spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 27 July 2004
doi: 10.1242/dev.01289


Development 131, 4251-4261 (2004)
Published by The Company of Biologists 2004


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
dev.01289v1
131/17/4251    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Development
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bullock, S. L.
Right arrow Articles by Schmidt-Ott, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bullock, S. L.
Right arrow Articles by Schmidt-Ott, U.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Differential cytoplasmic mRNA localisation adjusts pair-rule transcription factor activity to cytoarchitecture in dipteran evolution

Simon L. Bullock1,*, Michael Stauber2,*, Alexander Prell2, Julian R. Hughes1, David Ish-Horowicz1 and Urs Schmidt-Ott2,3,{dagger}

1 Cancer Research UK, Developmental Genetics Laboratory, PO Box 123, 44 Lincoln's Inn Fields, London WC2A 3PX, UK
2 Max-Planck-Institut für Biophysikalische Chemie, Abt. Molekulare Entwicklungsbiologie, Am Fassberg 11, 37077 Göttingen, Germany
3 University of Chicago, Department of Organismal Biology and Anatomy, CLSC 921B, 920 East 58th Street, Chicago, IL 60615, USA

{dagger} Author for correspondence (e-mail: uschmid{at}uchicago.edu)

Accepted 7 June 2004


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Establishment of segmental pattern in the Drosophila syncytial blastoderm embryo depends on pair-rule transcriptional regulators. mRNA transcripts of pair-rule genes localise to the apical cytoplasm of the blastoderm via a selective dynein-based transport system and signals within their 3'-untranslated regions. However, the functional and evolutionary significance of this process remains unknown. We have analysed subcellular localisation of mRNAs from multiple dipteran species both in situ and by injection into Drosophila embryos. We find that although localisation of wingless transcripts is conserved in Diptera, localisation of even-skipped and hairy pair-rule transcripts is evolutionarily labile and correlates with taxon-specific changes in positioning of nuclei. We show in Drosophila that localised pair-rule transcripts target their proteins in close proximity to the nuclei and increase the reliability of the segmentation process by augmenting gene activity. Our data suggest that mRNA localisation signals in pair-rule transcripts affect nuclear protein uptake and thereby adjust gene activity to a variety of dipteran blastoderm cytoarchitectures.

Key words: Pair-rule, Developmental evolution, mRNA localisation, Cytoarchitecture, Diptera


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Many cell types use cytoplasmic mRNA localisation to distribute protein products within cells (Kloc et al., 2002Go). In neurons, various transcripts are selectively sorted to different regions of the cytoplasm (Job and Eberwine, 2001Go), and in motile fibroblasts localisation of ß-actin mRNA to the leading edge contributes to remodelling of the cytoskeleton (Kislauskis et al., 1997Go; Shestakova and Singer, 2001Go). Localisation can also be coupled to cell divisions in which protein determinants must be segregated asymmetrically (Long et al., 1997Go; Takizawa et al., 1997Go).

In the syncytial blastoderm embryo of the fruit fly Drosophila melanogaster, transcripts of the pair-rule gene class are localised asymmetrically to the apical side of a layer of peripheral nuclei (Hafen et al., 1984Go; Ingham et al., 1985Go; Kilchherr et al., 1986Go; Macdonald et al., 1986Go). Pair-rule transcripts encode transcription factors that are expressed in partially overlapping sets of seven circumferential stripes, and act in combination to establish segmental organisation (Pankratz and Jäckle, 1993Go). The segment polarity gene wingless (wg), which encodes an extracellular signalling molecule of the WNT family, also has its transcripts localised apically. Localisation of wg mRNA augments Wg signalling activity, although it is not yet clear by what mechanism this is achieved (Simmonds et al., 2001Go).

A shared machinery localises pair-rule and wg transcripts during embryogenesis (Wilkie and Davis, 2001Go; Bullock and Ish-Horowicz, 2001Go), and also translocates maternal mRNAs from their sites of synthesis in the nurse cells into the early oocyte (Bullock and Ish-Horowicz, 2001Go). The localisation machinery involves active transport towards the minus-ends of microtubules by the dynein/dynactin motor complex (Wilkie and Davis, 2001Go). Transport also depends on the proteins Egalitarian (Egl) and Bicaudal-D (BicD) (Bullock and Ish-Horowicz, 2001Go). The machinery may be used widely because BicD and dynein components are highly conserved in metazoans and Egl homologues are found in the nematode C. elegans.

All the transcript cargoes studied to date have been shown to contain localisation signals in their 3'-untranslated regions (3'-UTRs), which must direct interaction with the transport machinery. RNA recognition is dependent on secondary structure - localisation signals in different transcripts consist of double-stranded stem-loops that share no overt primary sequence similarity - although higher-order RNA folding may also be significant (Macdonald and Kerr, 1998Go; Bullock et al., 2003Go).

Although the mechanisms of pair-rule mRNA transport in the blastoderm embryo are emerging, the developmental and evolutionary significance of this process remains unclear. Pair-rule patterning is used in many insects, but RNA signals for the dynein machinery have only been studied within the genus Drosophila, where signals in the pair-rule transcript hairy (h) (Bullock et al., 2003Go), as well as those of wg (Simmonds et al., 2001Go) and the maternal transcript bicoid (Macdonald, 1990Go), are functionally conserved. The conservation of h localisation in drosophilids is not surprising, however, because these flies share very similar blastoderm types. By contrast, blastoderm morphologies can differ drastically in less closely related dipteran taxa (Anderson, 1972Go).

In this study, we have analysed transcript localisation of a large number of newly identified homologues of the pair-rule genes even-skipped (eve) and h, and of wg in multiple families of the insect order Diptera (true flies) by in situ hybridisation to endogenous transcripts and by injection of fluorescently labelled transcripts into Drosophila embryos. We show that Egl-dependent localisation signals are conserved in eve and h transcripts over 145 million years of evolution in higher (cyclorrhaphan) flies, indicating that this process is functionally significant, but absent in some, but not all, branches of lower Diptera. By contrast, wg transcript localisation appears to be conserved throughout Diptera. The phylogenetic occurrence of pair-rule transcript localisation suggests a selective advantage of this trait in species with a thickened peripheral cytoplasm and apically residing blastoderm nuclei. Consistent with this, we find that, in Drosophila, localisation of pair-rule mRNAs targets their proteins apically, in close proximity to the nuclei, and that interfering with localisation lowers the activity of pair-rule genes. We provide evidence that RNA localisation augments levels of protein within the nucleus and propose that, by affecting perinuclear translation, this mechanism may be used in a wide variety of organisms to modulate the activity of nuclear factors.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Fly culture
Fly cultures and egg collections of Megaselia abdita (Phoridae; scuttle or humpbacked flies), Coboldia fuscipes (Scatopsidae; scavenger flies) and Clogmia albipunctata (Psychodidae; moth flies) have been described previously (Rohr et al., 1999Go; Stauber et al., 2002Go). Empis livida (Empididae; dance flies), Haematopota pluvialis (Tabanidae; horse flies) and Platypeza consobrina (Platypezidae; flat-footed flies) were collected in the surroundings of Göttingen (Germany). Embryos of Episyrphus balteatus (Syrphidae; hover flies) were a gift from Peter Hondelmann (University of Hannover, Germany). Anopheles gambiae (Culicidae; African malaria mosquito, Suakoko strain) genomic DNA was a gift from Hans-Michael Müller (European Molecular Biology Laboratory, Germany). Throughout the text we refer to Cyclorrhapha as `higher Diptera' (including Drosophila, Episyrphus, Megaselia and Platypeza). The term `lower Diptera' is used for the paraphyletic assemblages of orthorrhaphous Brachycera (including Empis and Haematopota) and Nematocera (including Coboldia, Clogmia and Anopheles).

