First published online September 1, 2004
doi: 10.1242/10.1242/dev.01315
Development 131, 4489-4500 (2004)
Published by The Company of Biologists 2004
Action of fat, four-jointed, dachsous and dachs in distal-to-proximal wing signaling
Eunjoo Cho and
Kenneth D. Irvine*
Howard Hughes Medical Institute, Waksman Institute and Department of
Molecular Biology and Biochemistry, Rutgers The State University of New
Jersey, Piscataway, NJ 08854, USA
*
Author for correspondence (e-mail:
irvine{at}waksman.rutgers.edu)
Accepted 15 June 2004
 |
SUMMARY
|
|---|
In the Drosophila wing, distal cells signal to proximal cells to
induce the expression of Wingless, but the basis for this distal-to-proximal
signaling is unknown. Here, we show that three genes that act together during
the establishment of tissue polarity, fat, four-jointed and
dachsous, also influence the expression of Wingless in the proximal
wing. fat is required cell autonomously by proximal wing cells to
repress Wingless expression, and misexpression of Wingless contributes to
proximal wing overgrowth in fat mutant discs. Four-jointed and
Dachsous can influence Wingless expression and Fat localization
non-autonomously, consistent with the suggestion that they influence signaling
to Fat-expressing cells. We also identify dachs as a gene that is
genetically required downstream of fat, both for its effects on
imaginal disc growth and for the expression of Wingless in the proximal wing.
Our observations provide important support for the emerging view that
Four-jointed, Dachsous and Fat function in an intercellular signaling pathway,
identify a normal role for these proteins in signaling interactions that
regulate growth and patterning of the proximal wing, and identify Dachs as a
candidate downstream effector of a Fat signaling pathway.
Key words: Fat, Cadherin, Limb, Growth, Drosophila
 |
Introduction
|
|---|
The wings and notum of the fly develop from clusters of undifferentiated
cells in the larva termed wing imaginal discs. The patterning and growth of
wing discs is governed by a series of regulatory interactions that have been
the subject of intensive study over the last decade (reviewed by
Lawrence and Struhl, 1996
;
Irvine and Rauskolb, 2001
;
Klein, 2001
). Studies of
signaling along the AP and DV axes have established paradigms for tissue
patterning, and have also been instrumental in the identification of many key
components of the Hedgehog, Notch, Wingless (WG; Wnt) and Decapentaplegic
(DPP; TGF-ß) signaling pathways. More recently, it has become clear that
normal wing development is also dependent upon signaling along the
proximodistal (PD) axis (Liu et al.,
2000
; del Álamo
Rodriguez et al., 2002
; Kolzer
et al., 2003
), but the identity of the genes that actually effect
signaling along this axis remains unknown.
There is a progressive elaboration of patterning along the PD axis over the
course of wing development (reviewed by
Klein, 2001
). During the
second larval instar, interactions among the Epidermal Growth Factor Receptor,
DPP and WG signaling pathways divide the wing disc into a dorsal region, which
will give rise to notum, and a ventral region, from which the wing will arise
(Ng et al., 1996
;
Baonza et al., 2000
;
Wang et al., 2000
;
Cavodeassi et al., 2002
;
Zecca and Struhl, 2002
). An
initial PD subdivision of the wing is then effected by signaling from the AP
and DV compartment boundaries, which promotes the expression of two genes,
scalloped and vestigial, that encode subunits of a
heterodimeric transcription factor (SD-VG) in the center of the wing
(Kim et al., 1995
;
Kim et al., 1996
;
Zecca et al., 1996
;
Neumann and Cohen, 1997
;
Halder et al., 1998
;
Klein and Martinez Arias,
1998
; Simmonds et al.,
1998
). This subdivides the wing into distal cells, which give rise
to the wing blade, and surrounding cells, which give rise to proximal wing and
wing hinge structures (Fig. 1) (Kim et al., 1996
;
Klein and Martinez Arias,
1998
; Azpiazu and Morata,
2000
; Casares and Mann,
2000
; Liu et al.,
2000
). The proximal wing is further subdivided into a series of
molecularly distinct domains (Fig.
1B). Studies of SD-VG function in the wing led to the realization
that the elaboration of this finer pattern depends in part upon signaling from
the distal, SD-VG-expressing cells, to more proximal cells
(Liu et al., 2000
). Thus,
mutation of vg leads to elimination, not only of the wing blade,
where VG is expressed, but also of more proximal tissue
(Williams et al., 1991
;
Williams et al., 1993
;
Klein and Martinez Arias,
1998
; Liu et al.,
2000
). Conversely, ectopic expression of VG in the proximal wing
reorganizes the patterning of surrounding cells
(Liu et al., 2000
;
del Álamo Rodriguez et al.,
2002
; Kolzer et al.,
2003
).

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 1. Proximodistal wing patterning. (A) Adult wing: distal (green), proximal
wing and hinge (blue), and WG-expressing cells (red). The boundary between
distal and proximal cells is an approximation. We adopt the term proximal wing
for the blue region, but note that this entire region is sometimes referred to
as the wing hinge. (B) Relative gene expression domains along the
proximodistal axis, related to C by the dashed lines. Although for simplicity
all genes are shown as having uniform expression levels, some are subject to
modulation within their spatial domains (this work)
(Williams et al., 1991 ;
Clark et al., 1995 ;
Villano and Katz, 1995 ;
Brodsky and Steller, 1996 ;
Ng et al., 1996 ;
Rieckhof et al., 1997 ;
Azpiazu and Morata, 2000 ;
Casares and Mann, 2000 ;
St Pierre et al., 2002 ;
Wu and Cohen, 2002 ;
Kolzer et al., 2003 ;
Whitworth and Russell, 2003 ).
(C) A wing imaginal disc, shaded as for the adult wing shown in A. Approximate
location of DPP-expressing cells (yellow) is also indicated.
|
|
A key target of the distal signal is WG, which during early third instar is
expressed in a ring of cells that surround the SD-VG-expressing cells
(Liu et al., 2000
;
del Álamo Rodriguez et al.,
2002
), and which later becomes expressed in a second, more
proximal ring (Fig. 1). WG
expression in the inner, distal ring within the proximal wing is regulated by
an enhancer called spade-flag (spd-fg), after an allele of
wg in which this enhancer is deleted
(Neumann and Cohen, 1996
).
Studies of this allele, together with ectopic expression experiments, revealed
that WG is necessary and sufficient to promote growth of the proximal wing
(Neumann and Cohen, 1996
;
Klein and Martinez Arias,
1998
). WG also plays a role in proximal wing patterning, as it
acts in a positive-feedback loop to maintain expression of Homothorax (HTH)
(Azpiazu and Morata, 2000
;
Casares and Mann, 2000
;
del Álamo Rodriguez et al.,
2002
). The rotund (rn) gene has been identified
as an additional target of distal signaling
(del Álamo Rodriguez et al.,
2002
).
