|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 4 August 2004
doi: 10.1242/dev.01304
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Department of Cell Biology and Anatomy, University of Arizona Health Sciences
Center, 1501 North Campbell Avenue, Tucson, AZ 85724-5044, USA
2 Department of Surgery, University of Arizona Health Sciences Center, 1501
North Campbell Avenue, Tucson, AZ 85724-5044, USA
3 Department of Molecular and Cellular Biology, Harvard University, 16 Divinity
Avenue, Cambridge, MA 02138, USA
Author for correspondence (e-mail:
pkrieg{at}email.arizona.edu)
Accepted 9 June 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Vasculogenesis, Tubulogenesis, Endoderm, VEGF, Mouse, Chick
| Introduction |
|---|
|
|
|---|
6 hours,
these angioblasts generate a polygonal network of angioblast cords at the
precise locations of the future endothelial tubes
(Coffin and Poole, 1988
4 hours
(Hirakow and Hiruma, 1981
10 hours, from the first appearance of angioblasts to the creation
of a complex tubular network. Although these morphological processes are not
as completely characterized during murine development, they appear largely
similar to those described in the avian embryo
(Drake and Fleming, 2000
Vasculogenesis occurs at two distinct embryonic locations during
development. In extra-embryonic tissues, angioblasts initially appear in blood
islands in the splanchnic mesoderm adjoining the extra-embryonic endoderm in
the posterior half of the embryo. In contrast to extra-embryonic angioblasts,
which form structures that are closely associated with blood cells,
intra-embryonic angioblasts are only rarely associated with blood cells
(Cormier and Dieterlen-Lièvre,
1988
; Olah et al.,
1988
; Jaffredo et al.,
1998
; Ciau-Uitz et al.,
2000
). In avian embryos, the first intra-embryonic angioblasts,
which form slightly later than the extra-embryonic angioblasts, are visible as
discrete cells at bilateral sites near the headfolds that correspond to the
future endocardium (at two somites), and slightly later at the lateral edges
of the anterior intestinal portal (Coffin
and Poole, 1988
; Sugi and
Markwald, 1996
). Angioblasts subsequently become visible
throughout broad regions of the embryo proper. Although the extra-embryonic
and intra-embryonic vessels will ultimately form a continuous vascular
network, each area develops independently of the other
(Hahn, 1909
;
Miller and McWhorter, 1914
;
Reagan, 1915
). At present, it
is not known if extra and intra-embryonic angioblasts are specified by the
same mechanism, or whether different genetic pathways regulate their
formation.
Although the morphological events underlying vascular cord formation and
endothelial tubulogenesis have been described in some detail, less is known
about the signaling pathways involved in vascular development. One of the most
important signaling molecules involved in early blood vessel development is
vascular endothelial growth factor A (hereafter VEGF), which acts through its
high-affinity receptor VEGFR2 (FLK1/KDR). VEGF activity is essential for the
formation of blood vessels, and embryos lacking either VEGF or VEGFR2 develop
few (or no) angioblasts and die early in development
(Shalaby et al., 1995
;
Carmeliet et al., 1996
;
Ferrara et al., 1996
). In
various contexts, VEGF has been shown to act as a potent mitogen
(Keyt et al., 1996
;
Wilting et al., 1996
;
Park et al., 1993
),
chemoattractant (Waltenberger et al.,
1994
; Cleaver and Krieg,
1998
; Ash and Overbeek,
2000
) and survival factor
(Gerber et al., 1998a
;
Gerber et al., 1998b
).
Additionally, the proper regulation of VEGF is crucial for the formation of
normal endothelial channels (Fong et al.,
1995
; Fong et al.,
1999
; Drake et al.,
2000
). Fibroblast growth factors (FGFs) have also been implicated
as proliferative agents during vascular development; however, the large number
of FGF ligands, and the early lethality of knockout embryos have impeded
research into the developmental roles of individual family members
(Javerzat et al., 2002
).
During subsequent vascular development, additional molecules are important for
promoting the maturation of specified endothelial cells into a patent vascular
system, for conferring arterial or venous identity, and for recruitment of the
vascular smooth muscle layer of blood vessels (for reviews, see
Lawson and Weinstein, 2002
;
Vokes and Krieg, 2002b
).
However, although known signaling pathways are essentially linked to
endothelial cell specification and proliferation, the specific signaling
pathways required for vascular tubulogenesis have not been identified
(Hogan and Kolodziej, 2002
;
Lubarsky and Krasnow,
2003
).
Within the embryo, the initial specification of angioblasts in the mesoderm
is independent of tissue interactions with other germ layers
(Vokes and Krieg, 2002a
).