Wild-type Drosophila embryos were of the Oregon-R strain. eglWU50, eve1.27, ftz13, hi22, kni1, Kr1 and wgCX4 are reported to be strong loss-of-function or null alleles. egl3e is a partial loss-of-function allele that compromises the interaction of the protein with dynein light chain (Navarro et al., 2004Go). For Fig. 5B, larvae heterozygous for the pair-rule gene mutation were distinguished from wild types using balancer chromosomes marked with green fluorescent protein (GFP) driven from the actin promoter (Reichhart and Ferrandon, 1998Go). Embryos of similar zygotic genotype but different maternal origin were generated from reciprocal crosses (i.e. heterozygous pair-rule mutant males were mated to egl mutant females and vice versa). Larval cuticle preparations were performed as described (Wieschaus and Nüsslein-Volhard, 1986Go).



View larger version (60K):
[in this window]
[in a new window]
 
Fig. 5. Pair-rule gene activity is reduced in egl mutant embryos. (A) Distribution of transcripts (as indicated; red) in Drosophila blastoderm embryos laid by wild-type mothers (egl+/egl+) or partial loss-of-function egl mothers (egl3e/eglWU50). mRNA alone is shown in monochrome images. Pair-rule and wg transcripts accumulate apically in wild-type embryos but are detected readily in the basal cytoplasm of mutant embryos (white arrowheads), although some apical enrichment of pair-rule transcripts is observed in most stripes (red arrowheads). The bottom panels show Run protein, which is normally apical (red arrow, left) and nuclear, but can also be detected in the basal cytoplasm in egl mutant embryos (red arrow, right). (B) The frequency of segmentation phenotypes in first instar larvae caused by inactivation of one copy of a pair-rule gene is significantly enhanced when embryos are laid by an egl mutant mother. For wild-type and mutant maternal genotypes, eve and h mutations are associated with partial deletions of even-numbered segments, whereas ftz mutations had similar effects on odd-numbered segments. We observed similar interactions with an additional h mutant allele, h31 (data not shown). The low frequency of larvae with defects in zygotically wild-type embryos typically had small notches in either even- or odd-numbered segments or partial fusion of segments. The frequency of cuticular defects caused by heterozygosity for the gap genes kni and Kr and the segment polarity gene wg are not altered significantly by the egl mutant background although the identity of segments affected by gap gene mutations differ slightly. For example, Kr1/+ normally gives defects in T3, A1 and A2 but in egl mutants defects in A3 at the expense of defects in A1 and A2 were also observed. These alterations may reflect changes in the distribution of maternal RNA determinants or reduced pair-rule activity. Numbers above the bars are total number of larvae scored. *P<0.05; ***P<0.001 (Fisher's exact test). egl is provided only maternally to the blastoderm. Experiments were conducted at 25°C, except for those involving ftz, which were carried out at 29°C, because only a few defects were seen in either genotype at 25°C. (C) Representative examples of first instar larvae with one inactive copy of h (hi22) laid by wild-type or egl mutant mothers. Red asterisks show missing regions of ventral denticle belts in abdominal segments 4 and 6 (A4 and A6). Scale bar in C: 50 µm for A (except Run protein, 30 µm); 385 µm for C.

 
Cloning of eve, h and wg homologues
3' regions of Anopheles-eve, -ftz, -h, -odd and -wg homologues were PCR amplified with specific primers (based on sequences from the Anopheles genome project) on genomic DNA of Anopheles gambiae strain Suakoko, a gift from Hans-Michael Müller (EMBL, Heidelberg). Partial sequences of the other eve, h and wg homologues were amplified by PCR on genomic DNA with the degenerate primer pairs GITAYMGIACIRCITTYACNMGNGA/TANACNGCNGCRTANGGCCANGC (eve), AAYAARCCIATHATGGARAARMGNMG/GYTTIACIGTYWTYTCIARDATRTCNGC (h) and GARTGYAARTGYCAYGGNATG/RTAICCICKICCRCARCACAT (wg). For Clogmia-eve1, Platypeza-eve and Platypeza-h, phages were isolated from genomic Lambda FIX II (Stratagene) phage libraries (S. Lemke and U.S.-O., unpublished) and used as templates for PCR-amplification of 3'-regions. 3'-UTRs of all other homologues were amplified by PCR on cDNA prepared with Marathon or SMART RACE cDNA Amplification Kit (Clontech). Table S1 at http://dev.biologists.org/supplemental lists details of clones and contains information on templates, primers and products.

In situ hybridisation, immunostaining and RNA injections
In situ hybridisation was carried out essentially as described (Lehmann and Tautz, 1994Go; Stauber et al., 2002Go) using NBT/BCIP and Fast Red (Roche) for colourimetric and fluorescent detection of transcripts, respectively. Nuclei were stained by a 2 hours room temperature incubation in 5 µg/ml of Alexa 660-wheat germ agglutinin (WGA; Molecular Probes) in PBS. For immunostaining, we used mouse anti-Hairy (S. M. Pinchin, unpublished) and guinea pig anti-Run (Kosman et al., 1998Go) polyclonal primary antibodies and Alexa-488 or Alexa 594-conjugated secondary antibodies (Molecular Probes).

Fluorescent, capped mRNAs incorporating Alexa-488- (Molecular Probes), Cy3- or Cy5-UTP (Perkin Elmer) were synthesised as described (Bullock and Ish-Horowicz, 2001Go). Briefly, for each transcript, 250 ng/µl solutions were injected into nuclear cycle 14 blastoderm embryos which were fixed ~8 minutes after injection of the last embryo (~11 minutes after injection of the first). Anti-Egl antibody (Mach and Lehmann, 1997Go) was injected 10 minutes before the RNAs.

Expression of localising and non-localising h transcripts
To guard against potential dominant lethality arising from expression of non-localising transcripts, we used a conditional expression system in which an upstream FRT-stop-FRT cassette terminates transcription and prevents transgene expression unless excised using FLP recombinase (Struhl et al., 1993Go). We cloned the wild-type h cDNA, or one containing the h{Delta}D deletion that removes 20 nucleotides required for localisation (Bullock et al., 2003Go), appended to 3' h genomic sequences containing the polyadenylation signal, into a unique PmeI site within the Drosophila transformation vector P{w+mC (eve2)2 >hsp70 3'>}, a derivative of P{w+mC (eve2)2 >hsp70 3'> eve3'} (Wu et al., 2001Go) with the eve 3'UTR removed. h fragments were generated by PCR (details available upon request) and the h-coding regions in the final constructs were sequenced to ensure that no mutations were introduced. The resultant constructs (P{w+mC (eve2)2 >hsp70 3'> hwt} and P{w+mC (eve2)2 >hsp70 3'> h{Delta}Dnloc} contain two copies of a minimal eve stripe 2 enhancer that, following excision of the stop signal, drive expression of h in parasegment 3 (Kosman and Small, 1997Go). In the event, removal of the transcriptional terminating sequence in the male germ-line with the ß2-tubulin-FLP transgene (Struhl and Basler, 1993Go) yielded viable transgenic lines which were used in all the experiments described here. To quantitate levels of st2-h expression in different lines, we generated cDNA from 150-300 blastoderm embryos 2.5-3.25 hours after egg laying at 25°C from crosses of homozygous flies (nlocA, B and C; wtA and B) or heterozygous flies when homozygous lines were lethal (nlocD; wtD) or semi-lethal (wtC). The data shown in Fig. 6E are normalised for gene dosage. We used real-time PCR with TaqmanTM probes to quantify amounts of activated st2-h cDNA relative to actin 5C cDNA using the comparative CT method described by the manufacturers (PerkinElmer). The Taqman probes (used at 0.1 µM) and primers (0.4 µM each) were as follows: st2-h 5' GTGACCGCCGCACAGTC; st2-h 3' AACTTCAAGATCCCCATTCAAAGT; st2-h TaqmanTM probe CAACTAACTGCCTTCGTTAATATCCTCTGAATAAGCC; Actin 5' GGTTTATTCCAGTCATTCCTTTCAA; Actin 3' ACTGTAAACGCAAGTGGCGA; Actin TaqmanTM probe CCGTGCGGTCGCTTAGCTCAGC.