In this work, we identify Four-jointed (FJ), Dachsous (DS), Fat and Dachs
as proteins that influence signaling to proximal wing cells to regulate WG and
rn expression. FJ is a type II transmembrane protein, which is
largely restricted to the Golgi (Villano
and Katz, 1995
; Brodsky and
Steller, 1996
; Buckles et al.,
2001
; Strutt et al.,
2004
). Null mutations in fj do not cause any obvious
defects in the proximal wing (Villano and
Katz, 1995
; Brodsky and
Steller, 1996
). However, fj plays a role in the
regulation of tissue polarity, yet acts redundantly with some other factor(s)
in this process (Zeidler et al.,
1999
; Zeidler et al.,
2000
; Casal et al.,
2002
). Mutations in fat or ds can also influence
tissue polarity (Adler et al.,
1998
; Casal et al.,
2002
; Rawls et al.,
2002
; Strutt and Strutt,
2002
; Yang et al.,
2002
; Ma et al.,
2003
), and both genes encode large protocadherins
(Mahoney et al., 1991
;
Clark et al., 1995
). Although
the molecular relationships among these proteins are not well understood,
genetic studies suggest that fj and ds act via effects on
fat, and both fj and ds can influence Fat
localization in genetic mosaics (Strutt
and Strutt, 2002
; Yang et al.,
2002
; Ma et al.,
2003
).
Interestingly, alleles of fj, ds and fat, as well as
alleles of another gene, dachs, can result in similar defects in wing
blade and leg growth (Mohr,
1923
; Waddington,
1943
). The similar requirements for these genes during both
appendage growth and tissue polarity, together with the expression patterns of
fj and ds in the developing wing, led us to investigate
their requirements for proximal wing development. We find that all four genes
influence the expression of WG in the proximal wing, and genetic experiments
suggest a pathway in which FJ and DS act to modulate the activity of Fat,
which then regulates transcription via a pathway that includes Dachs. Our
observations lend strong support to the hypothesis that FJ, DS and Fat
function as components of an intercellular signal transduction pathway,
implicate Dachs as a key downstream component of this pathway, and identify a
normal role for these genes in proximodistal patterning during
Drosophila wing development.
 |
Materials and methods
|
|---|
Drosophila stocks and clonal analysis
Mutations used were: fjd1
(Brodsky and Steller, 1996
),
fat8 (fatfd) and
fatG-rv (Bryant et al.,
1988
; Mahoney et al.,
1991
), dsUA071 and ds38k
(Clark et al., 1995
;
Adler et al., 1998
),
d210 and d1
(Buckles et al., 2001
),
wgspd-fg (Couso et
al., 1994
), vg83b27r
(Williams et al., 1990
) and
sd58 (Campbell et al.,
1991
). fat8 d1, fat8
vg83b27r, fatG-rv wgspd-fg and
fat8 wgspd-fg double mutant chromosomes were
generated by meiotic recombination; a fjd1
dsUA071 chromosome was a gift of D. Strutt
(Strutt et al., 2004
). UAS and
Gal4 transgenes used were: UAS-vg[49]
(Kim et al., 1996
);
UAS-fj[6a.2] and UAS-fj[146.3]
(Zeidler et al., 1999
);
UAS-GFP, AyGal4[17b] and AyGal4[5a] (actin>y+>Gal4)
(Ito et al., 1997
); and
GS-ds. GS-ds contains an insertion of the UAS-containing Gene Search
transposon (Toba et al.,
1999
), approximately 700 bp upstream of ds (flanking
sequence includes GTGTACAGTGAAGTGCGGAAAAGAGGTCGAGGGG), and was isolated in a
gain-of-function screen for genes that influence cell affinity in the wing (O.
Dunaevsky, C. Rauskolb and K.D.I., unpublished). Its influence on ds
expression was confirmed by in situ hybridization. Reporter genes employed
were spd-lacZ (Neumann and Cohen,
1996
), fj-lacZ[P1]
(Brodsky and Steller, 1996
),
rn-lacZ (St Pierre et al.,
2002
) and ds-lacZ
(Clark et al., 1995
). Mutant
clones were generated by mitotic recombination, and marked by the absence of a
MYC-tagged protein or GFP. They were induced at 24-48 and at 48-72 hours after
egg laying (AEL), and then allowed to grow for 48 or 72 hours, using the
following stocks:
- w; fjd1 FRT42D/CyO
- w; fat8 FRT40A/SM5-TM6b
- w; fat8 d1FRT40A/SM5-TM6b
- w; dsUA071 FRT40A/CyO act-GFP
- w; d1FRT40A/CyO
- w; d210FRT40A/CyO
- y w Flp, 2[
-Myc] FRT40A M
- y w Flp; 2[
-Myc] FRT40A
- y w Flp; Ubi-GFP FRT40A/CyO
- y w Flp: FRT42D arm-lacZ
- y w hs-FLP;gug35 FRT79E[2A]/TM6c
- w; FRT79E[2A] ubi-GFP:nls
- y w sd58 FRT18A/FM7
- 2{hs-
:MYC} FRT18A; hs-FLP Sb/TM6b
Clones of cells ectopically expressing genes of interest (Flip-out) were
generated by combining transgenes that provide expression under UAS control
with transgenes that allow the generation of clones of cells expressing the
Gal4 protein (AyGal4) (Ito et al.,
1997
). Gal4-expressing clones were marked using a UAS-GFP
transgene. Flip-out clones were induced at 24-48 and 48-72 hours AEL.
Immunostaining
Imaginal discs from third instar larvae were fixed and stained as
previously described (Liu et al.,
2000
), using as primary antibodies: rabbit anti-VG (1:600, S.
Carroll, University of Wisconsin-Madison), mouse anti-WG 4D4 (1:1000,
Developmental Studies Hybridoma Bank), mouse anti-NUB (1:100, S. Cohen,
European Molecular Biology Laboratory), rabbit anti-ß-gal (1:2000, ICN),
Goat anti-ß-gal (1:1000, Biogenesis), mouse anti-ß-gal (1:1000,
Sigma), rabbit anti-MYC (1:100, Santa Cruz), rat anti-MYC (1:1000, Serotec),
rat anti-DS (1:200, M. Simon, Stanford University) and rat anti-Fat (1:100, H.
McNeill, Cancer Research UK). For precise timing, larvae were collected in
intervals after the second to third instar molt, but in some cases ages were
estimated based on the size and morphology of the disc.
 |
Results
|
|---|
fat represses targets of distal-to-proximal signaling
The fat gene is expressed throughout the developing wing imaginal
disc (Mahoney et al., 1991
).
However, the expression and phenotypes of fj and ds
(described below), together with prior studies suggesting a functional
relationship among these genes, suggested that Fat might have a role in
proximal wing development. Indeed, the two known targets of distal signaling,
WG and rn, are both strongly upregulated within fat mutant
clones in the proximal wing (Fig.
2). The influence of fat on rn and WG is
strictly cell autonomous. This autonomous action suggests that Fat is not
involved in sending a signal to proximal wing cells, but might be regulated by
signals from neighboring cells.

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 2. fat mutant clones upregulate targets of distal-to-proximal
signalling. In this and subsequent figures, all panels show third instar wing
discs, oriented with ventral down and anterior left, and panels marked prime
show separate stains of the same disc. Clones of cells mutant for
fat8 are marked by the absence of MYC (green). Arrows
indicate clones with ectopic gene expression. Discs are stained for WG (red),
rn-lacZ (blue/white in C, red in E), spd-fg-lacZ (blue/white
in D, red in F), and NUB (blue). (A) Early third instar disc. (B) Late third
instar disc. (C) Mid-third instar disc. Ectopic WG expression is associated
with an expansion of the rn domain. (D) Mid-late third instar disc.
