|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 25 August 2004
doi: 10.1242/dev.01340
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Wellcome Trust/Cancer Research UK Gurdon Institute and Department of Zoology, University of Cambridge, Tennis Court Road, Cambridge CB2 1QR, UK
* Author for correspondence (e-mail: f.wardle{at}gurdon.cam.ac.uk)
Accepted 2 July 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Single cell RT-PCR, Xenopus, Heterogeneous, Activin, Germ layer
| Introduction |
|---|
|
|
|---|
This developmental precision requires that the spatial and temporal
expression patterns of genes involved in germ layer specification are
themselves tightly regulated. How does this regulation occur? Cell
transplantation experiments suggest that it is a gradual process. Cells of the
vegetal region become committed to an endodermal fate through the action of
the localised maternally encoded transcription factor VegT
(Clements et al., 1999
;
Xanthos et al., 2001
;
Yasuo and Lemaire, 1999
;
Zhang et al., 1998
). However,
although these cells are specified to form endoderm from early in development,
they are not completely committed to this fate until the early gastrula stage
(Heasman et al., 1984
;
Wylie et al., 1987
).
Similarly, transplantation experiments reveal that animal cells also become
committed to an ectodermal fate only gradually
(Domingo and Keller, 2000
;
Snape et al., 1987
), and
indeed they are capable of changing their state of specification in response
to mesoderm-inducing factors until gastrula stages
(Heasman, 1997
;
Kimelman and Griffin, 2000
).
And most remarkably, equatorial cells, which become specified as mesoderm in
response to signals derived from the vegetal hemisphere of the embryo, do not
become irrevocably committed to their fate until the end of gastrulation
(Godsave and Slack, 1991
;
Kato and Gurdon, 1993
).
Many genes have been identified that are expressed in these different
regions of the embryo. Sox17
, for example, is expressed in the
prospective endoderm, the vegetal mass, at the early gastrula stage
(Hudson et al., 1997
), and
Goosecoid is expressed in prospective anterior mesendoderm
(Cho et al., 1991
). In this
paper, we use in situ hybridization and single-cell RT-PCR in an attempt to
understand when the expression patterns of such genes become restricted. Our
results at the early gastrula stage reveal a large number of cells expressing
the `wrong' gene in the `wrong' place. For example, in situ hybridization and
single cell RT-PCR reveal that in the early gastrula Goosecoid is
expressed in significant numbers of ventral, Xwnt8-expressing cells,
as well as in dorsal tissue, and Sox17
expression can be found
in cells of the marginal zone as well as vegetal cells. In contrast, at the
late gastrula stage very few of these `rogue' cells can be detected. Indeed,
by late gastrula stages, the gene expression profiles of cells within the same
region of the embryo have refined significantly, and the profiles of cells
become more characteristic of their germ layer membership. Thus, these results
reflect at the level of gene expression the embryological observation that
cells of the early Xenopus gastrula become progressively and
asynchronously committed to a specific germ layer.
In addition, we show that when ectodermal cells are exposed to the mesendoderm-inducing factor Activin, single cells respond by activating markers of both endoderm and mesoderm in the same cell, as well as markers of ventral and dorsal mesoderm. They thus recapitulate the gene combinations seen in the marginal zone of an early gastrula embryo.
| Materials and methods |
|---|
|
|
|---|
Explants were dissociated in calcium-magnesium free medium (CMFM)
(Sive et al., 2000
). Single
cells were picked in 0.5 µl of CMFM using a P2 pipette, transferred into
4.75 µl lysis mix [1xPCR buffer (Roche), 1.5 mM MgCl2,
0.005% Igepal, 5 mM DTT, 0.05 mM dNTPs, 0.2 ng/µl anchor primer
(TATAGAATTCGCGGCCGCTCGCGAT24; PAGE purified), 0.3 U/µl Prime
RNase Inhibitor (Eppendorf) and 0.4 U/µl RNase Inhibitor (Roche)] in
thin-walled PCR tubes or 96-well plates, and then subjected to RT-PCR
described below. Medium (0.5 µl) was taken as a cell-free control for each
sample.
