|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 4 August 2004
doi: 10.1242/dev.01283
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institut für Biochemie und Molekulare Zellbiologie, Georg-August-Universität Göttingen, Justus-von-Liebig Weg 11, 37077 Göttingen, Germany
* Author for correspondence (e-mail: tpieler{at}gwdg.de)
Accepted 14 April 2004
| SUMMARY |
|---|
|
|
|---|
Key words: RNA localization, RNA transport, Xenopus laevis, Oogenesis
| Introduction |
|---|
|
|
|---|
In Xenopus, vegetally localized RNAs have been implicated in
playing a role in early embryonic patterning and cell fate determination.
There are two major pathways that mediate RNA localization to the vegetal
cortex during oogenesis (reviewed by Kloc
et al., 2001
; Rand and
Yisraeli, 2001
). During the earliest stages of oogenesis (stage
I/II), the first one of the localization pathways, the early one, utilizes a
structure referred to as the mitochondrial cloud (Balbiani body), which is
composed of mitochondria, lipids and diverse electron-dense materials. Most of
the early pathway RNAs are later restricted to the germinal granules in the
distal region of the vegetal cortex and seem to be involved in germ cell
determination (for a review, see Kloc et
al., 2001
). The second pathway, which operates during stages
III-IV, is referred to as the late pathway and localizes mRNAs encoding
developmental determinants such as Vg1, VegT and XBic-c to the vegetal pole of
the oocyte (Weeks and Melton,
1987
; Wessely and De Robertis,
2000
; Zhang and King,
1996
). In stage I oocytes these RNAs are found to be dispersed
throughout the cytoplasm but are excluded from the mitochondrial cloud, where
at this time point the early pathway RNAs are already enriched. Starting with
late stage II/stage III of oogenesis, the late pathway RNAs first localize to
the wedge-shaped region beneath the germinal vesicle that has previously been
occupied by the mitochondrial cloud, and are subsequently transported towards
the vegetal hemisphere, where they remain until the end of oogenesis.
Characteristically, late pathway RNAs occupy a broader region of the vegetal
hemisphere in stage VI oocytes than the early pathway RNAs, which are
restricted to a narrower region at the tip of the vegetal cortex. However, the
early and late localization pathways seem to overlap in some respect, since
several RNAs have been described as exhibiting features of both localization
pathways and are therefore thought to make use of an intermediate pathway
(Betley et al., 2002
;
Chan et al., 1999
).
RNA transport to distinct subcellular foci has been found to be mediated by
cis-acting sequences, which usually reside in the 3'-untranslated region
of the RNA to be localized. The 340 nucleotide localization element of the Vg1
mRNA (Vg1-LE) has been mapped by microinjection experiments and possesses a
number of different subelements with redundant function
(Cote et al., 1999
;
Deshler et al., 1998
;
Mowry and Melton, 1992
;
Yaniv and Yisraeli, 2001
).
Based on the observation that the late localizing VegT-RNA contains reiterated
VM1 and E2 elements, it has been proposed that these may serve as consensus
signals for late pathway RNAs (Bubunenko et
al., 2002
; Kwon et al.,
2002
). A detailed analysis of the localization element of an early
pathway RNA has been performed with Xcat2, which contains a composite
localization element in its 3'-untranslated region, consisting of a
mitochondrial cloud localization element (MCLE)
(Zhou and King, 1996a
) and an
additional, independent element, which directs the mRNA to the germinal
granules within the germ plasm-containing region of the mitochondrial cloud
(Kloc et al., 2000
). On the
basis of statistical analysis, it has been proposed that clusters of
CAC-containing motifs characterize the localization elements of the majority
of RNAs localizing to the vegetal cortex in Xenopus oocytes
(Betley et al., 2002
).
Interestingly, this seems to hold true for vegetal RNAs belonging to the
early, late or intermediate localization pathway.
Candidate trans-acting factors that interact with localization elements and
may mediate the directional transport of the RNAs have first been identified
by UV cross-linking experiments; six proteins showed a specific cross-linking
activity to the 340 nucleotide Vg1-LE
(Mowry, 1996
). Four proteins
that bind to the Vg1-LE have been identified. One is Vg1RBP, or Vera, which
contains two RRM domains and four KH domains
(Deshler et al., 1998
;
Havin et al., 1998
). The
second protein is VgRBP60, a homolog of hnRNP I, which contains four RRM
domains (Cote et al., 1999
).
Two additional Vg1-LE-interacting proteins, Prrp and the recently reported
VgRBP71, have been identified by screening a cDNA expression library for Vg1
RNA LE interacting proteins (Kroll et al.,
2002
; Zhao et al.,
2001
). The proline-rich RNA-binding protein Prrp contains two RNP
domains, as well as a C-terminally located proline-rich region. VgRBP71 is a
KH-domain protein, which is highly homologous to the human FUSE-binding
protein or KSRP. Very recently, it has been shown that VgRBP71 acts as a
translational activator by promoting the cleavage of a translational control
element of Vg1 mRNA, rather than directly participating in the vegetal
transport steps themselves (Kolev and
Huber, 2003
). Vg1RBP and VgRBP71 have been reported to bind RNAs
of both localization pathways (Havin et
al., 1998
; Kroll et al.,
2002
), whereas Prrp seems to have binding preferences for the late
pathway RNAs Vg1 and VegT, but associates also, like VgRBP71, with RNAs
localized to the animal hemisphere (Zhao
et al., 2001
).