However, the first blood vessels within the embryo always form in mesoderm
that is in close proximity to endoderm
(Mato et al., 1964
;
Wilt, 1965
;
Gonzalez-Crussi, 1971
;
Mobbs and McMillan, 1979
;
Meier, 1980
;
Kessel and Fabian, 1985
;
Pardanaud et al., 1989
).
Furthermore, we have recently demonstrated that a signal originating from the
endoderm is essential for the assembly of angioblasts into tubes
(Vokes and Krieg, 2002a
). We
present evidence that sonic hedgehog (SHH) signaling by the vasculogenic
endoderm plays a central role in organizing specified angioblasts into
vascular tubes. SHH is the first growth factor identified that specifically
regulates vascular tube formation.
| Materials and methods |
|---|
|
|
|---|
) at 0.3 µg/ml and PECAM
(PharMingen Mec 13.3) at 0.5 µg/ml. Embryos were then incubated with
biotinylated anti-rat secondary at 0.25 µg/ml (Vector Laboratories) and ABC
reagent (Vector Laboratories). Staining was visualized with diaminobenzidine
(DAB) substrate. After viewing and imaging stained embryos as wholemounts,
they were embedded in paraffin wax and sectioned at 10 µm.
Embryology
Avian embryos were staged according to Hamburger and Hamilton
(Hamburger and Hamilton,
1951
). Stage 5 (late gastrula) quail embryos (unless otherwise
specified) were placed on plastic rings and endoderm was removed from one half
of the embryo using tungsten needles. No enzymatic treatment was used with
stage 5 embryos, but older embryos were dissected in media containing 0.01%
trypsin, which was subsequently inactivated with 0.02% trypsin inhibitor.
Embryos were then incubated as New Cultures
(New, 1955
) at 37°C until
the appropriate stage (usually 7-8 somites) (see
Fig. 1A,B). When necessary,
heparin acrylic beads (Sigma) were implanted immediately after endoderm
removal. In these experiments, heparin beads were rinsed in PBS and soaked for
1 hour or more in the appropriate concentration of growth factor, on ice. The
beads were then briefly rinsed in PBS before being implanted in embryos. For
Hedgehog inhibition experiments, embryos at 1-2 somites were incubated as New
cultures immersed in DMEM containing 0.5% ethanol and 100 µm cyclopamine
(Toronto Research Chemicals) or DMEM containing 0.5% ethanol for controls and
incubated at 37°C in 95% oxygen until approximately the eight-somite
stage. Mouse embryos were harvested between E8 and E8.5, and were a
combination of 129/SvJ outbred with Swiss Webster.
|
RT-PCR
Chick embryos at the five-somite stage were placed on New Culture rings and
submerged in 0.01% trypsin. To obtain endodermal tissue, the intra-embryonic
endoderm was removed from both halves of the embryo using tungsten needles.
Mesodermal tissue samples were obtained by then stripping the exposed somites
and lateral plate mesoderm from the ectoderm. The notochord was excluded from
this sample. Total RNA was extracted from these tissues, and from whole chick
embryos using TRIzol® (Invitrogen). For cultured cells, total RNA was
isolated using guanidinium isothiocyanate
(Chomczynski and Sacchi, 1987
).
Precipitated RNA was treated with DNAse to remove residual genomic DNA and
phenol-chloroform extracted prior to the generating cDNA. The number of cycles
for each primer pair was empirically determined to be in the linear range of
amplification.
Primers
Chick embryos
GAPDH, (forward) 5'CAGGTGCTGAGTATGTTGTGGAGTC3' and (reverse)
5'TCTTCTGTGTGGCTGTGATGGC3' (Tm=62°C); SHH, (forward)
5'ATCTCGGTGATGAACCAGTGGC3' and (reverse)
5'TTTGACGGAGCAGTGGATGTGC3' (Tm=58°C); VEGFA (core sequence
common to all isoforms), (forward) 5'CAAATTCCTGGAAGTCTACGAACG3'
and (reverse) 5'AATTCTTGCGATCTCCATCGTG3' (Tm=62°C).
Mouse cell lines
GAPDH, (forward) 5'CAGTATGACTCCACTCACGG3' and (reverse)
5'GTGAAGACACCAGTAGACTCC3' (166 bp); patched 1, (forward)
5'CTGCTGCTATCCATCAGCGT3' and (reverse)
5'AAGAAGGATAAGAGGACAGG3'; smoothened, (forward)
5'GTGATGATGAGCCCAAGAGA3' and (reverse)
5'AGGGGCAGAGTGGTGAAGC3' (422 bp); VEGFR2, (forward)
5'GCCCTGAGTCCTCAGGAC3' and (reverse)
5'GGGTCTCCACGCAGAACC3' (344 bp).