The spd-fg enhancer and endogenous WG are both ectopically expressed,
although differences in subcellular localization result in apparent
differences within a focal plane. (E) Late third instar disc with a
fat clone that extends beyond the NUB domain; arrows here point to
the edges of the clone where it extends proximally; rn is induced
only within NUB-expressing cells. (F) Mid-third instar disc with a
fat clone in the NUB domain with spd-fg-lacZ expression
(arrow), and a clone just proximal to this without spd-fg-lacZ
expression (asterisk).
|
|
WG expression is upregulated within fat mutant cells from early
third instar, when the distal ring is first discernible
(Fig. 2A), and continues to be
upregulated throughout larval development
(Fig. 2B). A
wgspd-fg-lacZ reporter line is also activated
within fat mutant clones, indicating that the regulation of
wg expression by Fat is effected through the spd-fg enhancer
(Fig. 2D,F). The induction of
WG and rn in fat mutant clones is not detected in the notum
or in the distal wing, and within the proximal wing it is limited to
NUB-expressing cells (Fig.
2E,F). Importantly, this temporal and spatial profile of WG
regulation by Fat, as well as its action through the spd-fg enhancer,
match that for the regulation of WG and rn by VG
(Liu et al., 2000
;
del Álamo Rodriguez et al.,
2002
). These observations suggest that the VG-dependent signal
might activate WG expression by inhibiting Fat activity.
To further examine this possibility, we analyzed vg fat double
mutants. vg mutant wing discs contain a single ring of WG expression,
which, based on the NUB expression domain, appears to correspond to the outer
WG ring (Fig. 3A)
(Liu et al., 2000
). Expression
of WG in the inner ring, which normally overlaps NUB, is either not detected
(8/14 discs), or is reduced to a small central spot (6/14 discs) in
vg mutants (Fig. 3A).
Importantly, in vg fat double mutants, WG expression is always
observed in the center of the disc (7/7 discs), and this expression is
substantially enlarged (Fig.
3B). The observation that mutation of fat can promote WG
expression even in the absence of VG is consistent with the hypothesis that
Fat is normally repressed downstream of a VG-dependent signal.

View larger version (134K):
[in this window]
[in a new window]
|
Fig. 3. WG expression in mutant discs. Late third instar discs, stained for WG
(red), with inner (arrow) and outer (arrowhead) rings marked. (A)
vg83b27r. (B) fat8
vg83b27r. (C) fjd1 dsUA071. (D)
fat8/fatG-rv. Because the disc is more
folded (see Fig. 4), WG
expression is only partially visible.
|
|
Ectopic WG contributes to proximal wing overgrowth in fat mutant discs
fat acts as a Drosophila tumor suppressor gene, and
fat mutants die after an extended larval stage, with overgrown
imaginal discs (Bryant et al.,
1988
; Mahoney et al.,
1991
; Garoia et al.,
2000
). Although fat can influence the growth of most, and
perhaps all imaginal cells, examination of fat mutant wing discs
nonetheless indicates that there is a disproportionate overgrowth of the
proximal wing, which is particularly evident in older larvae
(Bryant et al., 1988
;
Garoia et al., 2000
)
(Fig. 4B,G). The observation
that mutation of fat results in ectopic WG expression in the proximal
wing (Fig. 2), together with
the knowledge that ectopic WG expression promotes overproliferation of
proximal wing tissue (Neumann and Cohen,
1996
), suggested that the disproportionate overgrowth of the
proximal wing in fat mutants might be due to ectopic expression of
WG. To test this possibility, we recombined fat alleles with the
wgspd-fg allele. Indeed, disproportionate overgrowth of
the proximal wing disc is suppressed in fat mutant animals that also
carry wgspd-fg (Fig.
4D,H; compare with Fig.
4B,G). Thus, two distinct processes contribute to overgrowth in
fat mutant wing discs: a broad-based process that results in
enlargement of the entire disc, and a local upregulation of WG in the proximal
wing. This latter process emphasizes the importance of WG regulation by
fat to normal wing development.

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 4. wg and dachs are required for overgrowth in fat
mutant discs. Discs stained for VG (green) and NUB (magenta); discs shown in
A-F are at 36-48 hours of third instar, those in G-H are at 48-60 hours. Cells
that express only NUB correspond to the distal half of the proximal wing
(Fig. 1). (A) Wild-type. (B)
fat8/fatG-rv. (C)
wgspd-fg. (D) wgspd-fg
fat8/wgspd-fg fatG-rv. (E)
dachs1. (F) fat8 dachs1.
(G) fat8/fatG-rv disc, the overgrowth
of the proximal wing is even more pronounced at this age, and the wing becomes
highly folded. (H) wgspd-fg
fat8/wgspd-fg fatG-rv. Wild
type and fat8 dachs1 are not shown at this age,
as they begin to pupate. Scale bar in B: 80 µm for A-H.
|
|
Expression and regulation of four-jointed during wing development
Since SD-VG functions as a transcription factor, its non-autonomous
influence on gene expression in the proximal wing presumably results from the
regulation of target genes that effect or modulate intercellular signaling. FJ
has been reported to be expressed throughout the wing pouch (distal wing
primordia) of the wing disc at late third instar
(Villano and Katz, 1995
;
Brodsky and Steller, 1996
). In
order to investigate FJ as a potential contributor to distal-to-proximal
signaling, we first confirmed that its expression is similar to VG throughout
the third instar (Fig. 5A,C).
The only significant difference observed was that along the DV boundary,
expression of VG remains at high levels outside of the distal wing, whereas
fj expression drops to lower levels
(Fig. 5C). At early third
instar, WG expression is directly adjacent to fj and VG, but as the
wing grows they separate (Fig.
5E-G) (Klein and Martinez
Arias, 1998
; del Álamo
Rodriguez et al., 2002
; Kolzer
et al., 2003
). Because SD-VG is required for the growth and
viability of wing cells, clones of cells that are mutant for null alleles of
sd or vg fail to proliferate and die
(Kim et al., 1996
;
Liu et al., 2000
). However, in
clones of cells mutant for a hypomorphic allele of sd,
sd58, a reduction in fj expression is detectable
(Fig. 6A).