We have screened a vegetal cortex cDNA library for novel localized maternal mRNAs. One of these is XNIF, encoding an evolutionary conserved protein of unknown biological function. Transport to the vegetal pole of Xenopus oocytes is mediated via a 300-nucleotide sequence element located in the 5'-UTR of XNIF. A subdomain of this element is sufficient to drive transport to the vegetal cortex but is not sufficient to mediate accumulation in the mitochondrial cloud. Co-immunoprecipitation assays, as well as UV cross-linking, reveal a protein-binding pattern that is overlapping, but not identical, with the one obtained for the localization element of the late pathway mRNA encoding Vg1.
| Materials and methods |
|---|
|
|
|---|
ZAP cDNA library according to the
manufacturer's protocols (Stratagene).
Preparation of antisense RNA probes and whole-mount in-situ hybridization
For the in-situ hybridization-based screening, the phage cDNA library was
subjected to a mass excision in BM25.8 cells (according to the Clontech
protocol) and single bacterial colonies were then picked and grown in 100
µl LB medium in microtiter plates. These bacterial suspensions served as
templates for insert amplification by PCR using the following vector-specific
primers: 5'
TriplEx2-LD, CTCGGGAAGCGCGCCATTGTGTTGGT and
3'
TriplEx2Seq, TAATACGACTCACTATAGGGC. These PCR products then
served as templates for the subsequent in-vitro transcription of labeled
whole-mount in-situ antisense probes
(Hollemann et al., 1999
).
Alternatively, the antisense transcripts were generated from linearized
plasmids containing either the full-length sequence or fragments of the
corresponding cDNAs. Whole-mount in-situ hybridizations were in principle
carried out as described (Harland,
1991
; Hollemann et al.,
1999
). After the color reaction, the specimens were photographed
using a digital video imaging system. For sections, whole-mount in-situ
stained oocytes were embedded in gelatine/albumine, and vibratome sections of
10-30 µm were done.
Cloning procedures
For localization element mapping experiments the vector pBK-CMV
(Stratagene) was used for subcloning different subfragments of the XNIF cDNA
sequences. For the detection of injected RNAs all constructs contain a 320 nt
fragment of the open reading frame of the bacterial lacZ gene, which has been
amplified from the pAX4a plasmid
(Markmeyer et al., 1990
) with
the following primers: forward primer
5'-TTGGCGCGCATGATTACGGATTCACTGGCCG; reverse primer
5'-CGGGATCCGACCGTAATGGGATAGGTTACG and inserted into BssHII- and
BamHI-sites of the corresponding pBKCMV plasmid (pBK-CMV-lacZ).
Similarly, a fragment spanning the XNIF-ORF was cloned into a pGEM-T-plasmid,
which also contained the 320 nt lacZ-fragment. Subfragments of the XNIF cDNA
were generated by PCR and ligated into BamHI/XhoI sites of
the pBKCMV-lacZ. The Vg1-LE was amplified with the following PCR primers from
a cDNA clone of the vegetal cortex library that contains the 3'-UTR of
Vg1-LE in addition to a fragment of the coding region:
5'-CGGGATCCTATTTCTACTTTATTTCTACACTG and
5'-CCGCTCGAGCAAGTCATATGGACTATTATATAT and ligated into
BamHI/XhoI sites of the pBK-CMV-lacZ.
For co-immunoprecipitation experiments, the proteins had to be produced by
in-vitro translation and required an epitope tag for the immobilization to the
protein G sepharose. In order to obtain an in-vitro translatable myc-tagged
version of the Vg1RBP protein, a NcoI/XhoI fragment of the
corresponding Vg1RBP cDNA in pET21a+ vector
(Havin et al., 1998
) was
subcloned into the pCS2+MT vector (Rupp et
al., 1994
). For the in-vitro translation of Prrp, we used the
pMT-21 plasmid, which contains the Prrp coding sequence fused to a repeated
myc epitope tag at its C-terminus (Zhao et
al., 2001
). For the in-vitro translation of VgRBP 71/KSRP, the
corresponding coding sequence was cut out with NdeI and XhoI
from the pET23a-KSRP vector (a kind gift from Paul W. Huber), overhanging ends
were filled in by Klenow polymerase and ligated into the XhoI
linearized and filled in pCS2+MT. The poly-myc-tagged ribosomal protein L5
served as a negative control in this study
(Claussen et al., 1999
).