VEGFA (three PCR product are produced by these primers [766bp
(VEGF188), 644bp (VEGF165) and 512bp
(VEGF120)], (forward) 5'GCGGGCTGCCTCGCAGTC3' and
(reverse) 5'TCACCGCCTTGGCTTGTCAC3'
(Marti and Risau, 1998
).
| Results |
|---|
|
|
|---|
8 hours later, at the eight-somite stage
(Fig. 1B), no vascular tubes
were observed on the side lacking endoderm, although abundant unassembled
angioblasts were present (12/12 embryos;
Fig. 1D). By contrast, the
unmanipulated control side showed the presence of an extensive network of
tubular vessels (Fig. 1C). We
conclude from this experiment that the endodermal signal is acting immediately
prior to, or during, vascular tube formation.
Shh is expressed in endoderm at the time of tube formation
The signaling factors that may be required for blood vessel tubulogenesis
are currently unknown. Therefore, we used an RT-PCR approach to examine the
expression of candidate growth factors in both the mesodermal and endodermal
layers of chick embryos at the time when tube formation commences (five
somites). Tissue samples were limited to the intraembryonic region of the
embryo, and did not include axial tissues, which express high levels of many
different growth factors. Of the growth factor sequences examined, only
Shh was present in the endoderm and absent from the mesoderm
(Fig. 2A; data not shown).
Sequences corresponding to Indian hedgehog (IHH) were not detected at
significant levels in either the mesodermal or endodermal tissue samples at
this stage (data not shown), and the chick ortholog of Desert hedgehog has not
yet been reported. Transcripts encoding the essential vasculogenic growth
factor, VEGF were also detected in the endoderm, but were present in the
mesoderm in higher amounts (Fig.
2A).
|
Inhibition of hedgehog signaling leads to disruption of vascular assembly
To determine whether Hedgehog signaling may play a role in regulating
embryonic vasculogenesis, quail embryos were treated with cyclopamine, a
highly specific inhibitor of SMO
(Incardona et al., 1998
;
Taipale et al., 2000
;
Chen et al., 2002
), from the
two-somite until the eight-somite stage. This is the period during which most
vascular tubulogenesis occurs in the untreated embryo
(Hirakow and Hiruma, 1983
).
Analysis of blood vessel formation by QH1 immunofluorescence showed that all
embryos treated with 100 µM cyclopamine exhibited vascular abnormalities
(13/13). These alterations ranged from the presence of small, interrupted
tubes, with a corresponding increase in unassembled clusters of angioblasts,
to instances where virtually no discernible tubular structures were detected
(Fig. 3B). In the latter case,
angioblasts remained abundant and were located in the regions where blood
vessel formation would normally occur. By contrast, vascular development was
mostly normal in control embryos treated with carrier solution alone
(Fig. 3A). Defects were
observed in a small proportion of carrier treated embryos (2/9), but the
extent of abnormalities observed, and the proportion of embryos showing
defects, was similar to that observed in unmanipulated embryos maintained
under New Culture conditions (data not shown). These experiments demonstrate
that inhibiting hedgehog signaling prevents angioblasts from undergoing normal
vascular assembly and tube formation.
|
|
|
|
| Discussion |
|---|
|
|
|---|
Collectively, our findings provide compelling evidence in birds and mammals
that SHH, which is produced by the endoderm, is an important regulator of
vascular tube formation from specified angioblasts. This conclusion is
strengthened by several previous reports that also implicate SHH signaling in
vascular tube formation. Murine embryoid bodies derived from ES cells lacking
Smo initially express endothelial cell markers but fail to form
endothelial enclosed blood islands (Byrd et
al., 2002
), and an initial examination of Smo mutant
embryos reported that extra-embryonic yolk sac vessels were poorly formed and
greatly reduced in number (Byrd et al.,
2002
). Zebrafish Shh mutant embryos contain angioblasts
but do not form vascular tubes in the trunk region of the embryo
(Brown et al., 2000
), and
overexpression of SHH by injection of Shh mRNA, causes the formation
of lumenized ectopic vessels (Lawson et
al., 2002
). Transgenic mouse embryos ectopically expressing
Shh in the neural tube display hypervascularization
(Rowitch et al., 1999
), and
treatment of mouse embryonic neurectoderm explants with IHH is reported to
respecify explants to form tissues containing blood vessels
(Dyer et al., 2001
). Finally,
in culture, the addition of SHH causes endothelial cells to assemble into
capillary networks (Kanda et al.,
2003
). Our demonstration of a specific requirement for Hedgehog
signaling in intra-embryonic vascular assembly and tubulogenensis
significantly extends our understanding of Hedgehog action in the developing
vascular system.