View larger version (129K):
[in this window]
[in a new window]
|
Fig. 5. Expression of four-jointed and dachsous during wing
development. Expression of VG (green), fj-lacZ (cyan),
ds-lacZ (green), DS (green) and WG (red) are shown. (A) Early (0-12
hours of third instar) disc, stained for VG and fj-lacZ. (B) Early
third instar disc, stained for ds-lacZ and WG. White bars identify WG
expression in the proximal wing. Images to the right of the dashed line show
different channels of vertical sections of the same disc. (C) Mid-late third
instar disc (24-36 hours) stained for VG and fj-lacZ. Asterisks
highlight proximal regions where VG expression remains elavated relative to
fj. (D) Early third instar disc, stained for DS and WG. DS protein is
predominantly apical (arrow). (E-G) Early (E), mid (F) and late (G) third
instar discs, stained for WG and fj-lacZ.
|
|

View larger version (107K):
[in this window]
[in a new window]
|
Fig. 6. Scalloped-Vestigial regulates four-jointed expression. (A)
Mid-third instar disc with sd58 clones, marked by the
absence of MYC (green), and stained for fj-lacZ (magenta). Arrows
indicate examples of clones with reduced fj expression. (B) Mid-late
third instar disc with VG-expressing clones, marked by GFP (green), and
stained for fj-lacZ (blue/white) and WG (red). Arrow indicates a
clone with ectopic fj.
|
|
To confirm that SD-VG is also sufficient to promote fj expression,
we examined the consequences of ectopic VG expression. Indeed, VG-expressing
clones are associated with induction of fj expression in the proximal
wing (Fig. 6B). However, the
induction of fj by ectopic VG sometimes occurs in a broader domain
that includes cells neighboring the VG-expressing clone. In the eye, FJ has
been reported to be able to induce the expression of fj in
neighboring cells (Zeidler et al.,
1999
). However, in the wing, ectopic expression of FJ does not
result in a detectable induction of fj expression
(Fig. 7A), nor does ectopic
expression of fj exert any detectable influence on VG expression
(Fig. 7B). Although the
mechanism by which FJ becomes induced non-autonomously is not known, our
results nonetheless indicate that FJ is a normal downstream target of VG in
the distal wing, and that it is expressed in association with ectopic VG in
the proximal wing.

View larger version (117K):
[in this window]
[in a new window]
|
Fig. 7. Four-jointed can influence gene expression in the proximal wing.
FJ-expressing clones are marked by GFP (green). (A) Late third instar disc,
stained for fj-lacZ (blue/white) and WG (red). Arrow points to a
clone that induces WG expression in flanking cells in the proximal wing. No
induction of fj occurs. (B) Mid-late third instar disc, stained for
VG (blue/white) and WG (red). Arrows point to clones that induce WG. No
induction of VG occurs. (C) Mid-third instar disc, stained for expression of
rn-lacZ (blue/white) and WG (red). Arrow indicates induction of WG
and rn flanking a clone. Their expression is also decreased within
the FJ-expressing cells. (D) Late third instar disc, stained for
rn-lacZ (blue) and WG (red). Arrows point to clones that alter WG
expression. (E) Mid-late third instar disc, stained for NUB (blue) and
spd-fg-lacZ (red). spd-fg-lacZ is induced only up to the
edge of the NUB domain, even though the clone (arrow) extends proximally.
Although spd-fg-lacZ expression is broader and more diffuse than
endogenous WG (Neumann and Cohen,
1996 ), it does not extend to the edge of NUB expression in the
absence of ectopic FJ. (F) Mid-third instar disc, stained for NUB (blue) and
rn-lacZ (red). rn-lacZ is induced only up to the edge of the
NUB domain, even though the clone (arrow) extends proximally. (G) Early third
instar disc, stained for Fat (magenta). Fat is tightly localized apically;
because the disc is not flat this figure is a composite projection of
different focal planes to allow visualization of Fat over a broad region. Fat
appears to be concentrated along the edge of the clone (arrow).
|
|
Ectopic four-jointed influences targets of the distal-to-proximal signal
If fj contributes to signaling from SD-VG-expressing distal cells,
then expression of FJ could be sufficient to induce the expression of targets
of the distal signal. Importantly then, clones of cells that ectopically
express FJ in the proximal wing can induce expression of both WG and
rn in neighboring cells (Fig.
7). Ectopic fj expression also results in downregulation
of WG expression within FJ-expressing cells
(Fig. 7B-D). Although virtually
all FJ-expressing clones (58/60 scored throughout third instar) effect at
least some modulation of WG expression, both the non-autonomous induction and
the autonomous repression of WG expression by fj are weaker than that
associated with ectopic VG expression in that: (1) modulation of WG expression
by FJ is more tightly restricted, and, in most cases, is only observed in
cells that are within or immediately adjacent to the endogenous WG stripe; (2)
when ectopic WG is observed more than a couple cells away from the endogenous
WG stripe, this ectopic WG is always weaker than endogenous WG; and (3) the
repression of endogenous WG within FJ-expressing cells is usually only
partial. By contrast, VG completely represses endogenous WG in the distal
ring, and often induces a strong ectopic expression of WG several cells away
from endogenous WG (Fig. 6B)
(Liu et al., 2000
;
del Álamo Rodriguez et al.,
2002
). Despite these differences, the spd-fg enhancer
also responds to FJ, both targets of distal signaling, rn and WG, are
similarly affected by FJ, and ectopic FJ is only able to modulate WG and
rn expression within the NUB-expressing cells in the distal half of
the proximal wing (Fig. 7). The
observations that FJ regulates the same genes, in the same place, and through
the same enhancer as VG suggest that FJ contributes to signaling from distal
cells. Similar reasoning (above) suggests that the distal signal acts through
Fat, and FJ has been suggested to influence Fat in regulating tissue polarity
(Strutt and Strutt, 2002
;
Yang et al., 2002
;
Ma et al., 2003
). Together
then, these observations imply that FJ influences WG and rn
expression by modulating Fat activity, and, consistent with this, ectopic FJ
expression also modulates Fat protein staining in the developing wing
(Fig. 7G).
Mutation of fj impairs the initiation of WG expression in the proximal wing
The proximal wing appears normal in fj null mutant animals
(Villano and Katz, 1995
;
Brodsky and Steller, 1996
).
Thus, if FJ contributes to distal signaling, it must do so redundantly.
Nonetheless, we considered the possibility that some reduction in WG
expression might be detectable in fj mutants. In order to enhance our
ability to detect subtle changes, WG was examined in fj genetic
mosaics. In this situation, regions of the disc composed of wild-type cells
provide an internal control for normal levels of staining. Importantly, at
early to mid third instar, WG expression in the distal ring was reduced in
cells adjacent to fj mutant distal wing cells
(Fig. 8A,B; 10/13 early discs
with clones had detectable alterations in WG expression). WG expression was
never completely eliminated, consistent with notion that FJ contributes to,
but is not absolutely required for, WG expression. The influence of FJ on WG
expression depended on the genotype of distal wing cells rather than proximal
wing cells (Fig. 8A,B),
consistent with the fj expression pattern
(Fig. 5). Intriguingly, WG
expression sometimes (7/32 clone edges) also appeared elevated in mutant cells
immediately adjacent to wild-type cells
(Fig. 8A). The altered
expression of WG indicates that FJ contributes to normal distal signaling, but
is not solely responsible for it.

View larger version (118K):
[in this window]
[in a new window]
|
Fig. 8. four-jointed influences the initiation of WG expression in the
proximal wing. fjd1 mutant clones, made using the
Minute technique and marked by absence of ß-galactosidase
(green). (A) Early third instar disc. WG expression is reduced within large
fj mutant clones (arrows). The requirement for fj is
non-autonomous, as fj mutant cells in the proximal wing express WG
normally (asterisk). Arrowhead identifies elevated WG expression in cells
immediately adjacent to wild-type cells. (B) Mid-third instar disc, arrows
point to reduced expression. (C) Mid-late third instar disc, with most tissue
mutant. WG expression is no longer noticeably reduced by absence of
fj (asterisk).
|
|
However, by late third instar, fj mutant clones are not associated
with any noticeable decrease in WG expression (>15 discs)
(Fig. 8C). That is, although
initiation of WG appears impaired, at later stages WG expression recovers.
