|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online September 1, 2004
doi: 10.1242/10.1242/dev.01302
1 University of Geneva, Biochemistry Department, 30 quai Ernest-Ansermet, 1211
Geneva, Switzerland
2 New York University School of Medicine, Department of Pathology, 550 First
Avenue, New York, NY 10016, USA
3 University of Lausanne, Institute of Research in Ophthalmology and the Eye
Hospital Jules Gonin, 15 avenue de France, 1004 Lausanne, Switzerland
* Author for correspondence (e-mail: dorota.skowronska{at}biochem.unige.ch)
Accepted 11 June 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Retinogenesis, Basic helix-loop-helix, Transcription, Chromatin modifications, Chick, CHRNB3
| Introduction |
|---|
|
|
|---|
The expression of ATH5 during chick retina development is transient. The
peak of activity of the ATH5 promoter coincides with the period when the
majority of RGC precursors exit from the mitotic cycle and start to
differentiate. In vitro and ex vivo approaches using chick embryos have
suggested that ATH5 protein is involved in the regulation of its own
expression exactly during this period, whereas NGN2 plays a role in the early
activation of ATH5 (Matter-Sadzinski et
al., 2001
) (L. Matter-Sadzinski, M. Puzianowska-Kuznicka, J.
Hernandez, M.B. and J.-M.M., unpublished). Additionally, the onset of
expression of the ß3 subunit of a neuronal nicotinic acetylcholine
receptor (nAChR; CHRNB3 Mouse Genome Informatics), a specific marker
of RGC specification, appears to come under the control of ATH5
(Matter-Sadzinski et al.,
2001
).
We show that chromatin immunoprecipitation (ChIP) can be successfully adapted for use with developing central nervous system tissues, allowing the unequivocal identification of transcription factors that bind target promoters at different stages of development. Specifically, we use ChIP to monitor changes in the in vivo occupancy of target promoters by ATH5 and NGN2 during the course of retina development. We demonstrate that binding of the ATH5 protein to its own promoter as well as to the ß3 nAChR promoter coincides with the period of development when both genes are actively transcribed. We show that the differential occupancy of the ATH5 and ß3 promoters by NGN2 correlates well with its ability to activate these promoters. Moreover, we show a correlation between promoter activity and histone H3 hypermethylation on lysine 4 (K4), thus providing one of the first direct demonstrations that activation of neuron-specific promoters by bHLH transcription factors is associated with chromatin modifications known to reflect the transcriptional competence of target genes.
| Materials and methods |
|---|
|
|
|---|
Chromatin immunoprecipitation
ChIP has been performed essentially as previously described
(Takahashi et al., 2000
) with
some modifications. Dissected retinas and suspensions of immunopanned cells
were incubated for 10 minutes at room temperature in 1% formaldehyde solution
with douncing (J. Ripperger and U. Schibler, University of Geneva,
unpublished). Crosslinking was stopped by the addition of glycine to a final
concentration of 0.125 M. After washing with PBS, cells were rocked for 10
minutes at 4°C in a lysing solution containing 50 mM HEPES (pH 7.6), 140
mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton X-100 and protease
inhibitors (10 µg/ml aprotinin, 1 µg/ml leupeptin). After centrifugation
(5 minutes at 1800 g, 4°C), the pellet was resuspended in
TE buffer containing 200 mM NaCl, 0.5 mM EGTA and protease inhibitors, and
rocked for 10 minutes at room temperature. Nuclei were collected by
centrifugation (for 5 minutes, at 1800 g, 4°C),
resuspended in sonication buffer (1 mM EDTA, 0.5 mM EGTA, 10 mM Tris pH 8 and
protease inhibitors) and sonicated on ice to an average DNA length of 700 bp.
For immunoprecipitation, 10 µg (
3.5x106 cells from
whole retina) or 5 µg (
2x106 immunopanned cells) of
crosslinked chromatin were incubated in solutions [20 mM HEPES (pH 8), 200 mM
NaCl, 2 mM EDTA, 0.1% NaDOC, 1% Triton X-100, 1 mg/ml BSA, 100 µg/ml salmon
sperm DNA and protease inhibitors] containing either 20 µg of
affinity-purified antibody (ATH5 or NGN2) or 2 µg of anti dimethylated K4
H3 antibody or the appropriate amount of rabbit preimmune serum as control.
