
vasPH165; P{vas
617} ovaries
produce few late-stage egg chambers. The vasPD allele, in
which Vas is detectable only in the germarial stages of oogenesis
(Lasko and Ashburner, 1990
),
completes oogenesis normally, but the embryos produced lack pole cells and
posterior segmentation. Sequencing of the vasPD allele did
not reveal any alteration in the coding sequence
(Liang et al., 1994
), thus
this mutation is believed to affect only the level of vas expression
and not the nature of Vas protein.
In wild-type stage 10 egg chambers, strong posterior accumulation of Osk,
Vas and Tud protein is evident (Fig.
6B,F,J), while in vasPD ovaries, which have
severely reduced levels of Vas protein
(Fig. 6A), posterior Osk is
abundant, but neither Vas nor Tud is detected at the posterior
(Fig. 6C,G,K). We next compared
the accumulation of these three proteins in vasPD;
P{vas+} and vasPD;
P{vas
617} ovaries, which contain comparable levels
of Vas protein as assayed by western blotting
(Fig. 6A). We found that Osk,
Vas and Tud protein can all be readily detected at the posterior of stage 10
oocytes (Fig. 6D-E,H-I,L-M), at
apparently equivalent levels for both transgenic genotypes. Thus,
GFP-Vas
617 not only localizes correctly to the posterior, but it is
also able to recruit the downstream pole plasm component Tud. We conclude that
interaction with eIF5B is not required for the role of Vas in the initial
assembly of the pole plasm.
|
617 transgene in the
vasPD background allowed us to address this question, as
Vas protein is expressed abundantly from this transgene, localizes correctly
and is able to recruit Tud, an essential factor for germ cell specification
(Ephrussi and Lehmann, 1992
617
transgene in the vasPD background. For simplicity,
transgenic embryos will be referred to by the genotype of the mother. Using
detection of GFP-Vas as a marker in live embryos at the cellular blastoderm
stage, we found that the majority of
vasPD;P{vas+} embryos had formed pole
cells at this stage, indicating that the wild-type transgene rescues this
vas phenotype (Fig.
7A). By contrast, only one
vasPD;P{vas
617} embryo out of
216 examined exhibited pole cells at the same stage, indicating that
expression of the vas
617 transgene could not rescue
this vas phenotype (Fig.
7B). We verified this result using Nos as an independent marker
for pole cells. Although 58% of
vasPD;P{vas+ }embryos exhibited
Nos-positive cells at the posterior of the embryo at the cellular blastoderm
stage (Fig. 7C), 81% of
vasPD;P{vas
617} embryos
examined did not have any Nos-positive cells
(Fig. 7D). Five percent of
these embryos formed one to three Nos-positive cells at the posterior
(Fig. 7E), while in 14% of
embryos, Nos-positive cells were visible, but at inappropriate positions
(Fig. 7F). These results
demonstrate that, downstream of initial pole plasm assembly, the Vas-eIF5B
interaction is vital for embryonic germ cell formation.
|
617} embryos have a
wild-type segmentation pattern, as inferred from a wild-type ftz
distribution (Fig. 8A). In
fact, when allowed to complete development, many
vasPD;P{vas
617} embryos hatched
into viable larvae. A further 20% of the
vasPD;P{vas
617} embryos
exhibited a weak posterior group phenotype in which stripes 4-6 of
ftz were present but were reduced in width and intensity relative to
the other stripes (Fig. 8B),
although the remaining 30% exhibited a stronger phenotype
(Fig. 8C), more closely
resembling that of vasPD
(Schüpbach and Wieschaus,
1986
617
transgene can partially rescue the abdominal segmentation defect of the
vasPD allele, suggesting that the Vas-eIF5B interaction is
less crucial for posterior patterning than it is for pole cell specification.
nos translation is tightly regulated such that it is repressed
outside of the pole plasm and active in the pole plasm
(Gavis and Lehmann, 1994
617} embryos
directly. Consistent with the ftz expression data, 55% of
vasPD;P{vas
617} embryos
exhibited a detectable Nos gradient (Fig.