View larger version (92K):
[in this window]
[in a new window]
 
Fig. 6. Abolishing localisation of h transcripts reduces Hairy protein activity. (A-C) h transcripts (red) in wild-type (A) or transgenic (B,C) blastoderm embryos carrying one copy of a h transgene either with (B, st2-hwtD) or without (C, st2-hnlocD) a functional localisation signal under the control of the eve stripe 2 enhancer. Numbers of endogenous h stripes are indicated. Red bar indicates approximate region of enhancer activity. (D) Incidence of defects in thoracic segment 2 (T2) induced by st2-h activity in different transgenic lines. Numbers above bars indicate number of first instar larvae scored. (E) Levels of st2-h transcripts (relative to actin 5C transcripts) in different lines, as determined by real-time PCR, normalised to that of wtA. Provided RNA levels are not very high (nlocD and wtD), lines with localising st2-h transcripts have stronger phenotypic effects than those with nonlocalising transcripts, even when the localising transcript is expressed at significantly lower levels [e.g. P<0.01 for different transcript levels for wtA versus nlocB or nlocC and P=0.05 for wtB versus nlocC (t-test)]. (F-H) Lateral views of st2-h first instar larvae showing examples of (F) a normal T2 denticle belt, (G) a deletion of a ventral region of the T2 denticle belt leading to a characteristic curvature of the thorax (arrowhead points to remaining dorsal cuticle) or (H) a complete deletion of the T2 denticle belt. st2-h has been previously shown to have stronger effects ventrally (Wu et al., 2001Go). (I) Lateral (dorsal upwards) and (I') ventral views of st2-hnlocC/st2-hnlocC blastoderm embryos stained for ftz mRNA. In ventral views, stripes 1, 2 and 3 are shown. Anterior is towards the left. (J,J') Same views as in I,I' of st2-hwtB/st2-hwtB embryos. Ectopic h expression partially deletes ftz stripe 2 with a stronger effect ventrally. See Table S2 for quantification of ftz defects in different lines. (K-M) Confocal images of Hairy protein distribution in wild-type (K, +/+), (L) st2-hnlocC/st2-hnl°cC and (M) st2-hwtB/st2-hwtB blastoderm embryos. More Hairy protein accumulates in the nuclei between endogenous stripes 2 and 3 in st2-hwtB/st2-hwtB than it does in st2-hnlocC/st2-hnlocC, even though the former expresses significantly less st2-h mRNA. Consistent results were seen in several embryos for each genotype. Red bars in L-N show approximate regions of enhancer activity. (N) Mean fluorescent intensity/pixel within nuclei of corresponding images (data were collected with Kinetic Imaging AQM6 software). Scale bar: 50 µm in A-C; 180 µm in F-H; 130 µm in I-J', 20 µm in K-M.

 
The st2-h oligonucleotides amplify sequences between the eve 5'UTR and the FRT site in the transgene. Using cDNA from embryos of the parental yw strain, we showed that these primers do not amplify endogenous cDNAs. Nor do they amplify products when no reverse transcription step is included. We confirmed the validity of our assay using serial dilutions of one of the transgenic cDNA samples.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Apical eve and h transcript localisation in Diptera correlates with the position of blastoderm nuclei
To investigate the functional significance and phylogenetic occurrence of pair-rule mRNA localisation, we first cloned eve and h orthologues from species throughout Diptera (Fig. 1) (see Fig. S1 at http://dev.biologists.org/supplemental for full sequence alignments). We assayed transcript localisation in four of these species that can be cultured in the laboratory by whole-mount in situ hybridisations on blastoderm embryos. Two of them, Episyrphus (Syrphidae) and Megaselia (Phoridae), are cyclorrhaphan flies (i.e. higher dipterans) but, unlike Drosophila, belong to basal branches of this taxon; the other two, Coboldia (Scatopsidae) and Clogmia (Psychodidae), belong to different branches of lower Diptera (Fig. 2).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. Phylogenetic relationships of dipteran eve, h and wg genes. Newly-identified dipteran eve (A), h (B) and wg (C) sequences are more closely related to one another than to paralogous Drosophila genes. Phylogenetic distance trees were generated from ClustalW alignments of predicted protein sequences (see legend to Fig. S1 at http://dev.biologists.org/supplemental) using the Quartet Maximum-Likelihood Method of Strimmer and von Haeseler (Strimmer and von Haeseler, 1996Go). Numbers refer to reliability values in percent. AbdominalA (Dme-AbdA), AbdominalB (Dme-AbdB), Deadpan (Dme-Dpn), E(spl)m{Delta} (Dme-HLHm{Delta}), Hairy/E(spl)-related with YRPW motif (Dme-Hey), Ultrabithorax (Dme-Ubx), Dme-Wnt2, Dme-Wnt5 and Dme-Wnt6 were used as outgroups. Aga, Anopheles gambiae; Cal, Clogmia albipunctata; Cfu, Coboldia fuscipes; Dme, Drosophila melanogaster; Eba, Episyrphus balteatus; Eli, Empis livida; Hpl, Haematopota pluvialis; Mab, Megaselia abdita; Pco, Platypeza consobrina. Accession numbers: Dme-AbdA SWP, P29555; Dme-AbdB SWP, P09087; Dme-Dpn SWP, Q26263; Dme-HLHm{Delta} SWP, Q01071; Dme-Eve SWP, P06602; Dme-Hairy SPTREMBL, Q95NU9; Dme-Hey SPTREMBL, Q9U9U4; Dme-Ubx SWP, P02834; Dme-Wg SPTREMBL, Q8MQP9; Dme-Wnt2 SPTREMBL, Q9V584; Dme-Wnt5 SPTREMBL, Q9VWT4; Dme-Wnt6 SPTREMBL, Q9VM26.

 



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 2. Expression and localisation of eve and h transcripts in five dipteran species at blastoderm stage. (A-J) eve and (K-T) h whole-mount in situ hybridisation showing transcript expression [(A-E,K-O) blue/purple (anterior towards the left, dorsal upwards)] and subcellular localisation [(F-J,P-T) red (apical is upwards and basal downwards in this and subsequent figures)]. Nuclear envelopes are shown in green pseudocolour (Alexa 660-wheat-germ agglutinin) in this and other figures. eve and h are found at high levels in the apical cytoplasm of Drosophila, Megaselia and Episyrphus, although in the latter species, localisation is less efficient. In Clogmia and Coboldia, these transcripts are distributed uniformly in the apicobasal axis. We identified two eve homologues in Clogmia, both of which are expressed in stripes and do not localise asymmetrically; Clogmia-eve2 is shown here. Arrowheads indicate the junction between the yolk and cytoplasm. In Coboldia and Clogmia, posteriormost stripes are established only after the onset of gastrulation (not shown). Unlike other dipteran h homologues Episyrphus-h is also expressed in the putative anlage of extra-embryonic tissue (not shown). Clogmia-h (O) is detected in a pair of anterior lateral patches and two stripes that might correspond to h stripes 1 and 6 in other species; expression in other stripe domains is weak or absent at blastoderm stages. Phylogenetic relationships of the species are shown below (Collins and Wiegmann, 2002Go; Yeates and Wiegmann, 1999Go). MYA, million years ago. Scale bar: 50 µm in F-J,P-T; 235 µm in A,K; 560 µm in B,J; 280 µm in C,M; 145 µm in D,N; 240 µm in E,O.