Immune complexes were captured for 2 hours at room temperature with protein A
sepharose beads. Beads were washed seven times with modified RIPA buffer [50
mM HEPES (pH 7.6), 1 mM EDTA, 0.7% NaDOC, 1% NP-40, 0.5 M LiCl] and once with
TE buffer. Immunoprecipitates were eluted from beads with 500 µl of 100 mM
Tris pH 8, 1% SDS for 10 minutes at 65°C and digested with 100 µg of
proteinase K in 200 mM NaCl for 2 hours at 42°C, and then overnight at
65°C to reverse crosslinks. DNAs were purified by phenol-chloroform
extraction. DNA sequences present in the immunoprecipitates were quantified by
real-time PCR using the primers listed below. Real-time PCR was performed
using the iCycler iQ Real-Time PCR Detection System (BioRad) and a SYBR-Green
based kit for quantitative PCR (iQ Supermix BioRad). The amounts of
immunoprecipitated DNA were calculated by comparison to a standard curve
generated by serial dilutions of input DNA, subtracting values obtained with
preimmune sera. The data were plotted as mean of at least two independent
chromatin immunoprecipitation assays and three independent amplifications.
Immunoprecipitation efficiency was calculated as the ratio of precipitated
sequence over total sequence amount in input chromatin.
Sequences and primers
The ATH5 and ß3 genomic sequences are available, respectively, as
AJ630209 and X83740. The primers used for real-time amplifications
(Fig. 1C) were as follows:
ath5fwd, GCTGGGAAGGTACTGGGAT; ath5rev, CTTGACTGCCGTCGGAAGC; ß3fwd,
TTGCCTCACTTTGAATCCCAGAC; ß3rev, GCTCCCTAAAGCACACTTC ATTG; ß3ORFfwd,
GGCAGTATGGTGGACTTAATTC; ß3ORFrev, CCTGTTGCCTTTCATACCTTTG; NeuroMfwd,
TGCTGCTCCACCTGAGAGTTAATTG; NeuroMrev, CGGCGTGGATTAGGGTGTTAATTAC; NeuroDfwd,
AGCTGAACCCTGGCAGATG; NeuroDrev, AGCCTGGAGGTGCAATGTC.
|
Immunostaining
Cells were fixed in 100% methanol for 4 minutes at 20°C. After
15 minutes of blocking with PBS containing 0.5% BSA and 0.1% Tween20, cells
were incubated with anti-THY1 (0.25 mg/ml) antibody overnight at 4°C and
revealed with FITC conjugated anti-mouse antibody (1:1000 dilution).
In situ hybridization
In situ hybridizations on tissue sections and on dissociated cells were
performed as previously described
(Roztocil et al., 1997
;
Matter-Sadzinski et al.,
2001
).
| Results and discussion |
|---|
|
|
|---|
800 bp of the promoter of
ATH5 gene. The region encompasses seven E-boxes, four of which are
essential for proper promoter activity
(Fig. 1C; J. Hernandez, L.
Matter-Sadzinski, D.S.-K., J.-M.M. and M.B., unpublished). Functional analyses
of the ATH5 promoter indicate that both the ATH5 and NGN2 proteins
are involved in the regulation of ATH5 transcription
(Matter-Sadzinski et al.,
2001
700 bp) allows overall detection
of promoter occupancy but does not allow the determination of which out of
several closely spaced E-boxes is bound by the targeted transcription
factor.
In retina, ATH5 is bound to its own promoter both at E3 and at E6, but not
at E9 or at E12 (Fig. 2A). In
situ hybridization on tissue sections and on dissociated cells has shown that
similar proportions of retinal cells express ATH5 at E2.5 and E6
(Fig. 3). The mildly enhanced
binding detected at E6 may thus reflect an increased involvement of ATH5 in
its own transcription at this stage. This pattern of association coincides
with the period of development when ATH5 promoter activity is highest and is
consistent with functional data suggesting that ATH5 protein stimulates the
activity of its own promoter more efficiently in E6 than in E3 retina. At E9,
the ATH5 promoter is downregulated, while at E12 the promoter is turned off
(Matter-Sadzinski et al.,
2001
) (L. Matter-Sadzinski, M. Puzianowska-Kuznicka, J. Hernandez,
M.B. and J.-M.M., unpublished). The specificity of the ATH5
immunoprecipitation reaction was confirmed by performing ChIP experiments with
chromatin isolated from optic tectum, a tissue in which ATH5 is not expressed
(Fig. 2A). In addition, as
there is no evidence suggesting that NeuroM can be directly regulated by ATH5,
we have monitored the enrichment in ATH5 immunoprecipitates of the NeuroM
upstream region, which contains several E-boxes
(Fig. 1C; J. Hernandez and
M.B., unpublished). The absence of ATH5 on the NeuroM promoter
(Fig. 2A) is further evidence
for the specificity of the procedure.