Cells were dissociated from whole explants and picked for RT-PCR within 15
minutes to minimize the effects of dissociation on gene expression. Cells from
ectodermal explants were taken from the inner layer only, as the outer layer
is more resistant to dissociation. Explants contained between
200 cells
(endodermal explant, stage 10; endodermal cells are larger than marginal or
animal cells) and
1000 cells (marginal zone explants, stage 12). For the
experiments described in Fig.
6, ectodermal explants were isolated at stage 10 and incubated in
20 U/ml Activin protein (Cooke et al.,
1987
) for up to 4 hours. Explants collected at different time
points were dissociated in CMFM and handled as described above.
|
Single cell RT-PCR
PCR tubes containing lysed cells were heated to 65°C for 1 minute then
0.25 µl of RT mix [133 U/µl Superscript II (Invitrogen), 1.7 U/µl
Prime RNase Inhibitor (Eppendorf), 2.2 U/µl RNase Inhibitor (Roche), 1.1
µg/µl T4 gene 32 product (Roche)] was added to each tube. The RT
reaction was incubated at 37°C for 90 minutes, 50°C for 50 minutes,
then heat inactivated at 65°C for 10 minutes. Next, 5 µl of tailing mix
[1xPCR buffer (Roche), 1.5 mM MgCl2, 3 mM dATP, 0.75 U/µl
rTdT (Invitrogen), 0.05 U/µl RNaseH (Roche)] was added to each tube and the
reaction incubated at 37°C for 20 minutes, then heat inactivated at
65°C for 10 minutes. Carrying out reverse transcription and terminal
transferase reactions in PCR buffer increased the efficiency of these
reactions compared to using standard RT and TdT buffers. PCR mix (100 µl)
[1xTaq buffer (Takara), 0.25 mM dNTPs, 20 ng/µl anchor primer, 0.05
U/µl EX Taq Polymerase (Takara)] was then added to each tube and incubated
as follows: 95°C, 2 minutes; 37°C, 5 minutes; 72°C, 20 minutes;
then 40 cycles of 95°C 30 seconds; 67°C, 1 minute; 72°C, 6 minutes
plus 6 seconds extension for each cycle; then 72°C, 10 minutes. cDNA (5
µl) from each reaction was run on a 2% agarose gel to check for
amplification and integrity. cDNA (5 µl) from each reaction was then
Southern blotted and/or dot blotted, and probed for each marker using standard
protocols (Saitou et al.,
2002
; Sambrook et al.,
1989
). Samples showed the same gene expression profile regardless
of whether the cDNA was Southern or dot blotted, and most samples were
therefore dot blotted for experimental convenience.
For the split cell lysate assay, 36 single cells were picked from four
regions of the embryo and the cell lysate was split equally between 2 tubes (A
and B samples; Fig. 2). Each
sample was then subjected to RT-PCR, dot blotted and probed for up to 8
markers. For spiking experiments, single cell lysates were spiked with
2x106pg, 2x105pg,
1x104pg, 2x104pg,
1x103pg, 2x103pg and
1x102pg of polyadenylated eGFP mRNA in 1 µl of
water and subjected to single cell RT-PCR as described. These correspond to
1, 10, 50, 100, 500, 1000 and 5000 transcripts, respectively. Ten
transcripts are reliably detected by this method.
Fig. 4 shows a dot blot where
samples from two separate RT-PCR reactions were analyzed at the same time.
|
|
, which are frequently used as loading
controls in experiments studying gene expression in Xenopus. This is
because if more than 100 transcripts (as assayed by spiking experiments) of an
mRNA are present in the reaction, the signal no longer falls within the linear
range (Fig. 4).
RNA isolation and real-time RT-PCR
Total RNA used as a template for real-time RT-PCR in the LightCycler
instrument (Roche) was prepared from five pooled ectodermal explants as
described (Trindade et al.,
2003
). Primers and PCR conditions for Xbra, Mix.1 and
Sox17
were as described
(Kofron et al., 1999
;
Xanthos et al., 2001
).