 
In each species, eve and h transcripts are expressed in circumferential stripes (Fig. 2A-E,K-O). In the higher dipterans Drosophila, Episyrphus and Megaselia, seven eve and h stripes are formed at blastoderm stage (Fig. 2A-C,K-M). In the lower dipterans, Clogmia (where eve has been duplicated; Fig. 1 and Fig. S1) and Coboldia, fewer than seven eve and h stripes are present at this stage (Fig. 2D,E,N,O) and posterior pair-rule stripes are added after the onset of gastrulation (Rohr et al., 1999Go). The striped expression of the eve and h transcripts in blastoderm embryos suggests that they act during segmentation in these species, although, interestingly, pair-rule expression of the putative h orthologue in Clogmia may not be conserved (Fig. 2O).

In Megaselia, eve and h transcripts are tightly localised apically throughout blastoderm stages, much like their counterparts in Drosophila (Fig. 2H,R). In these species blastoderm embryos have a thickened blastoderm with nuclei that reside apically throughout the cellularisation process (Fig. 2F-H). In Episyrphus, transcripts are also enriched apically, but in contrast to Drosophila and Megaselia, a substantial proportion of the mRNA accumulates in the basal cytoplasm (Fig. 2G,Q). Early Episyrphus blastoderm embryos also have apical nuclei. However, in this species the nuclei adopt a more central position during the cellularisation process, at a time when pair-rule genes are active (see Fig. S2 at http://dev.biologists.org/supplemental). In Clogmia and Coboldia, however, eve and h transcripts are distributed evenly throughout the cytoplasm and these species have a thin blastoderm with little cytoplasm surrounding the nuclei (Fig. 2I,J,S,T). These results suggest that localisation of pair-rule transcripts is not associated with pair-rule patterning per se and that a requirement for the apical localisation of pair-rule genes may be influenced by the cytoarchitecture of the blastoderm. In addition, the apical localisation of eve and h mRNAs in diverse cyclorrhaphan flies that evolved independently for ~145 million years (Grimaldi and Cumming, 1999Go) indicates that pair-rule transcript localisation is functionally significant.

Apical localisation of wg transcripts throughout Diptera suggests a conserved localisation machinery
To test whether the localisation machinery is active in transporting other transcripts in Clogmia and Coboldia, we cloned homologues of wg (Fig. 1, Fig. 3A-C, Fig. S1 at http://dev.biologists.org/supplemental), which encodes an extracellular signalling protein, from these species. In Drosophila, wg transcripts are localised apically in late blastoderm (Fig. 3D) and cellularised postgastrular embryos (Fig. 3G). We find that wg transcripts are also enriched apically in Coboldia embryos at equivalent stages (Fig. 3E,H). This suggests that the Egl/BicD/dynein localisation machinery is active, and that the failure of Coboldia-eve and -h transcripts to localise reflects a lack of mRNA localisation signals.



View larger version (80K):
[in this window]
[in a new window]
 
Fig. 3. Subcellular localisation of wg transcripts in Drosophila, Coboldia and Clogmia embryos. (A-C) The segmental expression pattern of wg in extended germband embryos is conserved in Drosophila, Coboldia and Clogmia (anterior towards the left, dorsal upwards). (D-F) At blastoderm stages, wg transcripts accumulate apically in Drosophila and Coboldia, but not in Clogmia. (G-I) After gastrulation, wg transcripts accumulate apically in all three species. Localisation of wg in germband extended embryos appears to be reproducibly less efficient in Clogmia than in Coboldia and Drosophila, with a proportion of transcripts detected basally. Scale bar: 385 µm in A; 240 µm in B; 400 µm in C; 83 µm in D,F; 50 µm in E,G,I; 27 µm in H.

 
In Clogmia, wg transcripts are distributed uniformly in the cytoplasm of blastoderm embryos and become apically enriched only in epithelial cells of postgastrular embryos (Fig. 3F,I). These observations suggest that the Egl/BicD/dynein localisation machinery is present in lower Diptera, but that it can be deployed at different stages in different species.

Localisation signals in pair-rule genes are evolutionarily labile
We wanted to survey localisation of eve and h orthologues in additional species in order to gain further insights into the phylogenetic occurrence of pair-rule mRNA localisation. However, embryos from many phylogenetically informative taxa are not available for in situ hybridisation. We therefore used injection of fluorescently labelled transcripts into Drosophila embryos (Bullock and Ish-Horowicz, 2001Go; Wilkie and Davis, 2001Go) to test for localisation signals in eve, h and wg homologues cloned from other dipteran species. Each labelled RNA included a region of coding sequence as well as the full-length 3'UTR (Table S1 at http://dev.biologists.org/supplemental). The distribution of all 11 injected Megaselia, Episyrphus, Clogmia and Coboldia transcripts mirrors closely their endogenous distributions observed by in situ hybridisation (Fig. 2, Fig. 3, Fig. 4A,B). In all cases, apical accumulation of localising transcripts is prevented by pre-injecting Drosophila embryos with antibodies that specifically inhibit Egl function (Bullock and Ish-Horowicz, 2001Go) (not shown). Based on these data, we believe that RNA injection into Drosophila blastoderm embryos provides a reliable tool for detecting Egl/BicD/dynein-dependent localisation signals throughout Diptera. The similarities between localisation of endogenous and injected transcripts indicates that the specificity of the RNA recognition factors has changed little during more than 210 million years of dipteran evolution, presumably because it is constrained by the need to recognise multiple cargoes in different cell types.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4. Localisation of dipteran transcripts upon injection into Drosophila blastoderm embryos mediated by Egl-dependent mRNA localisation signals. (A) Drosophila embryos injected with h transcripts from dipteran species and fixed ~8-11 minutes later, showing representative examples of different efficiencies of mRNA localisation. Ten to 30 embryos were imaged for each transcript and used to categorise the extent of apical RNA enrichment. (A, bottom panels) Anopheles-h transcripts localise very efficiently upon injection (left), but localisation of this transcript is prevented by prior injection with antibodies that specifically inhibit the function of the Drosophila Egl protein (right). (B) Summary of the efficiency of localisation signals within dipteran eve, h and wg transcripts upon injection into Drosophila plotted onto the phylogenetic tree: +++, very efficient localisation; ++, efficient localisation; +, weak localisation; -, no apical enrichment. The efficiency of apical transport in this assay mirrors endogenous efficiencies of transcript localisation (compare with Figs 2 and 3). Both Clogmia-eve1 and Clogmia-eve2 fail to localise in this assay. All localising transcripts are dependent on Egl function. The occurrence of pair-rule mRNA localisation signals does not appear to be related to the absolute size of the embryo. For example, h transcripts contain localisation signals in Megaselia and Drosophila (length of the embryo is ~400-500 µm), but not in Haematopota (~1500 µm) or Coboldia (~260 µm). Scale bar: 50 µm.