This explains the normal development of the proximal wing in fj
mutants. This recovery also suggests that WG expression in the hinge is
regulated in two phases: an initiation phase that depends on distal signaling,
and a later maintenance phase that is independent of distal signaling.
Expression of dachsous during wing development
Studies of tissue polarity suggest a close functional relationship among
fj, fat and ds. ds is expressed preferentially by proximal
wing cells (Clark et al.,
1995
), but low levels have been reported in more distal cells
(Strutt and Strutt, 2002
;
Ma et al., 2003
). During third
instar, both DS protein expression and ds transcription, as detected
by a lacZ enhancer trap line, appear graded, with the highest levels
in proximal wing cells and the lowest levels in distal wing cells
(Fig. 5B,D). When the inner
ring of WG expression is first detected, at early third instar, it appears on
the slope of DS expression, with the highest levels of DS more proximal, and
the lowest levels of DS more distal.
dachsous influences WG expression in the proximal wing
Neither ds mutant discs (not shown), nor fj ds double
mutant discs (Fig. 3C), exhibit
obvious changes in WG expression, nor do they display the overgrowths of wing
tissue observed in fat mutants. Nonetheless, clones of cells mutant
for a strong ds allele, dsUA071, can exert a
subtle influence on WG expression. At early third instar, this influence is
most often detected as a slight decrease in WG within ds mutant
cells, and a slight increase in WG in wild-type cells that border the clone
(18/37 early to mid third instar clones revealed this effect)
(Fig. 9A), although in some
cases (8/37) WG expression appeared slightly elevated within mutant cells. At
late third instar a slight increase in WG expression is most often (19/35
clones) observed within ds mutant cells
(Fig. 9B), and a decrease in WG
expression is only rarely (3/35 clones) observed. Similarly, at early to mid
third instar, ectopic expression of DS was often (12/23 cases) associated with
upregulation of WG within DS-expressing cells at the edge of clones
(Fig. 9C), although
occasionally (4/23 cases) WG was upregulated in neighboring cells
(Fig. 9D). At late stages
elevation of WG expression in neighboring cells was observed (12/12 cases).
Although the influence of DS is complex (see Discussion), its ability to
modulate WG expression in the proximal wing is consistent with the suggestion
that it can influence Fat activity. It has been reported previously that Fat
localization is altered by ds mutant clones
(Strutt and Strutt, 2002
;
Ma et al., 2003
), and we find
that clones of cells ectopically expressing DS can also influence Fat
localization (Fig. 9F). To
investigate possible interactions between ds and fj, we also
examined clones of cells co-expressing both genes. These are associated with
non-autonomous upregulation of WG at all stages
(Fig. 9E).

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 9. Dachsous influences WG expression. Discs stained for WG (red), Fat
(magenta), MYC (green) or GFP (green). (A) Early third instar disc with
dsUA071 mutant clones, marked by absence of GFP. In some
cases, WG is relatively decreased within clones (asterisk), and relatively
increased in flanking wild-type cells (arrows). (B) Late third instar disc
with dsUA071 mutant clones, marked by the absence of MYC.
WG expression is increased within a clone (arrow). (C) Early to mid-third
instar disc with clone overexpressing DS, marked by GFP. WG appears elevated
in cells at the edge of the clone (arrows), and slightly decreased in more
internal cells. (D) Mid-third instar disc with clone overexpressing DS, marked
by GFP. Ectopic expression of WG is detectable outside the clone (arrows). (E)
Clone overexpressing DS and FJ, marked by GFP. Arrows point to examples of
ectopic WG. Asterisk indicates a region where WG expression is out of the
plane of focus. (F) Early-mid third instar with clones overexpressing DS,
stained for Fat. Image is a composite of projections through different focal
planes. Fat appears to accumulate at the clone border (arrow), and to be
depleted from neighboring cells.
|
|
grunge mutations do not affect WG expression in the proximal wing
A transcriptional co-repressor, Grunge (Atro), has been identified that
influences tissue polarity and can physically interact with the cytoplasmic
domain of Fat (Fanto et al.,
2003
). To investigate whether it functions in distal-to-proximal
signaling, we examined WG expression in gug35 mutant
clones in the wing. Although the clones exhibited other defects consistent
with previously described roles for gug
(Erkner et al., 2002
;
Zhang et al., 2002
), no
influence on WG expression in the proximal wing was detected
(Fig. 10A).

View larger version (88K):
[in this window]
[in a new window]
|
Fig. 10. Dachs is required for distal-to-proximal signalling. Discs stained for WG
(red), with mutant clones marked by the absence of MYC or GFP (green). Arrows
point to clones with reduced WG, asterisks mark clones with essentially normal
WG. (A) gug35 mutant clones. (B) Early third instar disc
with dachs1 Minute clones. (C) Mid-late third instar disc
with dachs1 clones. (D) Early third instar disc with
fat8 dachs1 clones. (E) Mid-third instar disc
with fat8 dachs1 clones. WG expression is still
reduced in these clones, but is starting to recover.
|
|
dachs is required for the initiation of WG expression in the proximal wing
Although dachs has not been reported to influence tissue polarity,
hypomorphic alleles of dachs can result in wing and leg phenotypes
similar to those of fj and ds, and dachs interacts
genetically with fj (Waddington,
1943
; Buckles et al.,
2001
). To determine whether dachs also influences
distal-to-proximal signaling, we first attempted to generate clones mutant for
a strong allele (d210), but were unable to recover any
mutant clones, even when we gave them a growth advantage by using the
Minute technique. As an alternative, we examined clones mutant for a
hypomorphic allele of dachs, d1. When examined at early
stages of wing development, these clones are always (7/7 clones) associated
with a dramatic reduction of WG expression in the proximal wing
(Fig. 10B). The reduction in
WG expression is cell autonomous, suggesting that dachs is required
for receiving, rather than sending, the distal signal. Intriguingly however,
later in third instar, WG expression partially recovers within dachs
mutant clones (17 clones, the older the disc the more normal WG staining
appears) (Fig. 10C). This
recovery suggests again that WG expression in the hinge is regulated by
distinct initiation and maintenance mechanisms.
dachs is epistatic to fat
dachs has recently been found to encode an unconventional myosin
(F. Katz, personal communication), and thus is presumably a cytoplasmic
protein. The autonomous influence of dachs on WG expression, together
with its presumed cytoplasmic location, suggested that it might act downstream
of fat. Since mutation of fat and mutation of dachs
have opposing effects on WG, this possibility could be tested genetically. In
d1 fat8 double mutant clones, the influence of
dachs on WG expression is epistatic, as clones in early third instar
discs exhibit the same reduction in WG expression that is observed in
d1 mutant clones (12/12 clones)
(Fig. 10D). At later stages,
WG expression partially recovers (18 clones), but at no time do the clones
exhibit significant ectopic WG expression
(Fig. 10E). Interestingly, the
dachs phenotype is also epistatic for the growth effects of
fat, as the overgrowth phenotype of fat mutant discs is
partially suppressed in animals that are also heterozygous for
d1 (data not shown), and completely suppressed in animals
that are homozygous for d1
(Fig. 4F).