XK70A primers were: 5' CGACCACCAGTCTTTGGAGTATAAG (forward) and
5' TCGGATGCGTTATCCCTAAGG (reverse). PCR conditions for XK70A
were as follows: melting temperature, 95°C; annealing temperature/time,
58°C/10 seconds; extension temperature/time, 72°C/10 seconds;
acquisition temperature/time, 83°C/3 seconds.
| Results |
|---|
|
|
|---|
and Xwnt8 at early gastrula stages
|
, which is expressed strongly in the vegetal mass, was
also seen to stray into the marginal zone at stage 10-10.5 (40%;
n=35; Fig. 1) with no
clear boundary of expression. When embryos are bisected horizontally these
cells are adjacent to Sox17
non-expressing marginal zone
cells.
Single cells express a combination of germ layer markers at the start of gastrulation
These observations were confirmed by assaying expression of these genes in
single cells by RT-PCR (see Materials and methods;
Fig. 2). In addition, we looked
at a range of other markers expressed in the early gastrula stage embryo to
determine whether these markers were also expressed outside their canonical
domains and whether the `rogue' cells we observe also express markers
characteristic of the domain they are in. Markers were chosen to represent the
three germ layers. In the Xenopus early gastrula, the three germ
layers broadly correspond to regions along the animal-vegetal axis: the
ectoderm arises from animal cells, mesoderm from the equatorial region, and
endoderm from vegetal cells. XK70A, a type I cytoskeletal keratin
(Krasner et al., 1988
), was
chosen as a marker of ectoderm. Xbra was chosen as a pan-mesodermal
marker (Smith et al., 1991
).
Mix.1 is another marker of endoderm
(Hudson et al., 1997
;
Rosa, 1989
), although it is
reported to have some expression in the vegetal marginal zone at the early
gastrula stage (Lemaire et al.,
1998
). Derrière (Der), a marker of both
mesoderm and endoderm at the early gastrula stage, was also assayed
(Sun et al., 1999
).
EF1
and ODC were chosen as ubiquitous markers
(Bassez et al., 1990
;
Krieg et al., 1989
).
Explants of stage 10 embryos were taken from the dorsal marginal zone, the
dorsal blastopore lip, the ventral marginal zone and the vegetal mass, and the
animal pole region. Fig. 3
shows that as expected, individual dorsal marginal zone cells and cells taken
from the dorsal lip expressed pan mesodermal markers such as Xbra and
Der (Fig. 3), in
addition to Gsc. One cell out of 69 dorsal cells expressed
Xwnt8, a ventral and lateral mesodermal marker, and some dorsal
marginal zone cells (3/46, 6%) expressed Sox17
, consistent
with the in situ hybridization results. In fact, 7/69 dorsal cells expressed
markers of all three germ layers: XK70A, Xbra and
Sox17
. No expression of these markers was detected in the
cell-free control samples.
|
In the ventral marginal zone 52% (24/46) of cells sampled expressed
Xwnt8 (Fig. 3).
Significantly, the `rogue' cells that express Gsc on the ventral side
also express Xwnt8, confirming that these are indeed ventral cells
with unorthodox Gsc expression. There were also cells in the ventral
marginal zone (2/46; 4%) that expressed markers characteristic of each germ
layer: XK70A, Xbra and Sox17
.
In the animal explants, 42/47 (89%) of cells sampled expressed the
ectodermal marker XK70A. Of these, however, nine (19%) also expressed
another marker, including Xbra, Xwnt8, Der or, in one case, even
Sox17
, none of which would be predicted to be expressed in
animal cells. No expression of these markers was seen in the cell-free control
sample.