 
We therefore used this heterologous assay to probe for Egl-dependent localisation signals in transcripts of several other species where it is not possible to examine transcript localisation in situ (Fig. 4). eve and h RNAs from the cyclorrhaphan Platypeza (Platypezidae) localise apically in Drosophila blastoderm embryos, providing further evidence that localisation signals in pair-rule transcripts are common throughout Cyclorrhapha.

We detected localisation signals in wg and three out of four tested pair-rule transcripts of the Malaria mosquito Anopheles [odd skipped (odd), fushi tarazu (ftz) (not shown) and h (Fig. 4A); a signal was not found in the full-length eve transcript]. The presence of localisation signals in pair-rule genes of this lower dipteran is interesting, because similar blastoderm types appear to have evolved convergently in the cyclorrhaphan and the culicomorphan branch of Diptera to which Anopheles belongs (Ivanova-Kasas, 1949Go; Anderson, 1972Go; Monnerat et al., 2002Go). Of Empis-eve, Haematopota-h and Haematopota-eve - transcripts from species that are more closely related to cyclorrhaphan flies than Anopheles, Clogmia and Coboldia - only the last localises upon injection into Drosophila. Although the injection assay does not allow us to discern the developmental context in which localisation signals are used, the results corroborate our conclusion from the analysis of mRNA localisation in situ (Fig. 2, Fig. 3), that, in Diptera, localisation of wg transcripts is conserved, whereas localisation of pair-rule transcripts is labile.

We could not detect any significant stretches of conserved primary sequence in 3' UTRs of localising transcripts. This is not surprising, however, because efficient signal recognition by the localisation machinery can be mediated by multiple, partially redundant interactions in which the essential features are contained within short stretches of base-paired RNA (Macdonald and Kerr, 1998Go; Bullock et al., 2003Go). Even within the genus Drosophila, the primary sequence of the h localisation signal has diverged significantly (Bullock et al., 2003Go).

Suppression of pair-rule transcript localisation in Drosophila alters pair-rule protein distribution and reduces pair-rule gene activity
The apparent correlation between apical pair-rule transcript localisation and apical-residing nuclei led us to the hypothesis that apical transcript localisation augments nuclear uptake of the transcription factor products of the pair-rule genes by targeting translation apically, in close proximity to the nuclei. We therefore assayed the consequences of disrupting pair-rule mRNA localisation in embryos of Drosophila melanogaster. Because components of the pair-rule mRNA localisation machinery are also required maternally for differentiation of the oocyte (Deng and Lin, 2001Go), we used a partial loss-of-function allele of egl (Navarro et al., 2004Go), which provides sufficient Egl function to overcome the earlier block in oogenesis. Females that have one copy of this allele (egl3e) and one copy of a null allele (eglWU50) lay eggs, ~40-60% of which are fertilised and develop to blastoderm stages. Whereas embryos laid by wild-type mothers have an almost exclusively apical distribution of pair-rule mRNAs such as eve, ftz, h and runt (run), those laid by egl3e/eglWU50 mothers accumulate a large proportion of these transcripts in the basal cytoplasm (Fig. 5A). A slight apical enrichment of pair-rule mRNAs is still detectable in most stripes in these mutants (Fig. 5A), consistent with their retention of some Egl activity.

The defect in transcript localisation in egl mutant embryos also affects the subcellular distribution of pair-rule proteins (Fig. 5A). For example, in wild-type blastoderm embryos, Run protein is first detected predominantly in the apical cytoplasm (not shown); in slightly older blastoderms, the bulk of this protein has accumulated in the nuclei but a proportion of it is still detected in the apical cytoplasm (Fig. 5A). In egl-deficient embryos, more diffuse cytoplasmic Run protein staining is also detected basally, similar to the distribution of its transcripts (Fig. 5A). We also observed basal accumulation of other pair-rule proteins in egl mutants (not shown), but the width and intensity of protein stripes as well as protein levels are not altered noticeably (not shown). Together, these observations suggest that pair-rule transcript localisation targets protein to the apical cytoplasm prior to import into the nuclei.

In embryos from egl mutant mothers, the apical localisation of wg transcripts is very strongly reduced (Fig. 5A) but, despite the inefficient localisation of these and pair-rule mRNAs, segmentation is only slightly impaired. Some (7.4%; n=136) egl3e/eglWU50 blastoderm embryos show variable defects in the pattern of segmental engrailed expression (not shown), whereas only 1.3% of embryos from the reciprocal cross - i.e. wild-type mothers mated to egl3e/eglWU50 males - exhibit such defects (n=309; P<0.01; Fisher's exact test). The frequency of mild cuticular patterning defects in first instar larvae from egl mutant females is also increased (3.1%, n=349) compared with wild-type controls (0.7%, n=420; P<0.05; Fig. 5B).

However, egl mutant embryos are acutely sensitive to a reduction in pair-rule gene dose (Fig. 5B,C). For example, 32.4% of hi22/h+ first instar larvae from egl3e/eglWU50 mothers have pair-rule defects, compared with 3.2% from wild-type mothers (P<0.001). These genetic interactions do not reflect a general sensitivity of early patterning processes to a reduction in Egl function, however, because phenotypes caused by heterozygosity of gap genes such as Krüppel (Kr) and knirps (kni) - which function upstream of the pair-rule genes in segmentation, and whose transcripts are not localised asymmetrically - and wg are not enhanced significantly by the maternal egl mutant genotype (Fig. 5B).

These experiments suggest that apical localisation of pair-rule mRNAs and proteins enhance their activity, although they do not rule out entirely a role for Egl independent of its function in pair-rule transcript localisation. Nor do they address the consequences of completely blocking localisation of a pair-rule mRNA, because the egl mutants still retain some transport activity.

We therefore assayed the activity of a pair-rule protein encoded either by localising transcripts or by transcripts distributed uniformly in the cytoplasm. Wild-type h transcripts or transcripts lacking 20 nucleotides within the 3'UTR that are essential for RNA transport [the h{Delta}D mutation (Bullock et al., 2003Go)] were misexpressed in the eve stripe 2 domain, and assayed for their ability to repress stripe 2 of the h target gene ftz, which leads to deletions in the larval mesothorax (segment T2). As the effects in this assay are dose dependent (Wu et al., 2001Go), it is well suited to probe for subtle differences in activities. As expected, lines bearing transgenes that encode the wild-type 3'-UTR produce apically localised transcripts (st2-hwt lines; Fig. 6B), whereas those expressing the mutant 3'UTR give rise to transcripts distributed uniformly in the cytoplasm (st2-hnloc lines; Fig. 6C). We did not observe significant differences in the width of the stripe of localising or nonlocalising ectopic h transcripts using a probe that distinguishes st2-h from endogenous h (not shown).

Lines bearing localising or non-localising transcripts of st2-h can lead to defects in T2 (Fig. 6D), demonstrating that nonlocalising transcripts encode functional protein. To distinguish effects of expression level and mRNA localisation, we used real-time RT-PCR to quantitate levels of st2-h mRNA relative to those of endogenous actin mRNA levels in each transgenic line (Fig. 6E). Comparing lines expressing similar levels of st2-h transcript indicates that T2 defects are more severe and penetrant when transcripts localise apically (Fig. 6D). Consistent with this, localised st2-h RNA is more efficient at repressing ftz transcription than unlocalised transcripts (Fig. 6I,J; see Table S2 at http://dev.biologists.org/supplemental). Only in very strongly expressing lines (st2-hwtD and st2-hnlocD) do the ectopic transcripts cause equivalent phenotypes (disruption of T2 in over 90% of embryos), indicating that high expression levels can overcome the requirement for apical mRNA localisation. We estimate that in moderately expressing lines, localising st2-h transcripts have similar effects to two- to threefold more nonlocalising transcripts (Fig. 6D,E). Consistent with our analysis of egl mutant embryos, these data indicate that apical mRNA localisation augments pair-rule activity.