8E,F). In control
vasPD;P{vas+} embryos, a Nos protein
gradient could be observed in 95% of the embryos
(Fig. 8D). Thus, the
vas
617 transgene partially rescues the Nos
accumulation defect of the vasPD allele, suggesting that
either the Vas-eIF5B interaction is dispensable for Nos translation, or that
the low level of interaction between Vas
617 and eIF5B is sufficient to
activate Nos.
|
| Discussion |
|---|
|
|
|---|
617, which has greatly
reduced ability to interact with eIF5B. As residue 617 is not involved in
binding to any known Vas-interacting protein other than eIF5B, and it is
outside the region of Vas that contains the well-characterized catalytic
domains that are present in all DEAD-box proteins, we are confident that
Vas
617 specifically disrupts the Vas-eIF5B interaction, and that this
mutation can be used to identify developmental processes that are sensitive to
an association between Vas and the general translational machinery. We found
that the VaseIF5B interaction is crucial for the progression of oogenesis, for
correct dorsoventral patterning of the egg, and for expression of high levels
of Grk in the developing oocyte. These results are most easily explained if
grk is a target for Vas-mediated translational activation acting
through its association with eIF5B.
A role for Vas in positively regulating grk translation is
consistent with previous work (Styhler et
al., 1998
; Tomancak et al.,
1998
; Ghabrial and
Schüpbach, 1999
). Vas-mediated regulation of grk is
in turn regulated in response to a meiotic checkpoint, activated when DNA
double-strand break (DSB) repair is prevented during meiotic recombination
(Ghabrial et al., 1998
;
Ghabrial and Schüpbach,
1999
). In response to this checkpoint, Vas is post-translationally
modified, and Grk accumulation is reduced. It will be important to understand
the nature of the DSB-dependent modification of Vas, and to determine whether
it affects the Vas-eIF5B interaction, in order to gain insight into the
mechanism connecting cell cycle regulation with oocyte patterning.
The RNA-binding and unwinding activities of wild-type Vas and several
mutant forms of Vas have previously been assessed through in vitro assays
(Liang et al., 1994
). Two
mutant forms of Vas, encoded by the vasO14 and
vasO11 alleles, were found to be severely reduced for
binding to an artificial RNA substrate, and a third form, encoded by
vasD5, was defective for RNA unwinding but not for
binding. Although vasD5 leads to defects in oogenesis,
vasO11 phenotypically resembles vasPD,
and vasO14 is a weak temperature-sensitive allele
(Lasko and Ashburner, 1990
).
In the light of our present results, it is surprising that a mutant form of
Vas that cannot interact with RNA would nevertheless support oogenesis.
Perhaps in vivo, the RNA-binding and helicase activities of Vas are stimulated
or enhanced through a co-factor or through posttranslational modifications,
and the in vitro assay used in our earlier study may not accurately reflect
Vas activity in vivo.
Are there target RNAs for Vas-eIF5B regulation in the pole plasm?
Reduction of the Vas-eIF5B interaction by expressing Vas
617 severely
reduces pole cell formation. This happens despite the ability of
vasPD;P{vas
617} oocytes to
accumulate Osk, Vas and Tud at the posterior pole, demonstrating an essential
role for Vas in pole cell specification that is dependent upon its association
with eIF5B, and that cannot be substituted by Osk and Tud. The simplest
interpretation of these results is that Vas derepresses translation of a
localized RNA required for pole cell specification, in a manner analogous to
what appears to be the case for grk.
We considered the possibility that the Vas-eIF5B interaction could target
osk mRNA. It has previously been shown that whereas Osk protein
accumulates normally in vas mutant ovaries, Osk levels are severely
reduced at the posterior of vas mutant embryos
(Harris and Macdonald, 2001
),
suggesting a role for Vas in posterior accumulation of Osk after its initial
recruitment, and/or in stabilizing Osk at the posterior. We observed
comparable and substantial levels of Osk at the posterior in
vasPD;P{vas
617} and
vasPD;P{vas+} embryos (data not
shown), arguing against a direct role for the VaseIF5B interaction in
activating translation of osk mRNA. A requirement for Vas in
Par1-mediated phosphorylation and stabilization of Osk has been suggested
(Breitwieser et al., 1996
;
Markussen et al., 1997
;
Riechmann et al., 2002
). As
Vas
617 localizes normally and is able to interact with Osk, we would
not expect this mutation to have any effect on this Osk modification pathway.