A large number of cells in the vegetal mass express Sox17
,
Mix.1 or Der (39/44; 89%), as expected. However, many also
express mesodermal markers, such as Gsc, Xbra and Xwnt8
(32/44 cells; 73%), consistent with the in situ hybridization results. At this
stage, fewer individual vegetal cells also appear to express `ubiquitous'
genes such as ODC or EF1
than do individual cells
from other regions of the embryo. For example, vegetal cells express both
ODC and EF1
in only 24/44 (55%) cells compared with
46/46 (100%) and 44/47 (97%) in dorsal and animal cells, respectively
(Fig. 3). Part of this may be
due to inefficiencies in the RT-PCR reactions, or to some cells having low
levels of transcripts that are not detectable by this procedure (see below).
Indeed, we and others have previously observed that in comparison to other
regions of the embryo, whole vegetal mass explants express lower amounts of
ODC and EF1
overall as a percentage of total RNA
levels than other regions of the embryo
(Darken et al., 2002
;
Saka and Smith, 2004
).
Reproducibility of the single cell RT-PCR technique
Fig. 3 suggests individual
cells in the early gastrula have highly heterogeneous gene expression
profiles. However, some of this variability in gene expression, particularly
where a cell does not express a marker it might be expected to, may be due to
the inefficiencies in the reverse transcription, terminal transferase and PCR
amplification reactions during RT-PCR
(Neves et al., 2004
). In order
to assess the reproducibility of our assay, we picked 36 single cells and
split the cell lysate between two tubes (A and B samples;
Fig. 4; Materials and methods).
These samples were then subjected to RT-PCR and dot blotted, and then analyzed
for expression of up to eight markers. In the majority of cases amplification
was remarkably consistent between each split sample
(Fig. 4B). However, in 14/160
hybridized A+B samples (8.75%), asymmetric marker expression was seen, where
one sample hybridized to the probe and the other sample showed no signal (see
ventral cell 1, which expresses Xbra in the B sample but not in the A
sample; Fig. 4). Although we
are unable to measure this, it is also possible that in a proportion of cases
a marker was present but was not amplified in either sample. For example, out
of 25 split lysates of single cells taken from the marginal zone, three failed
to express Xbra in either sample
(Fig. 4 and data not
shown).
Some of this variability may be due to a cell containing a small number of
transcripts, close to the threshold number that can be detected, particularly
as the cell lysate and thus the number of transcripts in each reaction is
halved in the experiment above. In order to test the number of transcripts we
can detect with this method, single cell lysates were spiked with between
1 and 5000 transcripts of polyadenylated eGFP mRNA and subjected to
RT-PCR and dot blot as normal (Fig.
4C). In two separate experiments, samples containing
10
transcripts produced a robust signal, whereas in one experiment the
1-transcript sample also produced a weak signal above background; no
signal above background was detected in the control cell lysate that contained
no eGFP transcripts. This is consistent with previous studies which detected
over
10-25 transcripts reliably, and in some experiments could detect as
few as
1 (Chiang and Melton,
2003
; Tietjen et al.,
2003
). These results indicate that our protocol can detect as few
as 10 copies of a transcript in a single cell lysate.
Single cells express markers characteristic of their germ layer at late gastrula stages
Single cell transplant experiments suggest that during gastrulation, cells
become progressively more committed to a particular germ layer
(Godsave and Slack, 1991
;
Heasman et al., 1984
;
Kato and Gurdon, 1993
;
Snape et al., 1987
;
Wylie et al., 1987
). To
determine whether this commitment is reflected in the gene expression profiles
of cells from later embryos, explants were cut from the vegetal region, animal
region, dorsal marginal zone and ventral marginal zone of a late gastrula
stage 11.5 embryo (Fig. 5A). Dorsal marginal zone cells were taken from the anterior region corresponding
to those cells that involuted through the dorsal lip first at early gastrula
stages. Cells were then dissociated from these explants and picked for
RT-PCR.
|
). Endodermal cells also show a more uniform gene expression profile at stage 11.5 than at stage 10 (Fig. 5B). At stage 11.5, only 8/34 of endodermal cells sampled (24%) also express markers of mesoderm and ectoderm, compared with 32/44 (73%) of cells at stage 10.