Synthesis, injection and detection of lacZ-tagged RNA constructs
Capped RNAs for injection into Xenopus oocytes were prepared by
in-vitro transcription using the T3 or T7 mESSAGE mMACHINE kit (Ambion)
according to the manufacturer's instructions. Oocytes were obtained from
albino female Xenopus laevis and staged either by visual inspection
or by using nylon sieves with different mesh sizes. Injections were performed
using an Eppendorf Transjector 5246 injection system. Depending on the oocyte
size, 0.05-0.1 ng RNA in a 0.5-1 nl volume were injected into the nuclei.
Injected oocytes were incubated at 18°C for 2-3 days in
vitellogenin-enriched L-15 culture medium as described previously
(Wallace et al., 1980
;
Yisraeli and Melton, 1988
).
Frog vitellogenin was prepared as described in Kloc and Etkin
(1999
). Injected RNAs were
detected by whole-mount in-situ hybridization using a digoxygenin-labeled lacZ
antisense probe.
UV cross-linking assays and co-immunoprecipitation experiments
For the preparation of Xenopus oocyte S100 extracts,
collagenase-treated oocytes (stage I-IV) were homogenized on ice with syringe
needles of different sizes in an equal volume of S100 buffer (50 mM Tris/HCl,
pH 8.0; 50 mM KCl; 0.1 M EDTA; 25% w/v glycerol; protease inhibitors). After a
15 minute centrifugation in a tabletop cooling centrifuge (1900
g), the supernatant was centrifuged for 2 hours at 10,0000
g in a Beckmann ultracentrifuge. The protein concentration was
measured by the Bradford method and aliquots were frozen in liquid nitrogen
and stored at -70°C until use. The S100 extracts were typically 10-15
mg/ml in total protein. Radioactively labeled RNA probes were synthesized by
in-vitro transcription using the Stratagene T3 or T7 in-vitro transcription
Kit, according to the standard reaction protocol. For each labeling reaction 5
µl of 20 µCi/µl [
32P]UTP (Amersham Biosciences)
were used. Unincorporated nucleotides were removed either by MicroSpin G-50
columns (Amersham Biosciences) or by using RNeasy mini columns (Qiagen).
In-vitro UV cross-linking reactions were performed based on the protocol
described in Mowry (1996
) and
contained 5 mg/ml heparin, 1% glycerol, 50 mM KCl, 10 mM DTT, 5.2 mM HEPES [pH
7.9], 40 µg/ml yeast tRNA as competitor, different specific competitor RNAs
(2.25-2.5 µg) and 25% S100 oocyte total protein extract in an end volume of
10 µl. The in-vitro binding reactions were pre-incubated for 10 minutes at
room temperature prior to adding the radioactively labeled RNA transcripts
(
0.2 µg). After 10 minutes incubation at room temperature, RNAs were
UV-irradiated for 10 minutes at room temperature in a Stratalinker
(Stratagene) with a 9 cm distance from the bottom of the reaction tube to the
UV bulbs. Afterward 1 µl RNAse A (1 mg/ml) and 1 µl RNAse T1 (10,000
U/ml) were added and incubated for 15 minutes at 37°C. The cross-linked
proteins were separated by SDS-PAGE (10% gels) and analyzed by phospho-imaging
(Molecular Dynamics).
For the co-immunoprecipitation experiments, myc-tagged Vg1RBP, Prrp, VgRBP71 and L5 were in-vitro translated using the TNT coupled transcription and translation system (Promega). Then 1 µl containing 200,000-250,000 cpm of the appropriate 32P-labeled RNAs as well as 2 µl of 5xUV cross-linking mix as described above, were added to a 12.5 µl TNT reaction and adjusted to a total volume of 20 µl and incubated for 1 hour at 20°C. Afterward the binding reactions were transferred onto an anti-myc-immunopellet in 400 µl NET 2 buffer (50 mM Tris/HCl, pH 7.4; 150 mM NaCl; 0.05% NP40; protease inhibitors). For preparation of anti-myc-immunopellets, 15 µl of protein G sepharose (Amersham Biosciences) and 1 µl of a monoclonal anti-c-myc antibody M5546 (Sigma) per pellet were used. Immunoprecipitations were incubated with rotation for 1 hour at 20°C. The supernatant (20 µl) containing unbound RNA was phenol/chloroform extracted and analyzed on a denaturing PA-gel. The pellets were washed three times with NET 2 and after adding 200 µl NET 2 containing 1% SDS the bound RNA was phenol/chloroform extracted, precipitated and analyzed by denaturing urea PAGE (6-8%) and phospho-imaging.
| Results |
|---|
|
|
|---|
|
|
The 5'-UTR of the XNIF transcript contains an RNA localization sequence
To identify and delineate the signals responsible for the vegetal transport
of the XNIF transcript, microinjection experiments were performed. For this
purpose, different subfragments of the XNIF RNA were cloned behind a
320-nucleotide lacZ reporter sequence. In-vitro transcribed capped RNA
generated from these constructs was then injected into the nuclei of stage
II-III oocytes and the localization was detected by whole-mount in-situ
hybridization using a lacZ-specific antisense probe. Localization was evident
from preferential staining in the vegetal half of injected oocytes; failure to
localize resulted in diffuse, ubiquitous staining. Full-length XNIF fused to
the lacZ tag localized efficiently to the vegetal pole of the injected oocytes
(data not shown). In a first attempt to define the position of the
localization element within the XNIF transcript, fragments containing either
the 5'-UTR, the open reading frame or the 3'-UTR were tested for
localization. Whereas the open reading frame as well as the 3'-UTR
become dispersed throughout the oocyte, the RNA that includes the 5'-UTR
is capable of mediating efficient localization to the vegetal cortex
(Fig. 3A,B,F).