|
|
Although essential regulatory elements (e.g. E-boxes) are very well
conserved in the chicken (GenBank AJ630209) and mouse
(Brown et al., 2002
) ATH5
regulatory regions, suggesting that distant vertebrate species may use quite
similar strategies to regulate ATH5, there are reported differences in the
ATH5 and NGN2 expression patterns of birds and mammals. In the developing
mouse retina, the studies by Brown et al.
(Brown et al., 2001
) and Wang
et al. (Wang et al., 2001
)
show that autoregulation is not required for mouse ATH5 expression. Using a
lacZ reporter assay, Yang et al.
(Yang et al., 2003
) argue that
mouse ATH5 expression is restricted to post-mitotic cells, in contradiction
with the work of Brown et al. (Brown et
al., 1998
) and Marquardt et al.
(Marquardt et al., 2001
) who
find that mouse NGN2 and ATH5 are expressed in retinal progenitor cells. At
this point, it is possible to argue that the regulation of ATH5 differs in
birds and mammals, based on the 48 hours delay separating the onset of ATH5
and NGN2 expression in the mouse (Brown et
al., 1998
) and the quasi-simultaneous onsets in the chick
(Matter-Sadzinski et al.,
2001
).
The ß3 nAChR promoter is transiently and selectively bound by ATH5
The ß3 subunit of the neuronal nicotinic receptor is selectively
expressed in the RGCs and expression of the ß3 gene starts as soon as
retinal precursor cells are committed to the RGC fate
(Matter et al., 1995
).
Functional analysis of the ß3 promoter indicates that ATH5 regulates the
ß3 gene in the developing retina
(Matter-Sadzinski et al.,
2001
). To examine whether ATH5 binds to the ß3 promoter, we
performed ChIP experiments with chromatin isolated from E3-E12 retinas.
Remarkably, although binding of ATH5 to the ß3 promoter was undetectable
in chromatin isolated from retinas at E3, E9 and E12, it was readily detected
at E6 (Fig. 2C). A single E-box
is implicated in the regulation of the ß3 promoter
(Fig. 1C)
(Roztocil et al., 1998
) and
ATH5 was bound exclusively to sequences encompassing this region, but not to
coding sequences located downstream of the transcription start site (ORF)
(Fig. 2C). Control ChIP
experiments indicated that ATH5 binding was nearly undetectable in chromatin
derived from the optic tectum (Fig.
2C). The transient binding of ATH5 on the ß3 promoter in E6
retina is in agreement with previous studies showing that ATH5 has the
capacity to transactivate the ß3 promoter during the rather narrow period
of development when RGCs are generated, but not at later stages of development
(Matter-Sadzinski et al.,
2001
). Taken together, these data suggest that ATH5-regulated
transcription of the ß3 gene in RGC precursors and in newborn RGCs
correlates well with binding of ATH5 protein to the ß3 promoter.
Furthermore, as ATH5 is not expressed in fully differentiated RGCs,
transcription of the ß3 gene in these neurons must be directed by
another, uncharacterized factor.
Previous functional studies have shown that the ß3 promoter is
efficiently activated by ATH5, but not by NGN2
(Matter-Sadzinski et al.,
2001
). To elucidate the mechanism of this discrimination, we have
examined the ß3 promoter by ChIP using an antibody raised against NGN2.
Although NGN2 is expressed in these cells, there was no enrichment of the
ß3 promoter region in the NGN2 immunoprecipitates
(Fig. 2B), demonstrating that
NGN2 protein is not bound to the ß3 promoter in developing retina and
further documenting the remarkable specificity with which key bHLH
transcription factors interact with target genes in neuronal cells.
Histone methylation correlates positively with activity of the ATH5 and ß3 promoters
Even though there are numerous studies on gene expression in the nervous
system, very few have addressed the issue of chromatin structure modification
in relation to transcriptional competence [see Guan et al.