Thus, our findings are consistent with a model whereby Vas influences Osk
activity through effects on phosphorylation, anchoring and/or stability,
perhaps through Par1, rather than directly regulating osk
translation.
Another candidate target for the Vas-eIF5B interaction is germ
cell-less (gcl), the activity of which is important for pole
cell specification but not for posterior patterning
(Jongens et al., 1992
).
Unfortunately, with current reagents, and with new antisera we have generated,
we cannot reliably detect Gcl protein even in wild-type embryos prior to pole
bud formation, thus we cannot presently address the effects on gcl
translation of any mutation that abrogates pole cell formation. In addition,
effects on gcl cannot fully explain the severe consequences of the
Vas
617 mutation on pole cell formation, because the number of pole
cells formed in maternal gcl-null embryos is somewhat higher than in
vasPD;P{vas
617} embryos
(Robertson et al., 1999
). This
suggests that even if gcl is a target, the Vas-eIF5B interaction may
regulate translation of more than one target RNA involved in pole cell
formation.
Is the Vas-eIF5B interaction required for posterior patterning?
Although the Vas-eIF5B interaction is vital for pole cell specification, it
is perhaps less so for posterior patterning and establishment of the Nos
gradient. Previous analysis of hypomorphic mutations in posterior-group genes,
including vas has indicated that a higher level of activity is
required for pole cell specification than for posterior patterning. For
example, all embryos produced by females homozygous for
vasO14 (Lasko and
Ashburner, 1990
), osk301
(Lehmann and Nüsslein-Volhard,
1986
) and tudWC
(Schüpbach and Wieschaus,
1986
), lack pole cells, but some have normal posterior patterning
and are able to hatch. Our present results suggest two alternative
explanations for these observations. One possibility is that the Vas-eIF5B
interaction is required for posterior patterning, but that the residual
activity present in Vas
617 is sufficient to achieve the low activity
level that is necessary. Alternatively, the Vas-eIF5B interaction may be
dispensable for posterior patterning, and the fact that we do not observe
complete rescue of this phenotype with the vas
617
transgene may be due to an indirect effect of this mutation, resulting from a
general destabilization of the pole plasm that occurs in embryos that do not
form pole cells (Iida and Kobayashi,
2000
). In such embryos, pole plasm components localize initially
but become fully delocalized by the blastoderm stage
(Lasko and Ashburner, 1990
).
Consistent with this idea, all of the pole plasm components examined that are
downstream of Vas, including nos RNA, could be detected at the
posterior of vasPD;P{vas
617}
embryos, although to variable degrees (data not shown).
Previous work has suggested that nos may be a target for
Vas-mediated translational regulation
(Gavis et al., 1996
). Outside
of the pole plasm, nos translation is repressed through the binding
of Smg, and possibly other repressors, to its 3' UTR
(Smibert et al., 1996
;
Dahanukar et al., 1999
;
Crucs et al., 2000
;
Nelson et al., 2004
). Smg
achieves this regulation at least in part through interaction with the
eIF4E-binding protein Cup, thus influencing the cap-binding stage of
translation (Nelson et al.,
2004
). Within the pole plasm, in complexes with Osk and Vas,
nos translational repression is overcome, potentially through a
direct interaction between Osk and Smg
(Dahanukar et al., 1999
), which
may displace Smg-Cup interaction (Nelson
et al., 2004
). Our analysis of Vas
617 does not support an
important role for the VaseIF5B interaction in activating nos
translation in the pole plasm, as clearly translation of nos is far
less sensitive to the level of this interaction than is translation of
grk in early oocytes. The primary function of Vas in nos
accumulation may therefore be in anchoring nos mRNA in complexes
within the pole plasm, consistent with recent observations that nos
mRNA is trapped at the posterior by complexes containing Vas
(Forrest and Gavis, 2003
). It
of course remains possible that the low level of residual eIF5B binding
provided by Vas
617 is sufficient to fulfill a role of Vas in activating
translation of this transcript.
How might Vas-eIF5B interaction regulate translation of grk and potentially other target mRNAs?