Dorsal marginal zone cells and ventral marginal zone cells show more
variability than animal or vegetal cells at stage 11.5, but even so their gene
expression profiles are more representative of their germ layer and
dorsal-ventral position than cells taken from the dorsal or ventral marginal
zone at stage 10 (Fig. 5B). For
instance, none of the ventral marginal zone cells that were assayed (0/35; 0%)
express Gsc. Fig. 5B
also shows fewer ventral marginal zone cells (7/35; 20%) and dorsal marginal
zone cells (3/35; 9%) expressing endodermal markers at stage 11.5 than at
stage 10 when 36/45 (80%) ventral cells and 28/69 (41%) dorsal cells expressed
an endodermal marker. The results are consistent with the observation that
early in gastrulation the domains of expression of Xbra and
Mix.1 overlap, but become separate as gastrulation proceeds
(Lemaire et al., 1998
). It is
also reminiscent of experiments in zebrafish that show at the onset of
gastrulation expression of Ntl (zebrafish Brachyury)
overlaps with that of the endodermal marker Gata5, but that later in
gastrulation the expression domains of these two markers becomes distinct
(Rodaway et al., 1999
).
It is possible that at these later stages cells express transcripts at a
higher level compared with early gastrula stages, and so representative
markers are more likely to be reliably amplified and detected in more cells.
However, regions also lose expression of some markers (e.g.
Sox17
is lost from marginal zone cells). We also did not
observe `rogue' cells by in situ hybridization at late gastrula stages, even
when the time of colour reaction was lengthened (not shown).
Our results suggest that at late gastrula cells in a particular region of the embryo express genes more characteristic of their position when compared with the early gastrula.
Responses of single cells to mesoderm induction by Activin
In response to secreted signals from the vegetal region, cells of the
marginal zone in the Xenopus embryo form mesoderm, and in turn
express secreted signals that act to maintain and pattern mesoderm. As such,
cells of the marginal zone and vegetal region in the early embryo are exposed
to a wide variety of signals, including members of the TGFß, Wnt and FGF
families (Heasman, 1997
).
Blastomeres in the same region, particularly the marginal zone, may therefore
experience different concentrations and combinations of these factors.
TGFßs in particular induce different cell fates at different
concentrations. For instance, higher concentrations of the TGFß family
members Activin, Der, Xnr1 and Xnr2 are required to induce endoderm in
ectodermal explants than are required to induce mesoderm
(Clements et al., 1999
;
Henry et al., 1996
;
Sun et al., 1999
). Similarly,
when mesodermal markers are assayed, anterior and dorsal markers such as
Gsc or muscle actin are activated at higher concentrations
than ventral and posterior markers such as Xbra
(Agius et al., 2000
;
Green et al., 1992
;
Gurdon et al., 1994
;
Jones et al., 1995
;
Sun et al., 1999
;
Wilson and Melton, 1994
).
The results presented in Fig. 3 suggest that at early gastrula stages, cells of the marginal zone and vegetal region comprise a population with individual cells expressing genes characteristic of both mesoderm and endoderm. By the late gastrula stage, however, this co-expression is less marked, and individual cells tend to express a combination of genes characteristic of either mesoderm or endoderm. We therefore asked whether we could recapitulate this early response in ectodermal cells induced to form mesendoderm by exposure to a single growth factor, Activin.
Ectodermal explants from the animal pole regions of embryos at early
gastrula stage 10 were incubated in the presence or absence of 20 U/ml
Activin, which induces both mesoderm and endoderm (Green et al., 1990;
Rosa, 1989
). One explant was
dissociated immediately, before the addition of Activin (0 hours), then every
hour one cultured explant was dissociated and single cells were picked for
RT-PCR (Fig. 6A). Intact
explants remaining at 4 hours were assayed for expression of XK70A, Xbra,
Mix.1 and Sox17
by quantitative real-time RT-PCR
(Fig. 6B). These intact caps
expressed high levels of XK70A and Xbra following Activin
treatment, while induction of Mix.1 was less marked, and no
significant activation of Sox17
was observed
(Fig. 6B). How is this
induction reflected at the single cell level?