Our analysis of the Smo-/- phenotype indicates that the
intraembryonic vascular phenotype is more severe that that previously
described for the yolk sac (Byrd et al.,
2002
), suggesting that development of intra-embryonic blood
vessels is in some respects distinct from that of the extra-embryonic
vasculature. This is not altogether unexpected, as the first extra-embryonic
blood vessels are derived from endothelial encased blood islands while
intraembryonic vessels are derived from aggregations of individual
angioblasts. However, based on the severe intra-embryonic vascular phenotype
of the Smo-/- mutants, it is surprising that mice lacking
SHH signaling do not exhibit obvious vascular defects
(Chiang et al., 1996
). Our
results suggest that this is probably the result of functional redundancy of
SHH with IHH, which also signals through the SMO pathway and which appears to
be expressed in an overlapping pattern in the intra-embryonic endoderm of the
mouse embryo (Zhang et al.,
2001
). Finally, we note that unlike avian embryos treated with
cyclopamine, mouse embryos that lack Hedgehog signaling still form a limited
number of vascular tubes. This implies that an alternative,
Hedgehog-independent pathway is sufficient for vascular tube formation in
certain regions of the mouse embryo. The nature of this alternative pathway is
currently unknown.
SHH has also been implicated as an indirect angiogenic factor in the
postnatal mouse. In assays examining corneal angiogenesis and surgically
induced hindlimb ischemia, addition of SHH resulted in a significant increase
in angiogenesis. SHH is believed to act indirectly in these experiments by
upregulating VEGF and angiopoietins 1 and 2
(Pola et al., 2001
). Likewise,
the microinjection mRNA encoding Shh into zebrafish embryos caused an
upregulation of VEGF in the somites
(Lawson et al., 2002
). Our
studies strongly suggest that a simple epistatic relationship between SHH and
VEGF is unlikely to account for vascular tube formation. First, cyclopamine
inhibition of SHH signaling completely eliminates vascular tubulogenesis in
the avian embryo (Fig. 3), even
in the presence of abundant VEGF in the endodermal and mesodermal layers
(Fig. 2A; data not shown).
Second, the addition of SHH alone is sufficient to mediate efficient
tubulogenesis in endodermless embryos. This is in contrast to administration
of VEGF alone, which results in the proliferation and adhesion of angioblasts,
but never causes detectable vascular tube formation. Third, our data show that
Hedgehog receptor components are expressed in angioblasts
(Fig. 2E,H,I,J) and in cultured
endothelial cells (Fig. 6A),
consistent with a mechanism in which SHH acts directly upon endothelial cells
to initiate the tubulogenesis pathway. Fourth, we observe that addition of
both VEGF and SHH facilitates the formation of a more extensive plexus that
closely resembles a wild-type network (compare
Fig. 5A,F,J), again suggesting
that SHH is not merely required to upregulate VEGF levels. Finally, we find
that cultured endothelial cells respond to Hedgehog signaling by aggregating
into vascular cords (Fig. 6C).
During this process, there is no detectable VEGF expression in the cultured
cells (Fig. 6D), and no
increase in cellular proliferation (Fig.
6E). Overall, these results strongly suggest that SHH signaling
acts independently of VEGF to mediate tube formation; however, we do not
exclude the possibility that SHH plays an additional role in upregulating VEGF
expression under certain circumstances. In
Fig. 7, we present a model in
which SHH operates in concert with VEGF to promote normal vasculogenesis. In
this model Hedgehog signaling is the crucial factor for initiating the
tubulogenesis pathway, as no vascular tubes are formed in the absence of SHH
activity. The model also indicates that VEGF, which originates in both
mesodermal and endodermal tissues, is necessary for the proliferation of
normal numbers of angioblasts. The idea that VEGF levels must be maintained
within a narrow range for normal vascular development is illustrated by a
recent study of yolk-sac vasculogenesis in mouse embryos carrying a targeted
mutation of Vegf expression in the visceral endoderm, but not the
adjacent mesodermal tissue. These embryos showed defects in yolk sac blood
vessel formation, demonstrating that VEGF originating from the mesodermal
layer alone is not sufficient for normal yolk sac vasculogenesis
(Damert et al., 2002
). Our
data suggests that VEGF may also function to promote cell-cell interactions.