To investigate how localising mRNA enhances h activity, we compared the level of Hairy protein in the eve stripe 2 domain of transgenic lines encoding localising and non-localising st2-h transcripts. We found that levels of the protein in nuclei of the eve stripe 2 domain are clearly lower in st2-hnlocC than in st2-hwtB (Fig. 6K-N), even though the former expresses significantly more transcript. Although the anti-Hairy antibody is not sufficiently sensitive to detect cytoplasmic Hairy protein above background, we observe a diffuse distribution of several other pair-rule proteins in the basal cytoplasm when apical pair-rule RNA localisation is compromised in egl mutants (see above). In addition, when an excess of in vitro synthesised wild-type h RNA is injected, Hairy protein is detected in the apical cytoplasm, whereas when transcripts are injected that contain the same inactivating deletion in the localisation signal carried by the st2-hnloc lines Hairy protein is detected uniformly throughout the cytoplasm (not shown). Together, these data argue that apical h RNA localisation targets protein apically, in close proximity to the nuclei.


    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Localisation of mRNAs adjacent to the nucleus augments the nuclear concentration of pair-rule protein and improves the reliability of the segmentation process
Apical localisation of pair-rule mRNAs in Drosophila syncytial blastoderm embryos was first noted 20 years ago, but the developmental and evolutionary significance of this process has remained unclear. We show that apical pair-rule mRNA localisation is conserved in cyclorrhaphan species that diverged over 145 million years ago, indicating that this process has a significant developmental role under natural conditions. Likewise, the widespread maintenance of wg transcript localisation in Diptera supports the importance of this process on a phylogenetic scale, even though, in Drosophila, wg appears to be less sensitive than pair-rule genes to a reduction in endogenous transcript localisation (Fig. 5B).

Unlike wg transcripts, pair-rule mRNAs do not localise in some branches of lower Diptera, and the phylogenetic occurrence of this process provides interesting insights into its functional significance. Enrichment of pair-rule transcripts in the apical cytoplasm correlates with the position of blastoderm nuclei: efficient apical localisation of pair-rule gene transcripts is found in species which retain an asymmetric apical position of nuclei throughout the blastoderm stage (Drosophila, Megaselia); less efficient localisation is seen when the nuclei move from an apical to a more central position during blastoderm stages (Episyrphus); and no apical enrichment of transcripts is seen in species where blastoderm nuclei are surrounded uniformly by a thin layer of cytoplasm (Coboldia, Clogmia). We also find localisation signals in several pair-rule transcripts of the lower dipteran Anopheles. Like Cyclorrhapha, but unlike many other lower Diptera and most other insects, this culicid species has evolved a thickened blastoderm with apically positioned nuclei, probably to allow rapid development as an adaptation to ephemeral larval habitats (Anderson, 1972Go; Ferrar, 1987Go): columnar cells that emerge from thickened blastoderms can enter gastrulation directly, whereas cuboidal cells that emerge from thin blastoderms still have to elongate prior to undergoing the requisite cell shape changes.

In Drosophila, we find that pair-rule proteins are enriched in the apical cytoplasm prior to import into the nuclei in wild-type blastoderms, whereas they are detected basally in egl mutant embryos, in which transcript localisation is inefficient. The apical accumulation of pair-rule proteins under normal circumstances is consistent with the observation that apical RNA targeting restricts diffusion of cytoplasmic ß-galactosidase (Davis and Ish-Horowicz, 1991Go). Apically targeted protein is most likely confined by the cellularisation process, in which the plasma membrane invaginates between the nuclei and encloses the apical compartment first (Fig. 7).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 7. A model for the role of apical pair-rule mRNA localisation in Diptera. Cartoon illustrating mRNA and protein distributions in syncytial blastoderm embryos. Darker shading of nuclei represents a higher concentration of pair-rule protein. See Discussion for details. cf, cellularisation front; n, nucleus; y, yolk.

 
Davis and Ish-Horowicz (Davis and Ish-Horowicz, 1991Go) speculated that mRNA localisation prevents pair-rule proteins from moving into inter-stripe regions, where they would cause dominant patterning defects. However, when pair-rule mRNA localisation is compromised, either by interfering with the localisation machinery or the RNA signals, we do not observe expansion of RNA or protein stripes or ectopic phenotypic effects. Rather, we see a reduction of pair-rule activity in their domains of expression in these experiments, indicating that transcript localisation augments gene function. Pair-rule mRNA localisation does not appear to be obligatory for protein activity in Drosophila but makes the segmentation process more reliable: egl mutants, in which transcripts localise very inefficiently, have a mild increase in segmentation defects and are acutely sensitive to the reduction of pair-rule gene dose.

By what mechanism does pair-rule mRNA localisation augment the activity of their transcription factor products? We demonstrate for h that suppression of transcript localisation reduces nuclear levels of its protein. Pair-rule proteins could be specifically modified in the apical cytoplasm, or localising transcripts could be translated more efficiently. However, given the diffuse distribution of pair-rule proteins in the basal cytoplasm when RNA localisation is disrupted in egl mutants and the correlation between cytoarchitecture and pair-rule transcript localisation in Diptera, we favour a third possibility, namely that apical mRNA localisation increases nuclear uptake of their proteins by targeting translation in close proximity to the nuclei (Fig. 7). Proteins from non-localising mRNAs would not be available at high levels in the immediate vicinity of the nuclei, which would result in a decreased nuclear uptake. Such a role for apical pair-rule mRNA localisation would be redundant in lower Diptera with only a thin layer of cytoplasm surrounding the nuclei, which provides little room for diffusion of pair-rule proteins prior to nuclear import. A mechanism for perinuclear protein targeting might be particularly significant for nuclear proteins with short half-lives, such as those encoded by pair-rule genes (Edgar et al., 1987Go). Interestingly, localisation of mRNA in the vicinity of the nucleus to aid import of nuclear proteins has also been reported in cultured mammalian cells (Levadoux et al., 1999Go) and may be a widespread mechanism to efficiently exploit a limited pool of transcripts in cells that are polarised or have a high cytoplasmic:nuclear ratio.

The relationship between cytoarchitecture and apical pair-rule transcript localisation does not appear to be absolute because we detected a signal in eve, but not h, from Haematopota, which has retained the ancestral, cuboidal blastoderm morphology (U.S.-O., unpublished) and because we did not detect a localisation signal in Anopheles-eve. Although we cannot yet discern the developmental context in which these signals are used (in situ hybridisation is currently not possible in these species because of egg shells that are difficult to remove and because of difficulties in obtaining embryos) these data raise the possibility that, within a single species, the differential ability of transcripts to be recognised by the localisation machinery is used to fine-tune transcriptional control of target genes in the blastoderm by modulating the nuclear concentration of pair-rule proteins.

The efficiency of transcript localisation is modified gradually in evolution
The ability of eve and h pair-rule transcripts to use the localisation machinery varies in Diptera. We observe a range of localisation efficiencies in situ that are mirrored in all 11 cases upon injection into Drosophila embryos. Thus, differences in localisation efficiency appear to reflect changes in the respective localisation signals, rather than alterations in the specificity of the protein machinery. These findings are consistent with previous studies with artificial variants of the Drosophila-h localisation signal, which suggest that the character of localisation signals modulates the efficiency of localisation by determining the kinetics of both the initiation of transport and the transport process itself (Bullock et al., 2003Go). Localisation efficiency appears to be determined by multiple RNA:protein interactions, the sum of which affects the stability and/or activity of the RNA:motor complex (Macdonald and Kerr, 1998Go; Chartrand et al., 2002Go; Bullock et al., 2003Go). Therefore, the efficiency of the localisation process can be modified gradually during evolution by the addition, loss or modification of individual recognition sites within mRNAs.