Cap-dependent translation initiation in eukaryotes requires many
translation initiation factors, and involves several main steps (reviewed by
Pestova et al., 2001
). Most
known mechanisms of translational regulation impinge on the recruitment of the
cap-binding complex eIF4F to the mRNA, which represents the rate-limiting
first step of initiation. mRNA circularization through proteins such as Cup
serves an important role in translational control by allowing 3'
UTR-bound regulatory factors to influence translation initiation at the
5' end of the transcript. (Nakamura
et al., 2004
; Nelson et al.,
2004
; Wilhelm et al.,
2003
).
60S ribosomal subunit joining represents the interface between translation
initiation and elongation, and the VaseIF5B interaction suggests a distinct
mechanism of translational control occurring at this last stage of initiation.
Although this step has not historically been considered a target for
regulation, several examples have emerged to suggest that subunit joining may
in fact be subject to regulation. Translational repression of mammalian
15-lipoxygenase (LOX) mRNA is mediated by hnRNP proteins that bind to a
specific 3' UTR regulatory element, and which are thought to act by
blocking the activity of either eIF5 or eIF5B
(Ostareck et al., 2001
). An
additional link between mRNA 3' regulatory regions, and eIF5B activity,
comes from analysis of two DEAD-box proteins in yeast, Ski2p and Slh1p
(Searfoss et al., 2001
). These
proteins are required to achieve the selective translation of
poly(A)+ mRNAs, relative to poly(A)- mRNAs, and genetic
experiments suggest that they specifically repress the translation of
poly(A)- mRNAs by acting through eIF5 and eIF5B.
Together with these studies, our work suggests that in the
Drosophila germline, specific translational repression events may
target eIF5B and the ribosomal subunit joining step of initiation. Vas, which
potentially functions at the 3' UTR through interaction with specific
repressor proteins, may act to alleviate a translation block occurring at this
step. Such a model is consistent with what is known about translational
regulation of grk. For example, grk translation is repressed
by Bru, which binds to a Bruno-response element within its 3' UTR
(Filardo and Ephrussi, 2003
).
Vas interacts with Bru (Webster et al.,
1997
), suggesting that Vas could function as a derepressor by
overcoming Bru-mediated repression of grk translation. However, the
inability of a vas transgene to ameliorate the phenotype of
nosGAL4VP16-driven overexpression of Bru, might argue against this
model (Filardo and Ephrussi,
2003
). The mechanism by which Bru regulates grk remains
unclear. Translational repression of osk by Bru relies on direct
interaction with Cup, linking Bru with eIF4E
(Nakamura et al., 2004
).
However, mutations in cup that prevent interaction with Bru do not
appear to affect Grk expression, suggesting that Bru may operate through a
distinct mechanism to regulate grk translation
(Nakamura et al., 2004
). In
addition, in vitro translation assays have suggested that Bru can mediate
translational repression through a cap-independent mechanism
(Lie and Macdonald, 1999
).
Thus, Bru may be capable of regulating translation at more than one stage.
Based on the observations for the mammalian hnRNP proteins on the LOX mRNA,
and the Ski2p and Slh1p helicases in yeast, specific translational repressors
such as Bru could target the subunit joining step of initiation.
eIF5B is thought to form a molecular bridge between the two ribosomal
subunits, and to play a fundamental role in stabilizing the initiator
Met-tRNAiMet in the ribosomal P site (reviewed by
Pestova et al., 2000a
).
Inhibition of eIF5B activity could occur while the factor is bound to the
initiation complex, at the start codon, and block its ability to link or
stabilize the ribosomal subunits. Through circularization of the mRNA, this
block could be achieved by trans-acting factors at the 3' UTR, and the
Vas-eIF5B interaction may be involved in alleviating these specific repression
events, potentially through displacement of a repressor protein.
Alternatively, Vas could play a role in recruitment of eIF5B to specific
transcripts. As eIF5B is required for all cellular translation, a general
mechanism must exist to recruit this factor to all transcripts. However, in a
scenario where repressor proteins may be blocking the subunit joining step,
either through a direct effect on eIF5B, or another mechanism, it is
conceivable that eIF5B could become limiting for translation. In this
situation, Vas could play a role in recruiting this factor to specific
transcripts.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bardsley, A., McDonald, K. and Boswell, R. E.