 |
Discussion
|
|---|
Proximodistal patterning in the wing disc is reflected in a series of
concentric domains of gene expression. The initial expression of many of these
genes is known or thought to occur in response to WG and DPP, which can act
together to promote distal fates and repress proximal fates (reviewed by
Mann and Morata, 2000
;
Klein, 2001
). However,
important aspects of wing patterning rely on signaling from distal cells to
proximal cells. In this work, we have identified a set of genes that influence
this process, and provide genetic evidence that in doing so they act as
components of an intercellular signal transduction pathway. Studies described
here and elsewhere suggest that Fat functions as a key component in this
pathway, which is regulated by FJ and DS, and which then modulates
transcription via intracellular pathways that include Grunge and/or Dachs
(Fig. 11A).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 11. Models for Fat and distal-to-proximal signalling. (A) Analysis of WG
regulation, together with studies of tissue polarity, imply that Fat activity
is modulated by the juxtaposition of cells with different levels of FJ or DS
activity. Both normal expression patterns and analysis of genetic mosaics
imply that at FJ expression borders, Fat is inhibited in cells with less FJ,
and activated in cells with more FJ. The effects of DS are more variable, but
in some cases Fat is inhibited in cells with more DS, and activated in cells
with less DS. Fat functions normally to inhibit WG expression. As Dachs is
required for WG, and is epistatic to Fat, the simplest genetic pathway would
have Fat antagonizing Dachs activity. Fat regulates some processes via Grunge;
however, it is not currently known whether these also require Dachs. (B) SD-VG
specifies distal wing fate, and is regulated by Notch, WG and DPP signaling.
We hypothesize that FJ acts redundantly with some other gene (X), which would
also be regulated by SD-VG, and which would also act through Fat to regulate
WG in the proximal wing. We further suggest that DS might be repressed by WG
and DPP independently of SD-VG regulation, providing an additional input into
Fat signaling. Induction of WG also appears to require NUB, and to be
repressed distally.
|
|
The Fat signaling pathway
The argument that fj, ds and fat function together is
supported by the observation that they share common phenotypes in many
different processes, including proximodistal growth of legs and wings, tissue
polarity, and, as shown here, distal-to-proximal wing signaling. In addition,
both FJ and DS can influence Fat protein staining
(Strutt and Strutt, 2002
;
Yang et al., 2002
;
Ma et al., 2003
) (Figs
7,
9). The possibility that they
act as components of an intercellular signaling pathway has been suggested
based on studies of tissue polarity, but, at the same time, the nature of
tissue polarity has complicated attempts to assign distinct roles for these
genes in signaling versus receiving cells. Particularly important then, is the
identification of transcriptional outputs of Fat signaling. We have identified
here two genes, wg and rn, that are influenced
non-autonomously by FJ and cell autonomously by Fat in the proximal wing.
Similarly, expression of fj itself is influenced non-autonomously by
FJ (Zeidler et al., 1999
) and
cell autonomously by Fat (Yang et al.,
2002
) in the eye, and Serrate expression is influenced
non-autonomously by FJ (Buckles et al.,
2001
) and cell autonomously by Fat (E.C. and K.D.I., unpublished)
in the leg. The observation that four different genes in three different
tissues are each influenced non-autonomously by FJ and cell autonomously by
Fat suggests strongly that FJ and Fat have common roles on the sending and
receiving sides, respectively, of a broadly deployed intercellular signaling
pathway. The identification of a normal developmental event in which one
population of cells (distal wing) signals to adjacent cells (proximal wing)
via these genes adds further support to this argument, and, at the same time,
provides a developmental context for further identifying and characterizing
roles of pathway components.
Regulation of Fat activity
The common feature of all of our manipulations of FJ and DS expression is
that WG expression, and by inference, Fat activity, can be altered when cells
with different levels of FJ or DS are juxtaposed. In the case of FJ, its
normal expression pattern, mutant clones and ectopic expression clones are all
consistent with the interpretation that juxtaposition of cells with different
levels of FJ is associated with inhibition of Fat in the cells with less FJ
and activation of Fat in the cells with more FJ
(Fig. 11A). The influence of
DS, however, is more variable. Studies of tissue polarity in the eye suggested
that DS inhibits Fat activity in DS-expressing cells, and/or promotes Fat
activity in neighboring cells (Yang et
al., 2002
). The predominant effect of DS during early wing
development is consistent with this, but its effects in late discs are not.
Studies of tissue polarity in the abdomen suggest that the DS gradient might
be interpreted differently by anterior versus posterior cells
(Casal et al., 2002
), and it is
possible that a similar phenomena causes the effects of DS to vary during wing
development.
The influence of ds mutation on gene expression and growth in the
wing is much weaker than that of fat. It has been suggested that FJ
might influence Fat via effects on DS
(Yang et al., 2002
), and
fj mutant clones have been observed to influence DS protein staining
(Strutt and Strutt, 2002
;
Ma et al., 2003
). Our
observations are consistent with the inference that both DS and FJ can
regulate Fat activity, but they do not directly address the question of
whether FJ acts through DS. They do, however, indicate that even the combined
effects of FJ and DS cannot account for FAT regulation, and, assuming that the
strongest available alleles are null, other regulators of Fat activity must
exist. It is presumably because of the counteracting influence of these other
regulators that alterations in FJ and DS expression have relatively weak
effects. In addition, according to the hypothesis that Fat activity is
influenced by relative rather than absolute levels of its regulators, the
effects of FJ or DS could be expected to vary depending upon their temporal
and spatial profiles of expression, as well as on the precise shape and
location of clones.
Downstream signaling
Our observations, together with those of Fanto et al.
(Fanto et al., 2003
), imply
the existence of at least two intracellular branches of the Fat signaling
pathway (Fig. 11A). One branch
involves the transcriptional repressor Grunge, influences tissue polarity,
certain aspects of cell affinity, and fj expression, but does not
influence growth or WG expression. An alternative branch does not require
Grunge, but does require Dachs. Dachs is implicated as a downstream component
of the Fat pathway, based on its cell autonomous influence on Fat-dependent
processes, and by genetic epistasis. The determination that it encodes an
unconventional myosin (F. Katz, personal communication), and hence presumably
a cytoplasmic protein, is consistent with this possibility. It also suggests
that it does not itself function as a transcription factor, and hence implies
the existence of other components of this branch of the Fat pathway. This
Grunge-independent branch influences WG expression in the proximal wing and
imaginal disc growth. However, further studies will be required to determine
whether Dachs functions solely in Grunge-independent Fat signaling, or whether
instead Dachs is required for all Fat signaling.
Distal-to-proximal signaling in the wing
The observations that fj expression is regulated by SD-VG, and
that fj is both necessary and sufficient to modulate the distal ring
of WG expression in the proximal wing, suggest that FJ influences the activity
of a distal signal, which then acts to influence Fat activity
(Fig. 11B). However, the
relatively weak effects of fj indicate that other factors must also
contribute to distal signaling (X in Fig.