This latter point is evidenced by the formation of the extended sheets of
angioblasts following treatment with VEGF alone
(Fig. 5H,I).
|
5ß1 and fibronectin as being crucial for
this process. This evidence is based, in part, on the observation that some
murine embryos lacking fibronectin contain angioblasts, but fail to form
endothelial tubes (George et al.,
1997
Given the sparse knowledge of the events leading to tubulogenesis, the
precise role played by SHH remains speculative. One possibility is that SHH
functions in promoting a specific type of cell adhesion. This is consistent
with models in Drosophila proposing a Hedgehog-mediated cell adhesion
pathway that controls cell segregation in the wing imaginal disc
(Dahmann and Basler, 2000
).
Alternatively, given the evidence that SHH signaling within mouse dental
epithelial cells is required for their polarization
(Gritli-Linde et al., 2002
),
SHH signaling may be required to establish apicobasal polarity in angioblasts
prior to lumen formation. Clearly, the identification of cell polarity markers
in angioblasts would greatly facilitate studies to further elucidate the
cellular mechanisms underlying vascular tube formation.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Ash, J. and Overbeek, P. (2000). Lens-specific VEGF-A expression induces angioblast migration and proliferation and stimulates angiogenic remodeling. Dev. Biol. 223,383 -398.[CrossRef][Medline]
Brown, L., Rodaway, A., Schilling, T., Jowett, T., Ingham, P., Patient, R. and Sharrocks, A. (2000). Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech. Dev. 90,237 -252.[CrossRef][Medline]
Byrd, N., Becker, S., Maye, P., Narasimhaiah, R., St-Jacques, B., Zhang, X., McMahon, J., McMahon, A. and Grabel, L. (2002). Hedgehog is required for murine yolk sac angiogenesis. Development 129,361 -372.
Carmeliet, P., Ferreira, V., Breier, G., Pollefeyt, S., Kleckens, L., Gertsenstein, M., Fahrig, M., Vandenhoeck, A., Harpal, K., Eberhardt, C. et al. (1996). Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 380,435 -438.[CrossRef][Medline]
Carmeliet, P., Lampugnani, M., Moons, L., Breviario, F., Compernolle, V., Bono, F., Balconi, G., Spagnuolo, R., Oosthuyse, B., Dewerchin, M. et al. (1999). Targeted deficiency or cytosolic truncation of the VE-cadherin gene in mice impairs VEGF-mediated endothelial survival and angiogenesis. Cell 98,147 -157.[CrossRef][Medline]
Chen, J. K., Taipale, J., Cooper, M. K. and Beachy, P. A.
(2002). Inhibition of Hedgehog signaling by direct binding of
cyclopamine to Smoothened. Genes Dev.
16,2743
-2748.
Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J. L., Westphal, H. and Beachy, P. A. (1996). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383,407 -413.[CrossRef][Medline]
Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156 -159.[Medline]
Ciau-Uitz, A., Walmsley, M. and Patient, R. (2000). Distinct origins of adult and embryonic blood in Xenopus. Cell 102,787 -796.[CrossRef][Medline]
Clark, E. and Clark, E. (1939). Microscopic observations on the growth of blood capillaries in the living mammal. Am. J. Anat. 64,251 -301.[CrossRef]
Cleaver, O. and Krieg, P. (1998). VEGF mediates angioblast migration during development of the dorsal aorta in Xenopus. Development 125,3905 -3914.[Abstract]
Coffin, J. and Poole, T. (1988). Embryonic
vascular development: immunohistochemical identification of the origin and
subsequent morphogenesis of the major vessel primordia in quail embryos.
Development 102,735
-748.
Cormier, F. and Dieterlen-Lièvre, F. (1988). The wall of the chick embryo aorta harbours M-CFC, G-CFC, GM-CFC and BFU-E. Development 102,279 -285.[Abstract]
Dahmann, C. and Basler, K. (2000). Opposing transcriptional outputs of hedgehog signaling and engrailed control compartmental cell sorting at the Drosophila A/P boundary. Cell 100,411 -422.[CrossRef][Medline]
Damert, A., Miquerol, L., Gertsenstein, M., Risau, W. and Nagy, A. (2002). Insufficient VEGFA activity in yolk sac endoderm compromises haematopoietic and endothelial differentiation. Development 129,1881 -1892.
Davis, G. E. and Camarillo, C. W. (1996). An
2ß1 integrin-dependent pinocytic mechanism involving intracellular
vacuole formation and coalescence regulates capillary lumen and tube formation
in three-dimensional collagen matrix. Exp. Cell Res.