|
The vegetal localization element of the XNIF transcript is sufficient to mediate enrichment of the transcript to the mitochondrial cloud in stage I oocytes
It has previously been reported that early pathway RNAs, such as Xlsirts,
Xcat2 and Xpat, are transported to the vegetal pole after injection into stage
III and early stage IV oocytes, and that the localization achieved in such
experiments resembles the characteristically broader distribution of late
pathway RNAs (Hudson and Woodland,
1998
; Kloc et al.,
1993
; Zhou and King,
1996b
). Therefore, it seems possible that early pathway RNAs are
also capable of being transported along the late localization pathway in later
stages of oogenesis, when the corresponding endogenous transcripts have
already reached their destination via the early pathway. Since it is difficult
to distinguish if the RNAs shown in Fig.
3 followed the early or the late pathway, the RNA constructs that
mediate an efficient vegetal transport in stage II-III oocytes (nt 252-551, nt
252-381) were also tested for their accumulation in the mitochondrial cloud
after injection into stage I oocytes, which is a characteristic feature of
early pathway RNAs. As can be seen in Fig.
4A, the transcript containing nt 252-551 of the XNIF cDNA showed
an enrichment in the mitochondrial cloud after injection into stage I oocytes
and also revealed vegetal localization after injection into later stage
oocytes (Fig. 4F). However, the
nt 252-381-containing element, even though it localized efficiently to the
vegetal cortex in stage III oocytes, showed a homogeneous distribution after
injection into stage I oocytes and was not found to be enriched in the
mitochondrial cloud (Fig.
4B,G). An RNA construct that comprised the second half of the nt
252-551 XNIF-LE (nt 415-551) localized neither in early-nor in late-stage
oocytes (Fig. 4C,H). In
comparison, the 3'-UTR of XNIF, which bore no localizing activity, was
not enriched in the mitochondrial cloud and was not localized in later stage
oocytes (Fig. 4E,J). Visual
inspection of the 300 nt region containing the XNIF localization element
revealed a significant enrichment in CAC-containing repeats, which have been
claimed to characterize the localization elements of the majority of RNAs
localizing to the vegetal cortex in Xenopus oocytes, suggesting that
these may also play a role in the localization of XNIF RNA (CAC-containing
repeats are highlighted in Fig.
4K) (Betley et al.,
2002
). However, a critical number of CAC-containing motifs alone
seems not to be sufficient for vegetal localization in stage III oocytes,
since both elements exhibited comparable numbers of CAC-containing sequence
elements (Fig. 4G,H,K).
Interestingly, by contrast to an RNA construct containing one copy of nt
252-381, the same element duplicated in tandem repeat was found to be enriched
in the mitochondrial cloud and also showed vegetal localization in later stage
oocytes (Fig. 4D,I). Thus, our
findings support the idea that, in contrast to vegetal localization per se,
accumulation in the mitochondrial cloud may require a critical number of
CAC-containing repeats (Fig.
4A,B,D).
|
|
33, 36, 40, 69 and 78 kDa, as well
the 190-kDa protein that has not been described before
(Fig. 5, lanes 15, 16, 17). The
previously described 60-kDa protein (VgRBP60) migrated close to the very
abundant p54/p56 proteins and is not visible here
(Cote et al., 1999To investigate whether the 69- and 78-kDa proteins, which interact with XNIF-LE as well as with Vg1LE, are identical, cross-competition experiments have been performed. An access of Vg1LE competitor RNA competed with XNIF-LE for the binding of the 69- and 78-, as well as the 190-, kDa proteins, whereas no cross-competition could be observed for the 62- and 64-kDa proteins, which specifically bind to the XNIF-LE (Fig. 5, lane 6). UV cross-linking experiments were performed with these RNAs to analyze whether the different transport capacities of the nt 252-381 XNIF subelement, which localized only in later stage oocytes, and the tandem repeat of this element, which regained the ability to localize to the mitochondrial cloud, were reflected by differential protein-binding activities. Both these RNAs bound to the 62- and 64-kDa proteins, as well as to the 69- and 78-kDa proteins, although with an overall weaker binding activity compared with the XNIF-LE (Fig. 5, lanes 9, 10 and 11 for nt 252-381 and lanes 12, 13 and 14 for the nt 252-381 tandem repeat). A very weak interaction with the 190-kDa protein could be observed only for the nt 252-381 tandem repeat (Fig. 5, lane 13). In cross-competition experiments, both RNAs nt 252-381 and nt 252-381tr competed with XNIF-LE for the binding of the 62- and 64-kDa proteins and the 69- and 78-kDa proteins (Fig. 5, lanes 7 and 8).