11B), just as fj functions redundantly with other factors
to influence tissue polarity. As DS expression is downregulated in a domain
that is broader than the VG expression domain, a direct influence of VG on the
DS gradient is unlikely, and the essentially normal appearance of WG
expression in the proximal wing in fj ds double mutants implies that
DS is not a good candidate for Signal X. Rather, we suggest that DS acts in
parallel to signaling from VG-expressing cells to modulate Fat activity. This
VG-independent effect would account for the remnant of the distal ring that
sometimes appears in vg null mutants
(Fig. 3A)
(Liu et al., 2000
).
Importantly though, the observation that the phenotypes of hypomorphic
dachs mutant clones on WG expression are more severe than fj
and ds suggests that the hypothesized additional factors also act via
the Fat pathway. We also note that the limitation of WG expression to the
proximal wing even in fat mutant clones implies that wg
expression both requires NUB, and is actively repressed by distally-expressed
genes (Fig. 11B).
The recovery of normal WG expression by later stages in both fj
and dachs mutant clones implies that the maintenance of WG occurs by
a distinct mechanism. Prior studies have identified a positive-feedback loop
between WG and HTH that is required to maintain their expression
(Azpiazu and Morata, 2000
;
Casares and Mann, 2000
;
del Álamo Rodriguez et al.,
2002
). We suggest that once this feedback loop is initiated, Fat
signaling is no longer required for WG expression. Moreover, the recovery of
normal levels of WG at late stages suggests that this positive-feedback loop
can amplify reduced levels of WG to near normal levels.
The distinct consequences of VG expression and FJ expression in clones in
the proximal wing suggest that another signal or signals, which are
qualitatively distinct from the FJ-dependent signal, is also released from
VG-expressing cells. When VG is ectopically expressed, WG is often induced in
a ring of expression that completely encircles it
(Liu et al., 2000
). However,
this is not the case for FJ-expressing clones. Both VG- and FJ-expressing
clones can activate rn and wg only within NUB-expressing
cells, but VG expression can result in non-autonomous expansion of the NUB
domain, and this expansion presumably facilitates the expression of WG by
surrounding cells (Liu et al.,
2000
; del Álamo
Rodriguez et al., 2002
;
Baena-Lopez and Garcia-Bellido,
2003
). Another striking difference between VG- and FJ-expressing
clones is that in the case of ectopic FJ, enhanced WG expression is only in
adjacent cells. By contrast, in the case of VG, WG expression initiates in
neighboring cells, but often moves several cells away as the disc grows,
resulting in a gap between VG and WG expression. This gap suggests that a
repressor of WG expression becomes expressed there, and recent studies have
identified Defective proventriculus (DVE) as such a repressor
(Kolzer et al., 2003
).
Growth regulation by the Fat signaling pathway
In strong fat mutants, the wing discs become enlarged and have
extra folds and outgrowths in the proximal wing
(Bryant et al., 1988
;
Garoia et al., 2000
). The
disproportionate overgrowth of the proximal wing is due to upregulation of WG
in this region, as demonstrated by its suppression by
wgspd-fg (Fig.
4). At the same time, clones of cells mutant for fat
overgrow in other imaginal cells, and fat wgspd-fg discs
are still enlarged compared with wild-type discs. Thus, Fat appears to act
both by regulating the expression of other signaling pathways (e.g. WG), and
via its own, novel growth pathway. The identification of additional components
of this pathway will offer new approaches for investigating its profound
influence on disc growth.
 |
ACKNOWLEDGMENTS
|
|---|
We thank P. Adler, M. Brodsky, S. Cohen, F. Katz, S. Kerridge, H. McNeill,
N. Perrimon, C. Rauskolb, M. Simon, H. Steller, S. St. Pierre, D. Strutt, R.
Whittle, M. Zeidler, The Developmental Studies Hybridoma Bank and The
Bloomington Stock Center for antibodies and Drosophila stocks; F.
Katz for sharing unpublished observations; T. Correia and O. Dunaevsky for
technical assistance; and R. Mann, H. McNeill and C. Rauskolb for comments on
the manuscript. This work was supported by the Howard Hughes Medical Institute
and by ACS grant RPG-99-190-01-DDC.
 |
REFERENCES
|
|---|
Adler, P. N., Charlton, J. and Liu, J. (1998).
Mutations in the cadherin superfamily member gene dachsous cause a tissue
polarity phenotype by altering frizzled signaling.
Development 125,959
-968.[Abstract]
Azpiazu, N. and Morata, G. (2000). Function and
regulation of homothorax in the wing imaginal disc of Drosophila.
Development 127,2685
-2693.[Abstract]
Baena-Lopez, L. A. and Garcia-Bellido, A.
(2003). Genetic requirements of vestigial in the regulation of
Drosophila wing development. Development
130,197
-208.[Abstract/Free Full Text]
Baonza, A., Roch, F. and Martin-Blanco, E.
(2000). DER signaling restricts the boundaries of the wing field
during Drosophila development. Proc. Natl. Acad. Sci.
USA 97,7331
-7335.[Abstract/Free Full Text]
Brodsky, M. H. and Steller, H. (1996).
Positional information along the dorsal-ventral axis of the Drosophila eye:
graded expression of the four-jointed gene. Dev. Biol.
173,428
-446.[CrossRef][Medline]
Bryant, P. J., Huettner, B., Held, L. I., Jr, Ryerse, J. and
Szidonya, J. (1988). Mutations at the fat locus interfere
with cell proliferation control and epithelial morphogenesis in Drosophila.
Dev. Biol. 129,541
-554.[CrossRef][Medline]
Buckles, G. R., Rauskolb, C., Villano, J. L. and Katz, F. N.
(2001). Four-jointed interacts with dachs, abelson and enabled
and feeds back onto the Notch pathway to affect growth and segmentation in the
Drosophila leg. Development
128,3533
-3542.
Campbell, S. D., Duttaroy, A., Katzen, A. L. and Chovnick,
A. (1991). Cloning and characterization of the scalloped
region of Drosophila melanogaster. Genetics
127,367
-380.[Abstract]
Casal, J., Struhl, G. and Lawrence, P. (2002).
Developmental compartments and planar polarity in Drosophila. Curr.
Biol. 12,1189
-1198.[CrossRef][Medline]
Casares, F. and Mann, R. S. (2000). A dual role
for homothorax in inhibiting wing blade development and specifying proximal
wing identities in Drosophila. Development
127,1499
-1508.[Abstract]
Cavodeassi, F., Rodriguez, I. and Modolell, J.
(2002). Dpp signalling is a key effector of the wing-body wall
subdivision of the Drosophila mesothorax. Development
129,3815
-3823.
Clark, H. F., Brentrup, D., Schneitz, K., Bieber, A., Goodman,
C. and Noll, M. (1995). Dachsous encodes a member of
the cadherin superfamily that controls imaginal disc morphogenesis in
Drosophila. Genes Dev.
9,1530
-1542.[Abstract/Free Full Text]
Couso, J. P., Bishop, S. A. and Martinez Arias, A.