224, 39-51.[CrossRef][Medline]
Drake, C. J. and Fleming, P. A. (2000).
Vasculogenesis in the day 6.5 to 9.5 mouse embryo.
Blood 95,1671
-1679.
Drake, C. J., Davis, L. A. and Little, C. D. (1992). Antibodies to ß1-integrins cause alterations of aortic vasculogenesis in vivo. Dev. Dynamics 193, 83-91.[Medline]
Drake, C. J., Hungerford, J. E. and Little, C. D.
(1998). Morphogenesis of the first blood vessels. Ann.
N. Y. Acad. Sci. 857,155
-179.
Drake, C. J., LaRue, A., Ferrara, N. and Little, C. D. (2000). VEGF regulates cell behavior during vasculogenesis. Dev. Biol. 224,178 -188.[CrossRef][Medline]
Duncan, G. S., Andrew, D. P., Takimoto, H., Kaufman, S. A.,
Yoshida, H., Spellberg, J., de la Pompa, J. L., Alia, A., Wakeham, A.,
Karan-Tamir, B. et al. (1999). Genetic evidence for
functional redundancy of Platelet/Endothelial Cell Adhesion Molecule-1
(PECAM-1): CD-31-deficient mice revewal PECAM-1-dependent and
PECAM-1-independent functions. J. Immunol.
162,3022
-3030.
Dyer, M. A., Farrington, S. M., Mohn, D., Munday, J. R. and Baron, M. H. (2001). Indian hedgehog activates hematopoiesis and vasculogenesis and can respecify prospective neurectodermal cell fate in the mouse embryo. Development 128,1717 -1730.[Abstract]
Ferrara, N., Carver-Moore, K., Chen, H., Dowd, M., Lu, L., O'Shea, K., Powell-Braxton, L., Hillan, K. and Moore, M. (1996). Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature 380,439 -442.[CrossRef][Medline]
Folkman, J. and Haudenschild, C. (1980). Angiogenesis in vitro. Nature 288,551 -556.[CrossRef][Medline]
Fong, G., Rossant, J., Gertsenstein, M. and Breitman, M. (1995). Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature 376, 66-69.[CrossRef][Medline]
Fong, G., Zhang, L., Bryce, D. and Peng, J. (1999). Increased hemangioblast commitment, not vascular disorganization, is the primary defect in flt-1 knock-out mice. Development 126,3015 -3025.[Abstract]
Francis, S. E., Goh, K. L., Hodivala-Dilke, K., Bader, B. L.,
Stark, M., Davidson, D. and Hynes, R. O. (2002). Central
roles of
5ß1 integrin and fibronectin in
vascular development in mouse embryos and embryoid bodies.
Arterioscler. Thromb. Vasc. Biol.
22,927
-933.
George, E. L., Baldwin, H. S. and Hynes, R. O.
(1997). Fibronectins are essential for heart and blood vessel
morphogenesis but are dispensable for initial specification of precursor
cells. Blood 90,3073
-3081.
Gerber, H., Dixit, V. and Ferrara, N. (1998a).
Vascular endothelial growth factor induces expression of the antiapoptotic
proteins Bcl-2 and A1 in vascular endothelial cells. J. Biol.
Chem. 273,13313
-13316.
Gerber, H., McMurtrey, A., Kowalski, J., Yang, M., Keyt, B.,
Dixit, V. and Ferrara, N. (1998b). Vascular endothelial
growth factor regulates endothelial cell survival through the
Phosphatidylinositol 3'-Kinase/Akt signal transduction pathway.
J. Biol. Chem. 273,30336
-30343.
Gonzalez-Crussi, F. (1971). Vasculogenesis in the chick embryo, an ultrastructural study. Am. J. Anat. 130,441 -460.[CrossRef][Medline]
Gory-Fauré, S., Prandini, M. H., Pointu, H., Roullot, V., Pignot-Paintrand, I., Vernet, M. and Huber, P. (1999). Role of vascular endothelial-cadherin in vascular morphogenesis. Development 126,2093 -2102.[Abstract]
Grapin-Botton, A., Majithia, A. R. and Melton, D. A.
(2001). Key events of pancreas formation are triggered in gut
endoderm by ectopic expression of pancreatic regulatory genes.
Genes. Dev. 15,444
-454.
Gritli-Linde, A., Bei, M., Maas, R., Zhang, X. M., Linde, A. and
McMahon, A. P. (2002). Shh signaling within the dental
epithelium is necessary for cell proliferation, growth and polarization.
Development 129,5323
-5337.