(1993). Distribution of tudor protein in the Drosophila
embryo suggests separation of functions based on site of localization.
Development 119,207
-219.[Abstract]
Breitwieser, W., Markussen, F.-H., Horstmann, H. and Ephrussi,
A. (1996). Oskar protein interaction with Vasa represents an
essential step in polar granule assembly. Genes Dev.
10,2179
-2188.
Carrera, P., Johnstone, O., Nakamura, A., Casanova, J.,
Jäckle, H. and Lasko, P. (2000). VASA mediates
translation through interaction with a Drosophila yIF2 homolog.
Mol. Cell 5,181
-187.[CrossRef][Medline]
Castagnetti, S. and Ephrussi, A. (2003). Orb
and a long poly(A) tail are required for efficient oskar translation
at the posterior pole of the Drosophila oocyte.
Development 130,835
-843.
Chang, J. S., Tan, L. and Schedl, P. (1999).
The Drosophila CPEB homolog, orb, is required for oskar protein
expression in oocytes. Dev. Biol.
215,91
-106.[CrossRef][Medline]
Clark, I. E., Wyckoff, D. and Gavis, E. R.
(2000). Synthesis of the posterior determinant Nanos is spatially
restricted by a novel cotranslational regulatory mechanism. Curr.
Biol. 10,1311
-1314.[CrossRef][Medline]
Crucs, S., Chatterjee, S. and Gavis, E. R.
(2000). Overlapping but distinct RNA elements control repression
and activation of nanos translation. Mol.
Cell 5,457
-467.[CrossRef][Medline]
Dahanukar, A., Walker, J. A. and Wharton, R. P.
(1999). Smaug, a novel RNA-binding protein that operates a
translational switch in Drosophila. Mol. Cell
4, 209-218.[CrossRef][Medline]
Ephrussi, A. and Lehmann, R. (1992). Induction
of germ cell formation by oskar. Nature
358,387
-392.[CrossRef][Medline]
Ephrussi, A., Dickinson, L. K. and Lehmann, R.
(1991). Oskar organizes the germ plasm and directs localization
of the posterior determinant nanos. Cell
66, 37-50.[CrossRef][Medline]
Filardo, P. and Ephrussi, A. (2003). Bruno
regulates gurken during Drosophila oogenesis.
Mech. Dev. 120,289
-297.[CrossRef][Medline]
Forrest, K. M. and Gavis, E. R. (2003). Live
imaging of endogenous RNA reveals a diffusion and entrapment mechanism for
nanos mRNA localization in Drosophila. Curr.
Biol. 13,1159
-1168.[CrossRef][Medline]
Gavis, E. R. and Lehmann, R. (1994).
Translational regulation of nanos by RNA localization.
Nature 369,315
-318.[CrossRef][Medline]
Gavis, E. R., Lunsford, L., Bergsten, S. E. and Lehmann, R.
(1996). A conserved 90 nucleotide element mediates translational
repression of nanos RNA. Development
122,2791
-2800.[Abstract]
Ghabrial, A. and Schüpbach, T. (1999).
Activation of a meiotic checkpoint regulates translation of Gurken during
Drosophila oogenesis. Nat. Cell Biol.
1, 354-357.[CrossRef][Medline]
Ghabrial, A., Ray, R. P. and Schüpbach, T.
(1998). okra and spindle-B encode components of
the RAD52 DNA repair pathway and affect meiosis and patterning in
Drosophila oogenesis. Genes Dev.
12,2711
-2723.
Golemis, E. A., Serebriiskii, I., Gyuris, J. and Brent, R.
(1997). Interaction trap/two-hybrid system to identify
interacting proteins. In Current Protocols in Molecular
Biology (ed. F. M. Ausubel, R. Brent, R. E. Kingston, D. D.
Moore, J. G. Seidman, J. A. Smith and K. Struhl), unit 20.1, pp.1
-35. New York, NY: Wiley.
González-Reyes, A., Elliott, H. and St Johnston, D.
(1995). Polarization of both major body axes in
Drosophila by gurken-torpedo signalling.
Nature 375,654
-658.[CrossRef][Medline]
Hafen, E., Kuroiwa, A. and Gehring, W. J.