It seems that localisation signals in pair-rule genes have emerged multiple times within Diptera. For example, although we cannot rule out the possibility that localisation signals in h have been lost in multiple different lineages of lower Diptera, the most parsimonious explanation for the phylogenetic distribution of signals in this transcript is that they evolved independently in response to changes in cytoarchitecture in the lineages leading to Cyclorrhapha and Culicomorpha. Injection of transcripts from additional species into Drosophila will determine whether eve localisation signals emerged independently in the lineages leading to Haematopota and Cyclorrhapha, or were lost in the lineage leading to Empis.

Work in mammalian cells has provided insights into how localisation signals might initially appear (Fusco et al., 2003Go). These studies suggest that non-localising mRNAs can also interact with a motor complex, albeit with a comparatively small probability, and undergo short movements on microtubules. Localisation signals appear to augment these interactions and lead to the net translocation of an RNA population along a polarised cytoskeleton by increasing the frequency and duration of directed transport (Fusco et al., 2003Go). The localisation machinery in Diptera may also have a general, weak affinity for mRNAs because a small proportion of particles of injected non-localising transcripts are transported over short distances in Drosophila embryos (M. Wainwright and S.B., unpublished). Asymmetric accumulation of a population of transcripts may therefore evolve gradually as a result of selection for increased interaction between a specific transcript and the localisation machinery.

Concluding remarks
Using a combination of functional and phylogenetic analyses, we have provided evidence that the alteration of mRNA localisation signals is an important mechanism by which the activity of pair-rule transcription factors is regulated in flies. Apical localisation of these transcripts appears to augment the nuclear concentration of their protein products and makes the segmentation process less sensitive to perturbation of gene activity. It seems that different species have made use of the localisation machinery to adapt the deployment of specific pools of transcripts to evolutionary changes in blastoderm cytoarchitecture. Thus, the mRNA localisation mechanism may permit networks of patterning genes to tolerate changes in cell morphology, such as those imposed by reproductive adaptations.

In Drosophila, transport of mRNAs by the Egl/BicD/dynein machinery determines the distributions of several different kinds of proteins in diverse cell types such as oocytes, epithelial cells and neuroblasts (Bullock and Ish-Horowicz, 2001Go) (J.H., unpublished). Our studies of pair-rule mRNAs imply that the repertoire of other RNA cargoes for the machinery, and their efficiency of transport, may also be modulated readily in evolution through changes in localisation signals. Therefore, differential mRNA localisation is potentially an important factor in facilitating morphological evolution.


    ACKNOWLEDGMENTS
 
We thank Gordon Dowe for sequencing. For reagents, we thank Ruth Lehmann, Peter Hondelmann, Steffen Lemke, Sheena Pinchin, Steve Small and Hans-Michael Müller. We also thank Herbert Jäckle for his advice and generous support of this project, and acknowledge advice, and/or comments on the manuscript by Klaus Sander, Peter Chandler, Hans Ulrich and Michael Clark. Finally, we thank members of our laboratories and colleagues in the laboratory of Herbert Jäckle for discussions and support. Funding was provided by Cancer Research UK (S.B., J.H. and D.I.-H.) and the Beit Memorial Trust (S.B.), the Max-Planck-Gesellschaft, The University of Chicago and the Deutsche Forschungsgemeinschaft (U.S.-O.).