We conclude that XNIF-LE seems to bind to at least some of the previously described Vg1RBPs (p69/Vg1RBP and 78 kDa), but that it interacts also with additional proteins that do not bind to the Vg1-LE (62 and 64 kDa) and that may therefore correspond to proteins specifically involved in localization or anchoring of early pathway RNAs.
Binding of the XNIF localization element to specific proteins
Since the binding pattern of the early localizing XNIF-LE observed in the
UV cross-linking studies differed from the one observed with the late
localizing Vg1-LE, we wanted to test if this was also reflected by different
binding preferences for known Vg1-LE-binding proteins in
co-immunoprecipitation analyses, where Vg1RBP, Prrp and Vg1RBP71/KSRP were
tested. The ribosomal protein L5 is a 5S rRNA-binding protein serving as a
negative control here. RNA fragments that comprise nt 252-551 of the XNIF cDNA
and that show localizing activity in both early and late stage oocytes
(XNIFLE), as well as the Vg1-LE, were radioactively labeled by invitro
transcription. Due to their prior use in the injection experiments, these
constructs also contained the lacZ tag sequence. The lacZ tag alone as a
nonlocalizing RNA should not bind to LE-interacting factors and therefore
served as a negative control. The proteins all contained an N- or C-terminally
located poly-myc-epitope-tag, were produced by invitro transcription and
translation in the coupled reticulocyte lysate system TNT and were
incubated with labeled RNAs to allow complex formation. RNA/protein complexes
were immunoprecipitated with an immobilized anti-myc antibody. As can be seen
in Fig. 6, the nonlocalizing
lacZ RNA was mainly found in the supernatant of the binding reaction and
showed only background binding in the pellet fractions. By contrast, the
XNIF-LE exhibited a strong interaction with Vg1RBP, as was to be expected from
the cross-linking data, and also a significant, albeit weaker binding to Prrp.
No interaction above background could be observed with VgRBP71, as well as
with the 5S rRNA-binding protein L5. Similar but reduced binding activities
were observed for XNIF-nt 252-381, which exhibited transport activities only
in stage III oocytes. The transcript that contained XNIF nt 252-381 in a
tandem repeat, and which was capable of localizing also to the mitochondrial
cloud in stage I oocytes, showed an increased binding to Vg1RBP comparable to
the XNIF-LE. Vg1-LE also competed with XNIF-LE for Prrp binding (data not
shown). By contrast, the Vg1-LE showed a strong interaction with Prrp, while
it was not found to interact with Vg1RBP, VgRBP71 or L5 under the experimental
conditions employed here.
|
| Discussion |
|---|
|
|
|---|
200 amino acids. Most NIF family members
have been identified through genome-sequencing projects. Chromosomal regions
containing genes that encode human homologs of XNIF have been described as
deleted or amplified in a variety of human tumors, but the exact biological
function of these proteins remains elusive
(Ishikawa et al., 1997
Localized RNAs are classified as belonging to either the early or late
localization pathway. Based on the observation that XNIF mRNA localizes to the
mitochondrial cloud in stage I oocytes and is restricted to a discrete region
of the vegetal cortex in late stage oocytes, it is assigned to the early
localization pathway. Mapping analysis revealed that vegetal transport is
mediated by a localization signal that resides in the 5'-UTR of XNIF
mRNA. A 300 nt region of XNIF RNA is sufficient to mediate the accumulation of
a heterologous RNA (lacZ tag) to the mitochondrial cloud in stage I oocytes.
This is a remarkable feature, since in almost all localized RNAs analyzed to
date, the transport signals have been found to reside within the 3'-UTR
(reviewed by Palacios and Johnston,
2001
). Proteins required for the enrichment in the mitochondrial
cloud/vegetal transport may also participate in recruiting factors to
5'-UTR, which may be involved in translational repression during the
transport process (Wilkie et al.,
2003
).
It has previously been reported that different early pathway RNAs are also
capable to localize via the late localization pathway after injection into
stage III oocytes, and that the localization achieved then resembles the one
of a late pathway RNA (Hudson and
Woodland, 1998
; Kloc et al.,
1993
; Zhou and King,
1996b
). Mapping analysis with Xcat2 mRNA showed that signals that
mediate these localizing activities partially overlap (Zhou and King,
1996a
,
1996b
). In mapping experiments
with XNIF, a 130 nt sequence element (nt 252-381) turned out to be sufficient
to mediate vegetal localization in stage III oocytes, but failed to mediate
the early pathway specific enrichment in the mitochondrial cloud; by contrast,
a larger fragment, including this minimal element (nt 252-551), exhibited
localizing activity in both early and late stage oocytes. We also observed
that a duplication of this minimal localization element gained the ability to
localize to the mitochondrial cloud. Interestingly, a comparable situation has
been described for the late localizing Vg1-LE, where a duplication of the
5' subelement (containing a VM1 motif) gains vegetal localization
activity in late stage oocytes (Gautreau et
al., 1997
).