(1984). Spatial distribution of transcripts from the segmentation
gene fushi tarazu during Drosophila embryonic development.
Cell 37,833
-841.[CrossRef][Medline]
Harris, A. N. and Macdonald, P. M. (2001).
aubergine encodes a Drosophila polar granule component
required for pole cell formation and related to eIF2C.
Development 128,2823
-2832.
Hay, B., Jan, L. Y. and Jan, Y. N. (1988). A
protein component of Drosophila polar granules is encoded by
vasa and has extensive sequence similarity to ATP-dependent
helicases. Cell 55,577
-587.[CrossRef][Medline]
Iida, T. and Kobayashi, S. (2000).
Delocalization of polar plasm components caused by grandchildless mutations,
gs(1)N26 and gs(1)N441, in Drosophila melanogaster.
Dev. Growth Differ. 42,53
-60.[CrossRef][Medline]
Johnstone, O. and Lasko, P. (2001).
Translational regulation and RNA localization in Drosophila oocytes
and embryos. Annu. Rev. Genet.
35,365
-406.[CrossRef][Medline]
Jongens, T. A., Hay, B., Jan, L. Y. and Jan, Y. N.
(1992). The germ cell-less gene product: a posteriorly
localized component necessary for germ cell development in
Drosophila. Cell
70,569
-584.[CrossRef][Medline]
Kim-Ha, J., Smith, J. L. and Macdonald, P. M.
(1991). oskar mRNA is localized to the posterior pole of
the Drosophila oocyte. Cell
66, 23-35.[CrossRef][Medline]
Kim-Ha, J., Kerr, K. and Macdonald, P. M.
(1995). Translational regulation of oskar mRNA by bruno,
an ovarian RNA-binding protein, is essential. Cell
81,403
-412.[CrossRef][Medline]
Kobayashi, S., Amikura, R., Nakamura, A. and Lasko, P. F.
(1999). Techniques for analyzing protein and RNA distribution in
Drosophila ovaries and embryos at structural and ultrastructural
resolution. In Advances in Molecular Biology: A Comparative Methods
Approach to the Study of Oocytes and Embryos (ed. J. Richter),
pp. 426-445. New York, NY: Oxford University
Press.
Lantz, V., Ambrosio, L. and Schedl, P. (1992).
The Drosophila orb gene is predicted to encode sex-specific germline
RNA-binding proteins and has localized transcripts in ovaries and early
embryos. Development
115, 75-88.[Abstract]
Lasko, P. F. and Ashburner, M. (1988). The
product of the Drosophila gene vasa is very similar to
eukaryotic initiation factor-4A. Nature
335,611
-617.[CrossRef][Medline]
Lasko, P. F. and Ashburner, M. (1990).
Posterior localization of vasa protein correlates with, but is not sufficient
for, pole cell development. Genes Dev.
4, 905-921.
Lehmann, R. and Nüsslein-Volhard, C.
(1986). Abdominal segmentation, pole cell formation, and
embryonic polarity require the localized activity of oskar, a
maternal gene in Drosophila. Cell
47,141
-152.[CrossRef][Medline]
Lehmann, R. and Nüsslein-Volhard, C.
(1991). The maternal gene nanos has a central role in
posterior pattern formation of the Drosophila embryo.
Development 112,679
-691.[Abstract]
Liang, L., Diehl-Jones, W. and Lasko, P.
(1994). Localization of vasa protein to the Drosophila
pole plasm is independent of its RNA-binding and helicase activities.
Development 120,1201
-1211.[Abstract]
Lie, Y. S. and Macdonald, P. M. (1999).
Translational regulation of oskar mRNA occurs independent of the cap
and poly(A) tail in Drosophila ovarian extracts.
Development 126,4989
-4996.[Abstract]
Linder, P. (2003). Yeast RNA helicases of the
DEAD-box family involved in translation initiation. Biol.
Cell 95,157
-167.[CrossRef][Medline]
Linder, P., Lasko, P. F., Ashburner, M., Leroy, P., Nielsen, P.
J., Nishi, K., Schnier, J. and Slonimski, P. P. (1989). Birth
of the D-E-A-D box. Nature
337,121
-122.[CrossRef][Medline]
Mahowald, A. P. (2001). Assembly of the
Drosophila germ plasm. Int. Rev. Cytol.