    Footnotes
 
Supplemental data available online

* These authors contributed equally to this work Back


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 


Anderson, D. T. (1972). The development of holometabolous insects. In Developmental systems: insects (ed. S. J. Counce and C. H. Waddington), pp.165 -242. London, UK: Academic Press.
Bullock, S. L. and Ish-Horowicz, D. (2001). Conserved signals and machinery for RNA transport in Drosophila oogenesis and embryogenesis. Nature 414,611 -616.[CrossRef][Medline]
Bullock, S. L., Zicha, D. and Ish-Horowicz, D. (2003). The Drosophila hairy RNA localization signal modulates the kinetics of cytoplasmic mRNA transport. EMBO J. 22,2484 -2494.[CrossRef][Medline]
Chartrand, P., Meng, X. H., Huttelmaier, S., Donato, D. and Singer, R. H. (2002). Asymmetric sorting of ash1p in yeast results from inhibition of translation by localization elements in the mRNA. Mol. Cell. 10,1319 -1330.[CrossRef][Medline]
Collins, K. P. and Wiegmann, B. M. (2002). Phylogenetic relationships of the lower Cyclorrhapha (Diptera: Brachycera) based on 28S rDNA sequences. Insect Syst. Evol. 33,445 -456.
Davis, I. and Ish-Horowicz, D. (1991). Apical localization of pair-rule transcripts requires 3' sequences and limits protein diffusion in the Drosophila blastoderm embryo. Cell 67,927 -940.[CrossRef][Medline]
Deng, W. and Lin, H. (2001). Asymmetric germ cell division and oocyte determination during Drosophila oogenesis. Int. Rev. Cytol. 203,93 -138.[Medline]
Edgar, B. A., Odell, G. M. and Schubinger, G. (1987). Cytoarchitecture and the patterning of fushi tarazu expression in the Drosophila blastoderm. Genes Dev. 1,1226 -1237.[Abstract/Free Full Text]
Ferrar, P. (1987). A guide to the breeding habits and immature stages of Diptera Cyclorrhapha. Entomonograph 8,907 .
Fusco, D., Accornero, N., Lavoie, B., Shenoy, S. M., Blanchard, J.-M., Singer, R. H. and Bertrand, E. (2003). Single mRNA molecules demonstrate probabilistic movement in living mammalian cells. Curr. Biol. 13,161 -167.[CrossRef][Medline]
Grimaldi, D. and Cumming, J. (1999). Brachyceran Diptera in cretacaceous ambers and mesozoic diversification of the Eremoneura. Bull. Am. Mus. Nat. Hist. 239, 1-124.
Hafen, E., Kuroiwa, A. and Gehring, W. J. (1984). Spatial distribution of transcripts from the segmentation gene fushi tarazu during Drosophila embryonic development. Cell 37,833 -841.[CrossRef][Medline]
Ingham, P. W., Howard, K. R. and Ish-Horowicz, D. (1985). Transcription pattern of the Drosophila segmentation gene hairy. Nature 321,493 -499.[CrossRef]
Ivanova-Kasas, O. M. (1949). Embryological development of Anopheles maculipennis Mg. Izv. Akad. Nauk. SSSR Ser. Biol. 2,140 -170.
Job, C. and Eberwine, J. (2001). Localization and translation of mRNA in dendrites and axons. Nat. Rev. Neurosci. 2,889 -898.[CrossRef][Medline]
Kilchherr, F., Baumgartner, S., Bopp, D., Frei, E. and Noll, M. (1986). Isolation of the paired gene of Drosophila and its spatial expression during early embryogenesis. Nature 321,493 -499.[CrossRef]
Kislauskis, E. H., Zhu, X. and Singer, R. H. (1997). ß-Actin messenger RNA localization and protein synthesis augment cell motility. J. Cell Biol. 136,1263 -1270.[Abstract/Free Full Text]
Kloc, M., Zearfoss, N. R. and Etkin, L. D. (2002). Mechanisms of subcellular mRNA localization. Cell 108,533 -544.[CrossRef][Medline]
Kosman, D. and Small, S. (1997). Concentration-dependent patterning by an ectopic expression domain of the Drosophila gap gene knirps. Development 124,1343 -1354.[Abstract]
Kosman, D., Small, S. and Reinitz, J. (1998). Rapid preparation of a panel of polyclonal antibodies to Drosophila segmentation proteins. Dev. Genes Evol. 208,290 -294.[CrossRef][Medline]
Lehmann, R. and Tautz, D. (1994). In situ hybridization to RNA. In Drosophila melanogaster: Practical uses in cell and molecular biology (ed. L. S. B. Goldstein and E. A. Fyrberg), pp. 575-598. San Diego, CA: Academic Press.
Levadoux, M., Mahon, C., Beattie, J. H., Wallace, H. M. and Hesketh, J. E. (1999). Nuclear import of metallothionein requires its mRNA to be associated with the perinuclear cytoskeleton. J. Biol. Chem. 274,34961 -34966.[Abstract/Free Full Text]
Long, R. M., Singer, R. H., Meng, X., Gonzalez, I., Nasmyth, K. and Jansen, R. P. (1997). Mating type switching in yeast controlled by asymmetric localization of ASH1 mRNA. Science 277,383 -387.[Abstract/Free Full Text]
Macdonald, P. M. (1990). bicoid mRNA localization signal: phylogenetic conservation of function and RNA secondary structure. Development 110,161 -171.[Abstract]
Macdonald, P. M. and Kerr, K. (1998). Mutational analysis of an RNA recognition element that mediates localization of bicoid mRNA. Mol. Cell. Biol. 18,3788 -3795.[Abstract/Free Full Text]
Macdonald, P. M., Ingham, P. W. and Struhl, G. (1986). Isolation, structure, and expression of even-skipped: a second pair-rule gene of Drosophila containing a homeobox. Cell 47,721 -734.[CrossRef][Medline]
Mach, J. M. and Lehmann, R. (1997). An Egalitarian-BicaudalD complex is essential for oocyte specification and axis determination in Drosophila. Genes Dev. 11,423 -435.[Abstract/Free Full Text]
Monnerat, A. T., Machado, M. P., Vale, B. S., Soares, M. J., Lima, J. B. P., Lenzi, H. L. and Valle, D. (2002). Anopheles albitarsis embryogenesis: morphological identification of major events. Mem. Inst. Oswaldo Cruz 97,589 -596.[Medline]
Navarro, C., Puthalakath, H., Adams, J. M., Strasser, A. and Lehmann, R. (2004). Egalitarian binds dynein light chain to establish oocyte polarity and maintain oocyte fate. Nat. Cell Biol. 6,427 -435.[CrossRef][Medline]
Pankratz, M. J. and Jäckle, H. (1993). Blastoderm segmentation. In The development of Drosophila melanogaster (ed. M. Bate and A. Martinez-Arias), pp.467 -516. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Reichhart, J. M. and Ferrandon, D. (1998). Green balancers. D.I.S. 81,201 -202.
Rohr, K. B., Tautz, D. and Sander, K. (1999). Segmentation gene expression in the mothmidge Clogmia albipunctata (Diptera, Psychodidae) and other primitive dipterans. Dev. Genes Evol. 209,145 -154.[CrossRef][Medline]
Shestakova, E. A. and Singer, R. H. (2001). The physiological significance of ß-actin mRNA localization in determining cell polarity and directional motility. Proc. Natl. Acad. Sci. USA 98,7045 -7050.[Abstract/Free Full Text]
Simmonds, A. J., dosSantos, G., Livne-Bar, I. and Krause, H. M. (2001). Apical localization of wingless transcripts is required for Wingless signaling. Cell 105,197 -207.[CrossRef][Medline]
Stauber, M., Prell, A. and Schmidt-Ott, U. (2002). A single Hox3 gene with composite bicoid and zerknüllt expression characteristics in non-Cyclorrhaphan flies. Proc. Natl. Acad. Sci. USA 99,274 -279.[Abstract/Free Full Text]
Strimmer, K. and von Haeseler, A. (1996). Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies. Mol. Biol. Evol. 13,964 -969.
Struhl, G. and Basler, K. (1993). Organizing activity of wingless protein in Drosophila. Cell 72,527 -540.[CrossRef][Medline]
Struhl, G., Fitzgerald, K. and Greenwald, I. (1993). Intrinsic activity of the Lin-12 and Notch intracellular domains in vivo. Cell 74,331 -345.[CrossRef][Medline]
Takizawa, P. A., Sil, A., Swedlow, J. R., Herskowitz, I. and Vale, R. D. (1997). Actin-dependent localization of an RNA encoding a cell-fate determinant in yeast. Nature 389, 90-93.[CrossRef][Medline]
Wieschaus, E. and Nüsslein-Volhard, C. (1986). Looking at embryos. In Drosophila, A Practical Approach (ed. D. B. Roberts), pp.199 -226. Oxford, UK: IRL Press.
Wilkie, G. S. and Davis, I. (2001). Drosophila wingless and pair rule transcripts localize apically by Dynein-mediated transport of RNA particles. Cell 105,209 -219.[CrossRef][Medline]
Wu, X., Vasisht, V., Kosman, D., Reinitz, J. and Small, S. (2001). Thoracic patterning by the Drosophila gap gene hunchback. Dev. Biol. 237, 79-92.[CrossRef][Medline]
Yeates, D. K. and Wiegmann, B. M. (1999). Congruence and controversy: toward a higher-level phylogeny of Diptera. Annu. Rev. Entomol. 44,397 -428.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related articles in Development:

The rules of pair-rule evolution

Development 2004 131: e1702. [Full Text]  

The rules of pair-rule evolution

Development 2004 131: e1702. [Full Text]  



This article has been cited by other articles:


Home page
Genes Dev.Home page
D. Nashchekin and D. St Johnston
Egalitarian recruitment of localized mRNAs
Genes & Dev., July 1, 2009; 23(13): 1475 - 1480.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. Dienstbier, F. Boehl, X. Li, and S. L. Bullock
Egalitarian is a selective RNA-binding protein linking mRNA localization signals to the dynein motor
Genes & Dev., July 1, 2009; 23(13): 1546 - 1558.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Navarro, S. Bullock, and R. Lehmann
Altered dynein-dependent transport in piRNA pathway mutants
PNAS, June 16, 2009; 106(24): 9691 - 9696.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S. Lemke and U. Schmidt-Ott
Evidence for a composite anterior determinant in the hover fly Episyrphus balteatus (Syrphidae), a cyclorrhaphan fly with an anterodorsal serosa anlage
Development, January 1, 2009; 136(1): 117 - 127.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
G. dos Santos, A. J. Simmonds, and H. M. Krause
A stem-loop structure in the wingless transcript defines a consensus motif for apical RNA transport
Development, January 1, 2008; 135(1): 133 - 143.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
G. Vendra, R. S. Hamilton, and I. Davis
Dynactin suppresses the retrograde movement of apically localized mRNA in Drosophila blastoderm embryos
RNA, November 1, 2007; 13(11): 1860 - 1867.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
K. E. Jaeger, A. Graf, and P. A. Wigge
The control of flowering in time and space
J. Exp. Bot., October 1, 2006; 57(13): 3415 - 3418.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Kloc and L. D. Etkin
RNA localization mechanisms in oocytes
J. Cell Sci., January 15, 2005; 118(2): 269 - 282.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
dev.01289v1
131/17/4251    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Development
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bullock, S. L.
Right arrow Articles by Schmidt-Ott, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bullock, S. L.
Right arrow Articles by Schmidt-Ott, U.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?