The results indicate that ectodermal cells exposed to Activin form a population of cells expressing mesodermal and endodermal markers in a manner resembling that seen in the whole embryo in the marginal zone (Fig. 6C). Untreated cells, for the most part, maintain their expression of XK70A throughout the culture period and just one cell at 1 hour and one at 2 hour activated expression of Der as well as XK70A (Fig. 6C), in manner resembling ectodermal cells in an intact embryo (Fig. 3).
Little response to Activin is observed 1 hour after treatment
(Fig. 6C), but at 2 hours and
beyond, mesendodermal markers are activated, with many cells are expressing
Xbra (7/11 cells at 4 hours; 64%) and Mix.1 (4/11 cells;
36%), reflecting the levels of expression of these genes observed in intact,
induced ectodermal explants (Fig.
6B). Only 1/11 cells expressed Sox17
at 4 hours,
again consistent with the low level of induction observed in whole caps by
real-time RT-PCR (Fig. 6B).
Thus, animal cap cells exposed to Activin respond in a similar way to marginal
zone cells with Mix.1 and occasionally Sox17
expressed in the same cells as mesodermal markers. These results also reflect
those seen in cell culture, where studies have shown that when exposed to a
growth factor cells do not respond uniformly, but rather individual cells
activate a subset of characteristic markers (e.g.
Ko, 1992
;
Levsky et al., 2002
).
The levels of RNA seen in intact caps measured by conventional PCR methods reflects the number of cells expressing those transcripts by single-cell RT-PCR, also suggesting that embryonic cells respond to the addition of a growth factor in a stochastic manner, similar to cultured cells. However, it is also possible that some transcripts are expressed at levels too low to detect by single cell RT-PCR but are nonetheless expressed in all cells.
Strikingly, almost all Activin-treated animal cells maintain their expression of XK70A throughout the 4 hour culture period, even though by 2 hours and thereafter 30/36 cells also express mesodermal or endodermal markers (Fig. 6C). The maintenance of XK70A expression is consistent with the high level of expression of XK70A detectable in intact Activin-treated animal caps (Fig. 6B). Although it is possible that XK70A transcripts have a half-life in excess of 2 hours, these observations suggest that Activin can activate the expression of mesendodermal genes without significantly downregulating ectodermal markers.
Fig. 6 also shows that
Xbra and Gsc are expressed in the same cells at 2 and 3
hours. This confirms previous results indicating Activin initially induces
Gsc and Xbra in the same cells, but that after 5 hours
Gsc and Xbra become expressed in separate domains, perhaps
through secondary cell interactions (Papin
and Smith, 2000
; Wilson and
Melton, 1994
). It also reflects the situation in vivo where
Gsc and Xbra are expressed initially in an overlapping
dorsal mesodermal domain, before becoming separate as gastrulation proceeds
(Artinger et al., 1997
).
| Discussion |
|---|
|
|
|---|
was observed to be discontinuous at
the boundary of its expression in marginal zone cells
(Fig. 1). Single cell RT-PCR
experiments confirmed that cells might frequently express a transcript even
though they are not within the canonical expression domain of the gene in
question (Fig. 3). During later
stages of gastrulation, however, gene expression in individual cells from a
particular region of the embryo becomes more characteristic of their position,
and `rogue' cells are observed less frequently
(Fig. 5).
It is unlikely that the inappropriate gene expression we observe by
single-cell RT-PCR is due to contamination with cells from other areas of the
embryo because the `rogue' cells also express markers characteristic of their
original site in the embryo. For example, Gsc-expressing cells on the
ventral side of the embryo also express Xwnt8; and
Sox17
, Der or Xbra-expressing cells in the
ectoderm also express XK70A (Fig.
3).
It is possible that some part of the heterogeneity we observe here is due
to the single-cell RT-PCR method, which slightly underestimates the number of
cells expressing a particular transcript, because just under 9% of split
reaction samples fail to amplify a transcript uniformly
(Fig. 4). Nevertheless
heterogeneous expression of genes within a population of embryonic precursor
cells has been observed in other systems. For example, different combinations
of Dscam splice variants are expressed by individual photoreceptor
cells during Drosophila development
(Neves et al., 2004
). In
differentiating myofibres, individual nuclei within the syncytium express
different genes, with only some expressing muscle-specific markers
(Newlands et al., 1998
).