Hahn, H. (1909). Experimentelle studien uber die entstehung des blutes und der ersten Gefabe beim huhnchen. Archiv für Entwicklungsmechanik Der Organismen 27,337 -433.[CrossRef]
Hamburger, V. and Hamilton, H. (1951). A series of normal stages in the development of the chick embryo. J. Morph. 88,49 -93.[CrossRef]
Hirakow, R. and Hiruma, T. (1981). Scanning electron microscopic study on the development of primitive blood vessels in chick embryos at the early somite-stage. Anat. Embryol. 163,299 -306.[CrossRef][Medline]
Hirakow, R. and Hiruma, T. (1983). TEM-studies on development and canalization of the dorsal aorta in the chick embryo. Anat. Embryol. 166,307 -315.[CrossRef][Medline]
Hogan, B. L. and Kolodziej, P. A. (2002). Molecular mechanisms of tubulogensis. Nat. Rev. Genet. 3, 513-523.[CrossRef][Medline]
Houser, J. W., Ackerman, G. A. and Knouff, R. A. (1961). Vasculogenesis and erythropoiesis in the living yolk sac of the chick embryo: a phase microscopic study. Anat. Rec. 140,29 -43.
Incardona, J. P., Gaffield, W., Kapur, R. P. and Roelink, H. (1998). The teratogenic Veratrum alkaloid cyclopamine inhibits Sonic hedgehog signal transduction. Development 125,3553 -3562.[Abstract]
Ingham, P. W. and McMahon, A. P. (2001).
Hedgehog signaling in animal development: paradigms and principles.
Genes Dev. 15,3059
-3087.
Jaffredo, T., Gautier, R., Eichmann, A. and Dieterlen-Lièvre, F. (1998). Intraaortic hemopoietic cells are derived from endothelial cells during ontogeny. Development 125,4575 -4583.[Abstract]
Javerzat, S., Auguste, P. and Bikfalvi, A. (2002). The role of fibroblast growth factors in vascular development. Trends Mol. Med. 8, 483-489.[CrossRef][Medline]
Kanda, S., Mochizuki, S., Suematsue, T., Miyata, Y., Nomata, K.
and Kanetake, H. (2003). Sonic hedgehog induces capillary
morphogenesis by endothelial cells through phosphoinositide 3-kinase.
J. Biol. Chem. 278,8244
-8249.
Kessel, J. and Fabian, B. (1985). Graded morphogenetic patterns during the development of the extraembryonic blood system and coelom of the chick blastoderm: a scanning electron microscope and light microscope study. Am. J. Anat. 173,99 -112.[CrossRef]
Keyt, B., Berleau, L., Nguyen, H., Chen, H., Heinsohn, H.,
Vandlen, R. and Ferrara, N. (1996). The carboxyl-terminal
domain (111-165) of vascular endothelial growth factor is critical for its
mitogenic potency. J. Biol. Chem.
271,7788
-7795.
Lawson, N. D. and Weinstein, B. M. (2002). Arteries and veins: making a difference with zebrafish. Nat. Rev. Genet. 9,674 -682.
Lawson, N. D., Vogel, A. M. and Weinstein, B. M. (2002). Sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation. Dev. Cell 3,127 -136.[CrossRef][Medline]
Lubarsky, B. and Krasnow, M. A. (2003). Tube morphogenesis: making and shaping biological tubes. Cell 112,19 -28.[CrossRef][Medline]
Marti, H. H. and Risau, W. (1998). Systemic
hypoxia changes the organ-specific distribution of vascular endothelial growth
factor and its receptors. Proc. Natl. Acad. Sci. USA
95,15809
-15814.
Mato, M., Aikawa, E. and Kishi, K. (1964). Some observations on interstice between mesoderm and endoderm in the area vasculosa of the chick blastoderm. Exp. Cell Res. 35,426 -428.
Meier, S. (1980). Development of the chick embryo mesoblast: pronephros, lateral plate, and early vasculature. J. Embryol. Exp. Morph. 55,291 -306.[Medline]
Meyer, G. T., Matthias, L. J., Noack, L., Vadas, M. A. and Gamble, J. R. (1997). Lumen formation during angiogenesis in vitro involves phagocytic activity, formation and secretion of vacuoles, cell death, and capillary tube remodelling by different populations of endothelial cells. Anat. Rec. 249,327 -340.[CrossRef][Medline]
Miller, A. and McWhorter, J. (1914). Experiments on the development of blood vessels in the area pellucida and embryonic body of the chick. Anat. Rec. 8, 203-227.[CrossRef]
Mobbs, I. and McMillan, D. (1979). Structure of the endodermal epithelium of the chick yolk sac during the early stages of development. Am. J. Anat. 155,287 -309.[CrossRef][Medline]
Montesano, R., Pepper, M. S., Mohle-Steinlein, U., Risau, W., Wagner, E. F. and Orci, L. (1990). Increased proteolytic activity is responsible for the aberrant morphogenetic behavior of endothelial cells expressing the middle T oncogene. Cell 62,435 -445.[CrossRef][Medline]
New, D. (1955). A new technique for the cultivation of the chick embryo in vitro. J. Embryol. Exp. Morph. 3,326 -331.