(Guan et al., 2002
), for
pioneering work in the context of memory storage]. Essentially nothing is
known about histone modification within the promoter regions of genes involved
in CNS development. We decided to monitor lysine 4 (K4) dimethylation of
histone H3, a modification known to reflect the transcriptional competence of
several genes involved in differentiation
(Kouzarides, 2002
) and
development (Litt et al.,
2001
). We performed immunoprecipitation of chromatin isolated from
retinas and optic tecta using an anti-dimethylated K4 H3 antibody (H3-K4). As
depicted in Fig. 4A, we
observed a selective enrichment of ATH5 promoter sequences in the
immunoprecipitates at all stages of retina development (E3-18). Strikingly,
enrichment peaks at E6 and then decreases at a steady rate to low levels by
E18, in exact register with the reported kinetics of ATH5 promoter activity
(Matter-Sadzinski et al.,
2001
). In the developing optic tectum, where the ATH5 gene is not
expressed, H3-K4 dimethylation was not detected on the ATH5 promoter
(Fig. 4A). Methylation,
however, decreases in retina at a much slower rate than promoter activity.
Histone demethylation is known to proceed at a slow rate and to be dependent
on mechanisms that can be either replication dependent or replication
independent (Bannister et al.,
2002
). All RGCs are born before E12
(Prada et al., 1991
), strongly
suggesting that the operating mechanism of de-methylation in developing
retinal cells is replication independent.
|
Histone H3 methylation correlates with transcriptional competence
To determine whether the correlation between promoter activity and histone
H3-K4 dimethylation is a general phenomenon, it was of interest to analyze the
methylation patterns of genes expressed both in the retina and in the optic
tectum. NeuroM and NeuroD are good candidates for this study as they are
dynamically expressed in both tissues. In the optic tectum, the transient
expression of NeuroM peaks at E6, at a time when the various cell classes exit
from the mitotic cycle. In the retina, NeuroM expression obeys the same
principle as in the optic tectum; however, expression does not stop at the end
of neurogenesis but persists in mature bipolar and horizontal cells
(Roztocil et al., 1997
). In
the optic tectum and retina, NeuroD has a later onset than NeuroM. In early
(E4-6) retina, expression of NeuroD is detected in precursor cells
(Roztocil et al., 1997
) and
may correlate at later stages with the differentiation of photoreceptors and
amacrine cells (Morrow et al.,
1999
). In the optic tectum, NeuroD expression is detected at
around E6 and increases slowly during development of the tissue
(Roztocil et al., 1997
). We
performed immunoprecipitation of chromatin from retina and optic tectum using
an anti dimethylated H3-K4 antibody and observed correlations in both tissues
between histone dimethylation and the known expression patterns of NeuroM and
NeuroD (Fig. 5). In retina,
methylation of the NeuroM promoter is detected at E3 and reaches its highest
level at E9 (Fig. 5A). It
remains high in the developed retina, in accordance with the sustained NeuroM
mRNA expression seen in this tissue
(Roztocil et al., 1997
). In
the optic tectum, the transient expression of this gene is at a much lower
level than in the retina (Roztocil et al.,
1997
) and no significant enhancement of methylation was detected
(Fig. 5A). This could reflect
the fact that the fraction of tectal cells that express NeuroM is too small to
be detected in our assay, or it may suggest different histone modification
requirements for brief versus continuous expression of the gene. The level of
methylation of NeuroD promoter sequences remained very low during retina and
optic tectum development, but was strongly enhanced in the developed retina
and optic tectum (Fig. 5B).
This delayed methylation of the NeuroD promoter is congruent with the late
onset of NeuroD expression in both tissues. Incidentally, our ability to
detect H3 methylation at the NeuroD promoter in both retina and optic tectum
demonstrates that the paucity in optic tectum methylation we observe for other
promoters is physiologically relevant and not due to a tissue-specific bias in
chromatin quality.
|
80%
purity) at E9 and E12 (Fig.
6A). Next, we conducted a ChIP analysis on the chromatin of the
immunopanned cells, monitoring (as before) the increased levels of the ATH5
and ß3 promoters in dimethylated H3 immunoprecipitates. We found that the
methylation changes in RGCs (Fig.