203,187
-213.[Medline]
Markussen, F.-H., Breitwieser, W. and Ephrussi, A.
(1997). Efficient translation and phosphorylation of Oskar
require Oskar protein and the RNA helicase Vasa. Cold Spring Harb.
Symp. Quant. Biol. 62,13
-17.
Nakamura, A., Amikura, R., Hanyu, K. and Kobayashi, S.
(2001). Me31B silences translation of oocyte-localizing RNAs
through the formation of cytoplasmic RNP complex during Drosophila
oogenesis. Development
128,3233
-3242.
Nakamura, A., Sato, K. and Hanyu-Nakamura, K.
(2004). Drosophila Cup is an eIF4E binding protein that
associates with Bruno and regulates oskar mRNA translation in
oogenesis. Dev. Cell 6,69
-78.[CrossRef][Medline]
Nelson, M. R., Leidal, A. M. and Smibert, C. A.
(2004). Drosophila Cup is an eIF4E-binding protein that
functions in Smaug-mediated translational repression. EMBO
J. 23,150
-159.[CrossRef][Medline]
Neuman-Silberberg, F. S. and Schüpbach, T.
(1993). The Drosophila dorsoventral patterning gene
gurken produces a dorsally localized RNA and encodes a TGF alpha-like
protein. Cell 75,165
-174.[CrossRef][Medline]
Nilson, L. A. and Schüpbach, T. (1999).
EGF receptor signaling in Drosophila oogenesis. Curr. Top.
Dev. Biol. 44,203
-243.[Medline]
Ostareck, D. H., Ostareck-Lederer, A., Shatsky, I. N. and
Hentze, M. W. (2001). Lipoxygenase mRNA silencing in
erythroid differentiation: the 3'UTR regulatory complex controls 60S
ribosomal subunit joining. Cell
104,281
-290.[CrossRef][Medline]
Pause, A. and Sonenberg, N. (1992). Mutational
analysis of a DEAD box RNA helicase: the mammalian translation initiation
factor eIF-4A. EMBO J.
11,2643
-2654.[Medline]
Pestova, T. V., Dever, T. E. and Hellen, C. U. T.
(2000a). Ribosomal subunit joining. In Translational
Control of Gene Expression (ed. N. Sonenberg, J. W. B. Hershey
and M. B. Mathews), pp. 425-445. Cold Spring Harbor,
NY: Cold Spring Harbor Laboratory Press.
Pestova, T. V., Lomakin, I. B., Lee, J. H., Choi, S. K., Dever,
T. E. and Hellen, C. U. T. (2000b). The joining of ribosomal
subunits in eukaryotes requires eIF5B. Nature
403,332
-335.[CrossRef][Medline]
Pestova, T. V., Kolupaeva, V. G., Lomakin, I. B., Pilipenko, E.
V., Shatsky, I. N., Agol, V. I. and Hellen, C. U. T. (2001).
Molecular mechanisms of translation initiation in eukaryotes. Proc.
Natl. Acad. Sci. USA 98,7029
-7036.
Reynolds, A., Lundblad, V., Dorris, D. and Keaveney, M.
(1997). Yeast vectors and assays for expression of cloned genes.
In Current Protocols in Molecular Biology (ed. F. M.
Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith and
K. Struhl), unit 13.6, pp. 1-6. New York, NY:
Wiley.
Riechmann, V., Gutierrez, G. J., Filardo, P., Nebreda, A. R. and
Ephrussi, A. (2002). Par-1 regulates stability of the
posterior determinant Oskar by phosphorylation. Nat. Cell
Biol. 4,337
-342.[Medline]
Robertson, S. E., Dockendorff, T. C., Leatherman, J. L.,
Faulkner, D. L. and Jongens, T. A. (1999). germ
cell-less is required only during the establishment of the germ cell
lineage of Drosophila and has activities which are dependent and
independent of its localization to the nuclear envelope. Dev.
Biol. 215,288
-297.[CrossRef][Medline]
Roth, S., Neuman-Silberberg, F. S., Barcelo, G. and
Schüpbach, T. (1995). cornichon and the EGF receptor
signaling process are necessary for both anterior-posterior and dorsal-ventral
pattern formation in Drosophila. Cell
81,967
-978.[CrossRef][Medline]
Schüpbach, T. and Wieschaus, E. (1986).