(1994). The wingless signalling pathway and the patterning of the
wing margin in Drosophila. Development
120,621
-636.[Abstract]
del Álamo Rodriguez, D., Terriente, J., Galindo, M. I.,
Couso, J. P. and Diaz-Benjumea, F. J. (2002).
Different mechanisms initiate and maintain wingless expression in the
Drosophila wing hinge. Development
129,3995
-4004.[Abstract/Free Full Text]
Erkner, A., Roure, A., Charroux, B., Delaage, M., Holway, N.,
Core, N., Vola, C., Angelats, C., Pages, F., Fasano, L. et al.
(2002). Grunge, related to human Atrophin-like proteins, has
multiple functions in Drosophila development.
Development 129,1119
-1129.[Abstract/Free Full Text]
Fanto, M., Clayton, L., Meredith, J., Hardiman, K., Charroux,
B., Kerridge, S. and McNeill, H. (2003). The
tumor-suppressor and cell adhesion molecule Fat controls planar polarity via
physical interactions with Atrophin, a transcriptional co-repressor.
Development 130,763
-774.[Abstract/Free Full Text]
Garoia, F., Guerra, D., Pezzoli, M. C., Lopez-Varea, A.,
Cavicchi, S. and Garcia-Bellido, A. (2000). Cell
behaviour of Drosophila fat cadherin mutations in wing development.
Mech. Dev. 94,95
-109.[CrossRef][Medline]
Halder, G., Polaczyk, P., Kraus, M. E., Hudson, A., Kim, J.,
Laughon, A. and Carroll, S. (1998). The Vestigial and
Scalloped proteins act together to directly regulate wing-specific gene
expression in Drosophila. Genes Dev.
12,3900
-3909.[Abstract/Free Full Text]
Irvine, K. D. and Rauskolb, C. (2001).
Boundaries in development: formation and function. Annu. Rev. Cell
Dev. Biol. 17,189
-214.[CrossRef][Medline]
Ito, K., Awano, W., Suzuki, K., Hiromi, Y. and Yamamoto, D.
(1997). The Drosophila mushroom body is a quadruple structure of
clonal units each of which contains a virtually identical set of neurones and
glial cells. Development
124,761
-771.[Abstract]
Kim, J., Irvine, K. D. and Carroll, S. B.
(1995). Cell recognition, signal induction, and symmetrical gene
activation at the dorsal-ventral boundary of the developing Drosophila wing.
Cell 82,795
-802.[CrossRef][Medline]
Kim, J., Sebring, A., Esch, J. J., Kraus, M. E., Vorwerk, K.,
Magee, J. and Carroll, S. B. (1996). Integration of
positional signals and regulation of wing formation and identity by Drosophila
vestigial gene. Nature
382,133
-138.[CrossRef][Medline]
Klein, T. (2001). Wing disc development in the
fly: the early stages. Curr. Opin. Genet. Dev.
11,470
-475.[CrossRef][Medline]
Klein, T. and Martinez Arias, A. (1998).
Different spatial and temporal interactions between Notch, wingless, and
vestigial specify proximal and distal pattern elements of the wing in
Drosophila. Dev. Biol.
194,196
-212.[CrossRef][Medline]
Kolzer, S., Fuss, B., Hoch, M. and Klein, T.
(2003). defective proventriculus is required for pattern
formation along the proximodistal axis, cell proliferation and formation of
veins in the Drosophila wing. Development
130,4135
-4147.[Abstract/Free Full Text]
Lawrence, P. A. and Struhl, G. (1996).
Morphogens, compartments, and pattern: lessons from drosophila?
Cell 85,951
-961.[CrossRef][Medline]
Liu, X., Grammont, M. and Irvine, K. D. (2000).
Roles for scalloped and vestigial in regulating cell affinity and interactions
between the wing blade and the wing hinge. Dev. Biol.
228,287
-303.[CrossRef][Medline]
Ma, D., Yang, C. H., McNeill, H., Simon, M. A. and Axelrod, J.
D. (2003). Fidelity in planar cell polarity signalling.
Nature 421,543
-547.[CrossRef][Medline]
Mahoney, P. A., Weber, U., Onofrechuk, P., Biessmann, H.,
Bryant, P. J. and Goodman, C. S. (1991). The fat tumor
suppressor gene in Drosophila encodes a novel member of the cadherin gene
superfamily. Cell 67,853
-868.[CrossRef][Medline]
Mann, R. S. and Morata, G. (2000). The
developmental and molecular biology of genes that subdivide the body of
Drosophila. Annu. Rev. Cell Dev. Biol.
16,243
-271.[CrossRef][Medline]
Mohr, O. L. (1923). Modifications of the
sex-ratio through a sex-linked semi-lethal in Drosophila melanogaster (besides
notes on an autosomal section deficiency). In Studia Mendeliana Ad
centesimum diem natalem Gregorii Mendelii a grata patria
celebrandum, pp. 266-287. Brunn,
Czechoslovakia: Apud Typos.
Neumann, C. J. and Cohen, S. M. (1996).
Distinct mitogenic and cell fate specification functions of wingless in
different regions of the wing. Development
122,1781
-1789.[Abstract]
Neumann, C. J. and Cohen, S. M. (1997).
Long-range action of Wingless organizes the dorsal-ventral axis of the
Drosophila wing. Development
124,871
-880.[Abstract]
Ng, M., Diaz-Benjumea, F. J., Vincent, J. P., Wu, J. and Cohen,
S. M. (1996). Specification of the wing by localized
expression of wingless protein. Nature
381,316
-318.[CrossRef][Medline]
Rawls, A. S., Guinto, J. B. and Wolff, T.
(2002). The cadherins fat and dachsous regulate dorsal/ventral
signaling in the Drosophila eye. Curr. Biol.
12,1021
-1026.[CrossRef][Medline]
Rieckhof, G. E., Casares, F., Ryoo, H. D., Abu-Shaar, M. and
Mann, R. S. (1997). Nuclear translocation of
extradenticle requires homothorax, which encodes an extradenticle-related
homeodomain protein. Cell
91,171
-183.[CrossRef][Medline]
Simmonds, A. J., Liu, X., Soanes, K. H., Krause, H. M., Irvine,
K. D. and Bell, J. B. (1998). Molecular interactions
between Vestigial and Scalloped promote wing formation in Drosophila.
Genes Dev. 12,3815
-3820.[Abstract/Free Full Text]
St Pierre, S. E., Galindo, M. I., Couso, J. P. and Thor, S.
(2002). Control of Drosophila imaginal disc development by rotund
and roughened eye: differentially expressed transcripts of the same gene
encoding functionally distinct zinc finger proteins.
Development 129,1273
-1281.[Abstract/Free Full Text]
Strutt, H. and Strutt, D. (2002). Nonautonomous
planar polarity patterning in Drosophila: dishevelled-independent functions of
frizzled. Dev. Cell 3,851
-863.[CrossRef][Medline]
Strutt, H., Mundy, J., Hofstra, K. and Strutt, D.
(2004). Cleavage and secretion is not required for Four-jointed
function in Drosophila patterning. Development
131,881
-890.[Abstract/Free Full Text]
Toba, G., Ohsako, T., Miyata, N., Ohtsuka, T., Seong, K. H. and
Aigaki, T. (1999). Th