6B,C) accurately reflected those previously seen in chromatin from
whole retina (Fig. 4), thereby
strengthening the conclusions drawn using whole retina chromatin. However, we
noted that the differences between E9 and E12 levels of methylation of the
ATH5 and ß3 promoters were much higher when the chromatin was isolated
from RGCs. We believe that these differences reflect the experimental
procedure that we used to enrich in RGCs. The onset of THY1 expression takes
place when RGCs are completing differentiation and coincides with the period
of development when expression of ATH5 is downregulated, so that only a small
fraction of RGCs should co-express THY1 and ATH5. Because the majority of
THY1-expressing RGCs complete their differentiation between E9 and E12, it is
likely that the fraction of cells that express ATH5 would be selectively
diminished in the enriched population of THY1-expressing cells relative to the
total population of retinal cells. Moreover, THY1-expressing cells selected at
E9 and E12 are newborn RGCs. The significant de-methylation detected between
these two stages thus occurs in cells that have exited the mitotic cycle
(Fig. 6B). Taken together,
these results suggest that de-methylation of the ATH5 promoter is replication
independent and correlates very well with the decreased promoter activity seen
in RGCs. Likewise, the strong increase in the methylation of the ß3
promoter that we detect between E9 and E12 in immunopanned cells when compared
with whole retina most probably reflects the strong enrichment in
differentiated RGCs, the cell type expressing ß3
(Fig. 6C).
|
We have also monitored methylation of the NeuroD promoter region in
enriched populations of RGCs. The low and constant methylation that we
detected at E9 and E12 (Fig.
6E) may reflect the weak expression of NeuroD in newborn RGCs
(Roztocil et al., 1997
). We
suggest that the significant increase in methylation detected in whole retina
between E9 and E12 (Fig. 5B)
mostly reflects NeuroD expression in photoreceptors
(Roztocil et al., 1997
;
Yan and Wang, 1998
).
Conclusions
In this report, we show that ChIP can indeed be used to address basic
questions regarding functional interactions between transcription factors and
their target genes within the developing central nervous system. The method is
capable of identifying highly specific interactions between bHLH proteins and
neuron-type specific promoters in a native chromatin environment. Moreover, we
show that ChIP can be applied to study chromatin modifications in the promoter
regions of genes expressed in selected subclasses of retinal neurons.
Specifically, we demonstrate that, in vivo, the ATH5 factor directly interacts
with the regulatory sequences of the ß3 and ATH5 genes. Our
results further indicate that stable interactions between bHLH proteins and
specific regulatory elements occur only when these factors are engaged in
regulating transcriptional activity. The demonstration that ATH5 binds the
ß3 promoter, whereas NGN2 does not, suggests that the remarkable property
of the ß3 promoter to discriminate between bHLH proteins is most probably
regulated, in vivo, at the level of DNA binding. The specific binding of NGN2
to the ATH5 promoter in neuroretina suggests that recruitment of NGN2 to this
regulatory element involves tissue-specific factors. The fact that both NGN2
and ATH5 bind the ATH5 promoter is congruent with our mutational and
functional analysis showing that both proneural proteins require the same
E-boxes to mediate their effect upon the promoter
(Matter-Sadzinski et al.,
2001
) (Fig. 1C; J.
Hernandez, L. Matter-Sadzinski, D.S.-K., J.-M.M. and M.B., unpublished). We
surmise that they are acting in dynamic equilibrium and that the preponderance
of one protein over the other may change in the course of development.
Increased binding of ATH5 at E6 may reflect the fact that autostimulation is
prevalent in driving promoter activity at this stage. We have also noted a
remarkable coincidence between the expression patterns of the ATH5, NeuroM,
NeuroD and ß3 genes, and the histone methylation of their promoters
during development. These congruent events are one of the first demonstrations
that gene expression in the developing nervous system is associated with major
changes in histone modification. Furthermore, we note a striking correlation
between diminished levels of dimethylated K4 on histone H3 and diminished
expression, suggesting that an uncharacterized, replication independent
mechanism may operate in neurons to remove histone modification and dampen
gene expression.