Response of single cells to induction by activin
Members of the TGFß family, including Activin, Xnr2 and
Derrière, are required for mesoderm induction and for maintenance of
mesodermal and endodermal fate in the early Xenopus embryo (reviewed
by Yasuo and Lemaire, 2001
).
Animal cap experiments suggest that high concentrations of TGFß proteins
induce anterior and dorsal mesendodermal markers (such as Gsc), while
lower concentrations induce ventral and posterior mesodermal markers (such as
Xbra). In addition to these TGFß family members, cells of the
blastula and gastrula are exposed to many other secreted factors such as FGFs
and Wnts (reviewed in Heasman,
1997
). Our single-cell RT-PCR results suggest that the initial
outcome of this induction in the embryo is the expression in cells of the
marginal zone and vegetal mass of anterodorsal and posteroventral mesodermal
markers, or mesodermal and endodermal markers, in the same cell. To test
whether gene activation is similar when cells are exposed to a single growth
factor, we incubated animal cells in Activin, an inducer of mesendodermal cell
types. We observe that these cells too respond by activating anterior dorsal
mesendoderm and ventral posterior mesodermal markers in the same cell
(Fig. 6).
The level of induction of different markers assayed in whole explants by
real-time RT-PCR reflects the number of individual cells that express each
marker, as assayed by single cell RT-PCR. This suggests that cells in the
animal pole do not all respond equally by activating expression of the same
genes. Although this observation may in part be due to some variability in the
single cell RT-PCR method, this conclusion is consistent with experiments in
other systems that indicate that gene expression in a field of cells exposed
to a given concentration of inducer is heterogeneous (see above). It
contrasts, however, with work showing that dispersed Xenopus
ectodermal cells exposed to Activin and cultured for 2 hours express
mesodermal markers uniformly when analyzed by in situ hybridization
(Gurdon et al., 1999
).
However, our experimental procedure differs in several respects from this
study (Gurdon et al., 1999
),
which may account for our different observations. In our study, intact
explants were continuously exposed to Activin throughout the culture period,
whereas Gurdon and colleagues exposed dispersed cells to a 10-minute pulse of
Activin before washing. In addition, our cells were cultured in agarose
dishes, whereas in the other study dispersed cells were transferred onto
fibronectin-coated slides and cultured.
Single-cell fate commitment
Our finding that members of a group of cells refine their patterns of gene
expression to conform to their position within the embryo as gastrulation
proceeds reflects previous observations that cells in the Xenopus
embryo become committed to a specific germ layer gradually, and
asynchronously, during blastula and gastrula stages
(Domingo and Keller, 2000
;
Godsave and Slack, 1991
;
Heasman et al., 1984
;
Kato and Gurdon, 1993
;
Snape et al., 1987
;
Wylie et al., 1987
). Thus, at
the start of gastrulation, when commitment to ectoderm, endoderm and
particularly mesoderm is not complete, cells frequently express markers of two
or more germ layers (Fig. 3),
perhaps explaining why they are not yet fully committed. At later stages when
more cells become committed to a particular germ layer, gene expression
profiles of cells within the same region of the embryo are more uniform and
representative of their germ layer (Fig.
4).
The asynchronous nature of commitment to germ layer fate seen in single
cell transplant studies (Heasman et al.,
1984
; Wylie et al.,
1987
) may be a consequence of the stochastic nature of gene
expression (reviewed by Fiering et al.,
2000
). For example, commitment could arise through the
co-expression of a particular combination of lineage-specific factors. If
lineage-specific factors are activated at different concentrations of a signal
or in response to combinations of signals, and if receptors are also expressed
stochastically, commitment will appear asynchronous. The observation that
cells in a population show heterogeneous gene expression has led to the idea
that transcription in eukaryotic cells occurs in a digital fashion, with gene
expression being regulated at the level of the probability that the mRNA will
be produced by a cell rather than by the rate of transcription (reviewed by
Fiering et al., 2000
;
Hume, 2000
). The gene
expression profile of a cell will thus be a function of the probability that a
pulse of transcription will occur and the stability of the mRNA in question,
leading to stochastic gene expression and the detection of `rogue cells'.