A recent publication (Betley et al.,
2002
) describes the existence of a conserved consensus signal for
RNA localization in chordates. Based on the observation that short nt repeats
are important for vegetal localization, a computer program called REPFIND was
developed, which helps to identify repeat motifs in RNA. Using this program
(http://zlab.bu.edu/repfind)
it was shown that clusters of short CAC-containing motifs can be found in the
localization elements of virtually all early and late localizing mRNAs
investigated. Searches for CAC-containing sequence motifs in the 300 nt LE of
XNIF revealed a total number of 16 such elements. Subfragments of this
localization element (nt 252-381 and nt 415-551) contain a reduced number of
CAC-containing repeats and loose their ability to localize to the
mitochondrial cloud. However, as stated above, a duplication of nt 252-381,
resulting in a total number of CAC-containing repeats comparable to the 300 nt
XNIF mitochondrial cloud localization element, regains localization to the
mitochondrial cloud, indicating that a critical number of CAC-containing
repeats may indeed be required for mitochondrial cloud localization. Different
types of CAC-containing repeats have also been discussed as being critical in
localizing RNAs of the late localization pathway
(Betley et al., 2002
;
Bubunenko et al., 2002
; Deshler
et al., 1997
,
1998
;
Havin et al., 1998
;
Kwon et al., 2002
). However,
CAC-containing repeats alone seem not to be sufficient for localization of
XNIF in later stages of oogenesis. Although both subfragments of the 300 nt
XNIF-LE (nt 252-381 and nt 415-551) contain comparable numbers of CAC-motifs,
only one (nt 252-381) mediates localization in late stage oocytes, indicating
that there may be other structural features required for the late transport
process.
UV cross-linking analysis reveals at least five proteins (62, 64, 69, 75
and 190 kDa) that interact with the localization element of XNIF. Two of
these, namely the 62- and 64-kDa proteins, seem to be specific for the XNIF-LE
and were not observed in UV cross-links with the LE of the late pathway Vg1
mRNA. Therefore, these define candidate proteins with a specific function in
the early localization pathway. The UV cross-linking pattern of the XNIF-LE
differs from the one of Vg1-LE in revealing only weak or no interaction with
the low molecular weight VgRBPs (33, 36 and 40 kDa, respectively). It is
interesting to note that the protein-binding properties of the 252-381 element
are virtually indistinguishable from those of its tandem repeat or of the
entire XNIF-LE, even though the 252-381 element by itself is not capable of
traveling via the early pathway in association with the mitochondrial cloud
while still making use of the late pathway. These observations seem to have
two implications. Firstly, they reemphasize the considerable overlap in
respect to the protein machineries that appear to be involved in both of the
vegetal transport routes. Secondly, they suggest that a higher order
structure, with perhaps multiple copies of a basic RNP module, is required for
association with the mitochondrial cloud in the context of the early
localization pathway. Since UV cross-linking patterns give only information on
the approximate size of interacting proteins, we also tested whether the known
Vg1-LE-interacting proteins, Vg1RBP, Prrp and VgRBP71, bind to the XNIF-LE.
Co-immunoprecipitation analysis revealed a very strong interaction of Vg1RBP
with XNIF-LE, as was to be expected from the UV cross-linking experiments. The
XNIF-LE also contains two copies of the previously defined E2-element (UUCAC),
which has been shown to serve as binding site for Vg1RBP
(Kwon et al., 2002
). A
specific but weaker interaction can also be observed with Prrp, which also
strongly interacts with the Vg1-LE under these conditions.
As protein binding to early localization pathway elements has previously not been analyzed in detail, our results obtained from UV cross-linking studies and co-immunoprecipitation assays identify candidate protein factors for transport along the early pathway. Identification of the 62- and 64-kDa proteins, which specifically cross-link to the XNIF-LE, will provide further insight in the protein machinery involved in the localization of early pathway RNAs.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and Lipman, D. J. (1990). Basic local alignment search tool. J. Mol. Biol. 215,403 -410.[CrossRef][Medline]
Betley, J. N., Frith, M. C., Graber, J. H., Choo, S. and Deshler, J. O. (2002). A ubiquitous and conserved signal for RNA localization in chordates. Curr. Biol. 12,1756 -1761.[CrossRef][Medline]
Bubunenko, M., Kress, T. L., Vempati, U. D., Mowry, K. L. and King, M. L. (2002). A consensus RNA signal that directs germ layer determinants to the vegetal cortex of Xenopus oocytes. Dev. Biol. 248,82 -92.[CrossRef][Medline]
Chan, A. P., Kloc, M. and Etkin, L. D. (1999). fatvg encodes a new localized RNA that uses a 25-nucleotide element (FVLE1) to localize to the vegetal cortex of Xenopus oocytes. Development 126,4943 -4953.[Abstract]
Claussen, M., Rudt, F. and Pieler, T. (1999).
Functional modules in ribosomal protein L5 for ribonucleoprotein complex
formation and nucleocytoplasmic transport. J. Biol.
Chem. 274,33951
-33958.