The correlation that we found between gene expression, binding of transcription factors and chromatin modification indicates that ChIP is a powerful and robust tool with which to investigate neural gene regulation. The approach should be easily extended to the developing and adult nervous tissues of other vertebrate species. Moreover, ChIP and DNA arrays may be combined into a unique tool to screen for new target of transcription factors known to play key roles in the neural development and maintenance of the differentiated state.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Anderson, D. J., Groves, A., Lo, L., Ma, Q., Rao, M., Shah, N. M. and Sommer, L. (1997). Cell lineage determination and the control of neuronal identity in the neural crest. Cold Spring Harb. Symp. Quant. Biol. 62,493 -504.[Medline]
Bannister, A. J., Schneider, R. and Kouzarides, T. (2002). Histone methylation: dynamic or static? Cell 109,801 -806.[CrossRef][Medline]
Bertrand, N., Castro, D. S. and Guillemot, F. (2002). Proneural genes and the specification of neural cell types. Nat. Rev. Neurosci. 3, 517-530.[CrossRef][Medline]
Brown, N. L., Kanekar, S., Vetter, M. L., Tucker, P. K., Gemza, D. L. and Glaser, T. (1998). Math5 encodes a murine basic helix-loop-helix transcription factor expressed during early stages of retinal neurogenesis. Development 125,4821 -4833.[Abstract]
Brown, N. L., Patel, S., Brzezinski, J. and Glaser, T.
(2001). Math5 is required for retinal ganglion cell and optic
nerve formation. Development
128,2497
-2508.
Brown, N. L., Dagenais, S. L., Chen, C. M. and Glaser, T. (2002). Molecular characterization and mapping of ATOH7, a human atonal homolog with a predicted role in retinal ganglion cell development. Mamm. Genome 13,95 -101.[CrossRef][Medline]
Butowt, R., Jeffrey, P. L. and von Bartheld, C. S. (2000). Purification of chick retinal ganglion cells for molecular analysis: combining retrograde labeling and immunopanning yields 100% purity. J. Neurosci. Methods 95, 29-38.[CrossRef][Medline]
French, P. W. and Jeffrey, P. L. (1986). Partial characterization of chicken Thy-1 glycoprotein by monoclonal antibodies. J. Neurosci. Res. 16,479 -489.[CrossRef][Medline]
Guan, Z., Giustetto, M., Lomvardas, S., Kim, J. H., Miniaci, M. C., Schwartz, J. H., Thanos, D. and Kandel, E. R. (2002). Integration of long-term-memory-related synaptic plasticity involves bidirectional regulation of gene expression and chromatin structure. Cell 111,483 -493.[CrossRef][Medline]
Hernandez, M. C., Erkman, L., Matter-Sadzinski, L., Roztocil,
T., Ballivet, M. and Matter, J. M. (1995).
Characterization of the nicotinic acetylcholine receptor beta 3 gene. Its
regulation within the avian nervous system is effected by a promoter 143 base
pairs in length. J. Biol. Chem.
270,3224
-3233.
Inoue, T., Hojo, M., Bessho, Y., Tano, Y., Lee, J. E. and Kageyama, R. (2002). Math3 and NeuroD regulate amacrine cell fate specification in the retina. Development 129,831 -842.
Kanekar, S., Perron, M., Dorsky, R., Harris, W. A., Jan, L. Y., Jan, Y. N. and Vetter, M. L. (1997). Xath5 participates in a network of bHLH genes in the developing Xenopus retina. Neuron 19,981 -994.[CrossRef][Medline]
Kouzarides, T. (2002). Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12,198 -209.[CrossRef][Medline]
Litt, M. D., Simpson, M., Gaszner, M., Allis, C. D. and
Felsenfeld, G. (2001). Correlation between histone lysine
methylation and developmental changes at the chicken beta-globin locus.
Science 293,2453
-2455.