Obeso, J., Weber, J. and Auerbach, R. (1990). A hemangioendothelioma-derived cell line: its use as a model for the study of endothelial cell biology. Lab. Invest. 63,259 -269.[Medline]
Olah, I., Medgyes, J. and Glick, B. (1988). Origin of aortic cell clusters in the chicken embryo. Anat. Rec. 222,60 -68.[CrossRef][Medline]
Pardanaud, L., Altmann, C., Kitos, P., Dieterlen-Lièvre,
F. and Buck, C. (1987). Vasculogenesis in the early quail
blastodisc as studied with a monoclonal antibody recognizing endothelial
cells. Development 100,339
-349.
Pardanaud, L., Yassine, F. and Dieterlen-Lièvre, F.
(1989). Relationship between vasculogenesis, angiogenesis and
haemopoiesis during avian ontogeny. Development
105,473
-485.
Park, J., Keller, G. and Ferrara, N. (1993). The vascular endothelial growth factor (VEGF) isoforms: differential deposition into the subepithelial extracellular matrix and bioactivity of extracellular matrix-bound VEGF. Mol. Biol. Cell 4,1317 -1326.[Abstract]
Pola, R., Ling, L. E., Silver, M., Corbley, M., Kearney, M., Pepinsky, R. B., Shapiro, R., Taylor, F. R., Baker, D. P., Asahara, T. et al. (2001). The morphogen Sonic hedgehog is an indirect angiogenic agent upregulating two families of angiogenic growth factors. Nat. Med. 7,706 -711.[CrossRef][Medline]
Pollack, A. L., Runyan, R. B. and Mostov, K. E. (1998). Morphogenetic mechanisms of epithelial tubulogenesis: MDCK cell polarity is transiently rearranged without loss of cell-cell contact during Scatter Factor/Hepatocyte Growth Factor-induced tubulogenesis. Dev. Biol. 204,64 -79.[CrossRef][Medline]
Reagan, F. (1915). Vascularization phenomena in fragments of embryonic bodies completely isolated from yolk-sac blastoderm. Anat. Rec. 9,329 -341.[CrossRef]
Roberts, D. J., Johnson, R. L., Burke, A. C., Nelson, C. E., Morgan, B. A. and Tabin, C. (1995). Sonic hedgehog is an endodermal signal inducing Bmp-4 and Hox genes during induction and regionalization of the chick hindgut. Development 121,3163 -3174.[Abstract]
Rowitch, D. H., St-Jacques, B., Lee, S. M., Flax, J. D., Snyder,
E. Y. and McMahon, A. P. (1999). Sonic hedgehog regulates
proliferation and inhibits differentiation of CNS precursor cells.
J. Neurosci. 19,8954
-8965.
Shalaby, F., Rossant, J., Yamaguchi, T., Gertsenstein, M., Wu, X., Breitman, M. and Schuh, A. (1995). Failure of blood-island formation and vasculogenesis in Flk-deficient mice. Nature 376,62 -66.[CrossRef][Medline]
Sugi, Y. and Markwald, R. (1996). Formation and early morphogenesis of endocardial endothelial precursor cells and the role of endoderm. Dev. Biol. 175, 66-83.[CrossRef][Medline]
Taipale, J., Chen, J. K., Cooper, M. K., Wang, B., Mann, R. K., Milenkovic, L., Scott, M. P. and Beachy, P. A. (2000). Effects of oncogenic mutations in Smoothened and Patched can be reversed by cyclopamine. Nature 406,1005 -1009.[CrossRef][Medline]
Vernon, R., Lara, S., Drake, C., Iruela-Arispe, M., Angello, J., Little, C., Wight, T. and Sage, E. (1995). Organized type I collagen influences endothelial patterns during "spontaneous angiogenesis in vitro". planar cultures as models of vascular development. In vitro Cell. Dev. Biol. Anim. 31,120 -131.[Medline]
Vokes, S. A. and Krieg, P. A. (2002a). Endoderm is required for vascular endothelial tube formation, but not for angioblast specification. Development 129,775 -785.