Cote, C. A., Gautreau, D., Denegre, J. M., Kress, T. L., Terry, N. A. and Mowry, K. L. (1999). A Xenopus protein related to hnRNP I has a role in cytoplasmic RNA localization. Mol. Cell 4,431 -437.[CrossRef][Medline]
Deshler, J. O., Highett, M. I., Abramson, T. and Schnapp, B. J. (1998). A highly conserved RNA-binding protein for cytoplasmic mRNA localization in vertebrates. Curr. Biol. 8,489 -496.[CrossRef][Medline]
Deshler, J. O., Highett, M. I. and Schnapp, B. J.
(1997). Localization of Xenopus Vg1 mRNA by Vera protein and the
endoplasmic reticulum. Science
276,1128
-1131.
Gautreau, D., Cote, C. A. and Mowry, K. L. (1997). Two copies of a subelement from the Vg1 RNA localization sequence are sufficient to direct vegetal localization in Xenopus oocytes. Development 124,5013 -5020.[Abstract]
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36,685 -695.[Medline]
Havin, L., Git, A., Elisha, Z., Oberman, F., Yaniv, K.,
Schwartz, S. P., Standart, N. and Yisraeli, J. K. (1998).
RNA-binding protein conserved in both microtubule- and microfilament-based RNA
localization. Genes Dev.
12,1593
-1598.
Hollemann, T., Panitz, F. and Pieler, T. (1999). In situ hybridization techniques with Xenopus embryos. In A Comparative Methods Approach to the Study of Oocytes and Embryos (ed. J. D. Richter), pp.279 -290. Oxford, UK: Oxford University Press.
Hudson, C. and Woodland, H. R. (1998). Xpat, a gene expressed specifically in germ plasm and primordial germ cells of Xenopus laevis. Mech. Dev. 73,159 -168.[CrossRef][Medline]
Ishikawa, S., Kai, M., Tamari, M., Takei, Y., Takeuchi, K., Bandou, H., Yamane, Y., Ogawa, M. and Nakamura, Y. (1997). Sequence analysis of a 685-kb genomic region on chromosome 3p22-p21.3 that is homozygously deleted in a lung carcinoma cell line. DNA Res. 4,35 -43.[Abstract]
Kloc, M. and Etkin, L. D. (1999). Analysis of localized RNAs in Xenopus oocytes. In A Comparative Methods Approach to the Study of Oocytes and Embryos (ed. J. D. Richter), pp. 256-278. Oxford, UK: Oxford University Press.
Kloc, M., Bilinski, S., Chan, A. P., Allen, L. H., Zearfoss, N. R. and Etkin, L. D. (2001). RNA localization and germ cell determination in Xenopus. Int. Rev. Cytol. 203, 63-91.[Medline]
Kloc, M., Bilinski, S., Pui-Yee Chan, A. and Etkin, L. D. (2000). The targeting of Xcat2 mRNA to the germinal granules depends on a cis-acting germinal granule localization element within the 3'UTR. Dev. Biol. 217,221 -229.[CrossRef][Medline]
Kloc, M., Spohr, G. and Etkin, L. D. (1993).
Translocation of repetitive RNA sequences with the germ plasm in Xenopus
oocytes. Science 262,1712
-1714.
Kolev, N. G. and Huber, P. W. (2003). VgRBP71 stimulates cleavage at a polyadenylation signal in Vg1 mRNA, resulting in the removal of a cis-acting element that represses translation. Mol. Cell 11,745 -755.[CrossRef][Medline]
Kroll, T. T., Zhao, W. M., Jiang, C. and Huber, P. W. (2002). A homolog of FBP2/KSRP binds to localized mRNAs in Xenopus oocytes. Development 129,5609 -5619.
Kwon, S., Abramson, T., Munro, T. P., John, C. M., Kohrmann, M. and Schnapp, B. J. (2002). UUCAC- and Vera-dependent localization of VegT RNA in Xenopus oocytes. Curr. Biol. 12,558 -564.[CrossRef][Medline]
Marello, K., LaRovere, J. and Sommerville, J.
(1992). Binding of Xenopus oocyte masking proteins to mRNA
sequences. Nucleic Acids Res.
20,5593
-5600.
Markmeyer, P., Ruhlmann, A., Englisch, U. and Cramer, F. (1990). The pAX plasmids: new gene-fusion vectors for sequencing, mutagenesis and expression of proteins in Escherichia coli. Gene 93,129 -134.[CrossRef][Medline]
Mowry, K. L. (1996). Complex formation between
stage-specific oocyte factors and a Xenopus mRNA localization element.
Proc. Natl. Acad. Sci. USA
93,14608
-14613.
Mowry, K. L. and Melton, D. A. (1992). Vegetal
messenger RNA localization directed by a 340-nt RNA sequence element in
Xenopus oocytes. Science
255,991
-994.
Palacios, I. M. and Johnston, D. S. (2001). Getting the message across: the intracellular localization of mRNAs in higher eukaryotes. Annu. Rev. Cell Dev. Biol. 17,569 -614.[CrossRef][Medline]
Protopopov, A., Kashuba, V., Zabarovska, V. I., Muravenko, O.