Marquardt, T., Ashery-Padan, R., Andrejewski, N., Scardigli, R., Guillemot, F. and Gruss, P. (2001). Pax6 is required for the multipotent state of retinal progenitor cells. Cell 105,43 -55.[CrossRef][Medline]
Matter, J. M., Matter-Sadzinski, L. and Ballivet, M. (1995). Activity of the beta 3 nicotinic receptor promoter is a marker of neuron fate determination during retina development. J. Neurosci. 15,5919 -5928.[Abstract]
Matter-Sadzinski, L., Hernandez, M. C., Roztocil, T., Ballivet, M. and Matter, J. M. (1992). Neuronal specificity of the alpha 7 nicotinic acetylcholine receptor promoter develops during morphogenesis of the central nervous system. EMBO J. 11,4529 -4538.[Medline]
Matter-Sadzinski, L., Matter, J. M., Ong, M. T., Hernandez, J. and Ballivet, M. (2001). Specification of neurotransmitter receptor identity in developing retina: the chick ATH5 promoter integrates the positive and negative effects of several bHLH proteins. Development 128,217 -231.[Abstract]
Morrow, E. M., Furukawa, T., Lee, J. E. and Cepko, C. L. (1999). NeuroD regulates multiple functions in the developing neural retina in rodent. Development 126, 23-36.[Abstract]
Prada, C., Puga, J., Perez-Mendez, L., Lopez, R. and Ramirez, G. (1991). Spatial and temporal patterns of neurogenesis in the chick retina. Eur. J. Neurosci. 3, 559-569.[CrossRef][Medline]
Roztocil, T., Matter-Sadzinski, L., Alliod, C., Ballivet, M. and Matter, J. M. (1997). NeuroM, a neural helix-loop-helix transcription factor, defines a new transition stage in neurogenesis. Development 124,3263 -3272.[Abstract]
Roztocil, T., Matter-Sadzinski, L., Gomez, M., Ballivet, M. and
Matter, J. M. (1998). Functional properties of the
neuronal nicotinic acetylcholine receptor beta3 promoter in the developing
central nervous system. J. Biol. Chem.
273,15131
-15137.
Sheppard, A. M., Konopka, M. and Jeffrey, P. L. (1988). Thy-1 expression in the retinotectal system of the chick. Brain Res. 471,49 -60.[Medline]
Sommer, L., Ma, Q. and Anderson, D. J. (1996). neurogenins, a novel family of atonal-related bHLH transcription factors, are putative mammalian neuronal determination genes that reveal progenitor cell heterogeneity in the developing CNS and PNS. Mol. Cell. Neurosci. 8,221 -241.[CrossRef][Medline]
Takahashi, Y., Rayman, J. B. and Dynlacht, B. D.
(2000). Analysis of promoter binding by the E2F and pRB families
in vivo: distinct E2F proteins mediate activation and repression.
Genes Dev. 14,804
-816.
Vetter, M. L. and Brown, N. L. (2001). The role of basic helix-loop-helix genes in vertebrate retinogenesis. Semin. Cell Dev. Biol. 12,491 -498.[CrossRef][Medline]
Wang, S. W., Kim, B. S., Ding, K., Wang, H., Sun, D., Johnson,
R. L., Klein, W. H. and Gan, L. (2001). Requirement
for math5 in the development of retinal ganglion cells. Genes
Dev. 15,24
-29.
Yan, R. T. and Wang, S. Z. (1998). neuroD induces photoreceptor cell overproduction in vivo and de novo generation in vitro. J. Neurobiol. 36,485 -496.[CrossRef][Medline]
Yang, Z., Ding, K., Pan, L., Deng, M. and Gan, L. (2003). Math5 determines the competence state of retinal ganglion cell progenitors. Dev. Biol. 264,240 -254.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. Hernandez, L. Matter-Sadzinski, D. Skowronska-Krawczyk, F. Chiodini, C. Alliod, M. Ballivet, and J.-M. Matter Highly Conserved Sequences Mediate the Dynamic Interplay of Basic Helix-Loop-Helix Proteins Regulating Retinogenesis J. Biol. Chem., December 28, 2007; 282(52): 37894 - 37905. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Y. Okitsu and C.-L. Hsieh DNA Methylation Dictates Histone H3K4 Methylation Mol. Cell. Biol., April 1, 2007; 27(7): 2746 - 2757. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Skowronska-Krawczyk, L. Matter-Sadzinski, M. Ballivet, and J.-M. Matter The Basic Domain of ATH5 Mediates Neuron-Specific Promoter Activity during Retina Development Mol. Cell. Biol., November 15, 2005; 25(22): 10029 - 10039. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Matter-Sadzinski, M. Puzianowska-Kuznicka, J. Hernandez, M. Ballivet, and J.-M. Matter A bHLH transcriptional network regulating the specification of retinal ganglion cells Development, September 1, 2005; 132(17): 3907 - 3921. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Hutcheson, M. I. Hanson, K. B. Moore, T. T. Le, N. L. Brown, and M. L. Vetter bHLH-dependent and -independent modes of Ath5 gene regulation during retinal development Development, February 15, 2005; 132(4): 829 - 839. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||