Maternal-effect mutations altering the anterior-posterior pattern of the
Drosophila embryo. Roux's Arch. Dev. Biol.
195,302
-317.[CrossRef]
Searfoss, A., Dever, T. E. and Wickner, R.
(2001). Linking the 3' poly(A) tail to the subunit joining
step of translation initiation: relations of Pab1p, eukaryotic translation
initiation factor 5B (Fun12p), and Ski2p-Slh1p. Mol. Cell.
Biol. 21,4900
-4908.
Smibert, C. A., Wilson, J. E., Kerr, K. and Macdonald, P. M.
(1996). smaug protein represses translation of unlocalized
nanos mRNA in the Drosophila embryo. Genes
Dev. 10,2600
-2609.
Styhler, S., Nakamura, A., Swan, A., Suter, B. and Lasko, P.
(1998). vasa is required for GURKEN accumulation in the
oocyte, and is involved in oocyte differentiation and germline cyst
development. Development
125,1569
-1578.[Abstract]
Styhler, S., Nakamura, A. and Lasko, P. (2002).
VASA localization requires the SPRY-domain and SOCS-box containing protein,
GUSTAVUS. Dev. Cell 3,865
-876.[CrossRef][Medline]
Tanner, N. K. and Linder, P. (2001). DExD/H box
RNA helicases: from generic motors to specific dissociation functions.
Mol. Cell 8,251
-262.[CrossRef][Medline]
Tanner, N. K., Cordin, O., Banroques, J., Doère, M. and
Linder, P. (2003). The Q motif: a newly identified motif in
DEAD box helicases may regulate ATP binding and hydrolysis. Mol.
Cell 11,127
-138.[CrossRef][Medline]
Tinker, R., Silver, D. and Montell, D. J.
(1998). Requirement for the Vasa RNA helicase in gurken
mRNA localization. Dev. Biol.
199, 1-10.[CrossRef][Medline]
Tomancak, P., Guichet, A., Zavorszky, P. and Ephrussi, A.
(1998). Oocyte polarity depends on regulation of gurken
by Vasa. Development
125,1723
-1732.[Abstract]
Wang, C. and Lehmann, R. (1991). Nanos is the
localized posterior determinant in Drosophila.
Cell 66,637
-647.[CrossRef][Medline]
Wang, C., Dickinson, L. K. and Lehmann, R.
(1994). Genetics of nanos localization in
Drosophila. Dev. Dyn.
199,103
-115.[Medline]
Webster, P. J., Liang, L., Berg, C. A., Lasko, P. and Macdonald,
P. M. (1997). Translational repressor bruno plays multiple
roles in development and is widely conserved. Genes
Dev. 11,2510
-2521.
Wilhelm, J. E., Hilton, M., Amos, Q. and Henzel, W. J.
(2003). Cup is an eIF4E binding protein required for both the
translational repression of oskar and the recruitment of Barentsz.
J. Cell Biol. 163,1197
-1204.
Related articles in Development:
This article has been cited by other articles:
![]() |
Y. Deng, R. H. Singer, and W. Gu Translation of ASH1 mRNA is repressed by Puf6p-Fun12p/eIF5B interaction and released by CK2 phosphorylation Genes & Dev., April 15, 2008; 22(8): 1037 - 1050. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Song, L. Fee, T. H. Lee, and R. P. Wharton The Molecular Chaperone Hsp90 Is Required for mRNA Localization in Drosophila melanogaster Embryos Genetics, August 1, 2007; 176(4): 2213 - 2222. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Anderson and A. M. L. Lever Human immunodeficiency virus type 1 gag polyprotein modulates its own translation. J. Virol., November 1, 2006; 80(21): 10478 - 10486. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Linder Dead-box proteins: a family affair--active and passive players in RNP-remodeling Nucleic Acids Res., September 10, 2006; 34(15): 4168 - 4180. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cavey, S. Hijal, X. Zhang, and B. Suter Drosophila valois encodes a divergent WD protein that is required for Vasa localization and Oskar protein accumulation Development, February 1, 2005; 132(3): 459 - 468. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||