V., Lerman, M. I., Klein, G. and Zabarovsky, E. R. (2003). An
integrated physical and gene map of the 3.5-Mb chromosome 3p21.3 (AP20) region
implicated in major human epithelial malignancies. Cancer
Res. 63,404
-412.
Rand, K. and Yisraeli, J. (2001). RNA localization in Xenopus oocytes. In Result and Problems in Cell Differentiation, Vol. 34 (ed. D. Richter), pp. 157-173. Berlin: Springer-Verlag.
Rupp, R. A., Snider, L. and Weintraub, H.
(1994). Xenopus embryos regulate the nuclear localization of
XMyoD. Genes Dev. 8,1311
-1323.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1998). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Satow, R., Chan, T. C. and Asashima, M. (2002). Molecular cloning and characterization of dullard: a novel gene required for neural development. Biochem. Biophys. Res. Commun. 295, 85-91.[CrossRef][Medline]
Su, Y. A., Lee, M. M., Hutter, C. M. and Meltzer, P. S. (1997). Characterization of a highly conserved gene (OS4) amplified with CDK4 in human sarcomas. Oncogene 15,1289 -1294.[CrossRef][Medline]
Wallace, R. A., Misulovin, Z. and Wiley, H. S. (1980). Growth of anuran oocytes in serum-supplemented medium. Reprod. Nutr. Dev. 20,699 -708.
Weeks, D. L. and Melton, D. A. (1987). A maternal mRNA localized to the vegetal hemisphere in Xenopus eggs codes for a growth factor related to TGF-beta. Cell 51,861 -867.[CrossRef][Medline]
Wessely, O. and De Robertis, E. M. (2000). The Xenopus homologue of Bicaudal-C is a localized maternal mRNA that can induce endoderm formation. Development 127,2053 -2062.[Abstract]
Wilkie, G. S., Dickson, K. S. and Gray, N. K. (2003). Regulation of mRNA translation by 5'- and 3'-UTR-binding factors. Trends Biochem. Sci. 28,182 -188.[CrossRef][Medline]
Yaniv, K. and Yisraeli, J. K. (2001). Defining cis-acting elements and transacting factors in RNA localization. Int. Rev. Cytol. 203,521 -539.[Medline]
Yisraeli, J. K. and Melton, D. A. (1988). The material mRNA Vg1 is correctly localized following injection into Xenopus oocytes. Nature 336,592 -595.[CrossRef][Medline]
Zhang, J. and King, M. L. (1996). Xenopus VegT RNA is localized to the vegetal cortex during oogenesis and encodes a novel T-box transcription factor involved in mesodermal patterning. Development 122,4119 -4129.[Abstract]
Zhang, J. and King, M. L. (1999). PCR based cloning of cortically localized RNAs from Xenopus oocytes. In Developmental Biology Protocols. Vol.II (ed. R. S. Tuan and C. W. Lo), pp.301 -306. Totowa, N.J.: Humana Press.
Zhao, W. M., Jiang, C., Kroll, T. T. and Huber, P. W. (2001). A proline-rich protein binds to the localization element of Xenopus Vg1 mRNA and to ligands involved in actin polymerization. EMBO J. 20,2315 -2325.[CrossRef][Medline]
Zhou, Y. and King, M. L. (1996a). Localization of Xcat-2 RNA, a putative germ plasm component, to the mitochondrial cloud in Xenopus stage I oocytes. Development 122,2947 -2953.[Abstract]
Zhou, Y. and King, M. L. (1996b). RNA transport to the vegetal cortex of Xenopus oocytes. Dev. Biol. 179,173 -183.[CrossRef][Medline]
Zohn, I. E. and Brivanlou, A. H. (2001). Expression cloning of Xenopus Os4, an evolutionarily conserved gene, which induces mesoderm and dorsal axis. Dev. Biol. 239,118 -131.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
B. Heinrich and J. O. Deshler RNA localization to the Balbiani body in Xenopus oocytes is regulated by the energy state of the cell and is facilitated by kinesin II RNA, April 1, 2009; 15(4): 524 - 536. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Souopgui, B. Rust,, J. Vanhomwegen, J. Heasman, K. A. Henningfeld, E. Bellefroid, and T. Pieler The RNA-binding protein XSeb4R: a positive regulator of VegT mRNA stability and translation that is required for germ layer formation in Xenopus Genes & Dev., September 1, 2008; 22(17): 2347 - 2352. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jambhekar and J. L. DeRisi Cis-acting determinants of asymmetric, cytoplasmic RNA transport RNA, May 1, 2007; 13(5): 625 - 642. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. CZAPLINSKI and I. W. MATTAJ 40LoVe interacts with Vg1RBP/Vera and hnRNP I in binding the Vg1-Localization Element RNA, February 1, 2006; 12(2): 213 - 222. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kloc and L. D. Etkin RNA localization mechanisms in oocytes J. Cell Sci., January 15, 2005; 118(2): 269 - 282. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||