What is the mechanism by which gene expression is refined as the embryo
develops? One possibility is that cells expressing inappropriate markers die
by apoptosis if they find themselves in the wrong part of the embryo, and
indeed limited apoptosis does occur in the Xenopus embryo after stage
10.5 (Hensey and Gautier,
1998
). Another mechanism by which a cell population may refine its
patterns of gene expression is through a local feedback loop. One example of
this involves Xbra and eFGF, which are both expressed in the marginal zone
during gastrulation and which act in a positive feedback loop to maintain each
other's expression (Casey et al.,
1998
; Isaacs et al.,
1994
). Thus, if Xbra were erroneously expressed in an
ectodermal cell, its expression would not be maintained as eFGF is not present
in the animal cap at early gastrula stages
(Isaacs et al., 1992
).
Interaction between groups of cells, the community effect, is important for
muscle precursor cells to maintain muscle-specific gene expression
(Gurdon et al., 1993a
;
Gurdon et al., 1993b
;
Standley et al., 2001
).
Similar interactions are also likely to be important in establishing
boundaries between germ layers during gastrulation. Mixer, for example, has
been implicated in forming the boundary between mesoderm and endoderm by
limiting expression of mesoderm-inducing signals during gastrulation
(Kofron et al., 2004
). An
interesting future challenge will be to identify other factor(s) involved in
restriction of germ layer boundaries and to understand how these interact to
refine gene expression and cell fate commitment.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Agius, E., Oelgeschlager, M., Wessely, O., Kemp, C. and de
Robertis, E. M. (2000). Endodermal Nodal-related
signals and mesoderm induction in Xenopus. Development
127,1173
-1183.[Abstract]
Artinger, M., Blitz, I., Inoue, K., Tran, U. and Cho, K. W.
(1997). Interaction of goosecoid and brachyury in Xenopus
mesoderm patterning. Mech. Dev.
65,187
-196.[CrossRef][Medline]
Bassez, T., Paris, J., Omilli, F., Dorel, C. and Osborne, H.
B. (1990). Posttranscriptional regulation of ornithine
decarboxylase in Xenopus laevis oocytes. Development
110,955
-962.
Casey, E. S., O'Reilly, M. A., Conlon, F. L. and Smith, J.
C. (1998). The T-box transcription factor Brachyury regulates
expression of eFGF through binding to a non-palindromic response element.
Development 125,3887
-3894.[Abstract]
Chiang, M. K. and Melton, D. A. (2003).
Single-cell transcript analysis of pancreas development. Dev.
Cell 4,383
-393.[CrossRef][Medline]
Cho, K. W., Blumberg, B., Steinbeisser, H. and de Robertis, E.
M. (1991). Molecular nature of Spemann's organizer: the role
of the Xenopus homeobox gene goosecoid. Cell
67,1111
-1120.[CrossRef][Medline]
Christian, J. L., McMahon, J. A., McMahon, A. P. and Moon, R.
T. (1991). Xwnt-8, a Xenopus Wnt-1/int-1-related gene
responsive to mesoderm-inducing growth factors, may play a role in ventral
mesodermal patterning during embryogenesis.
Development 111,1045
-1055.
Clements, D., Friday, R. V. and Woodland, H. R.
(1999). Mode of action of VegT in mesoderm and endoderm
formation. Development
126,4903
-4911.[Abstract]
Cooke, J. (1989). Xenopus mesoderm induction:
evidence for early size control and partial autonomy for pattern development
by onset of gastrulation. Development
106,519
-529.[Abstract]
Cooke, J., Smith, J. C., Smith, E. J. and Yaqoob, M.
(1987). The organization of mesodermal pattern in Xenopus laevis:
experiments using a Xenopus mesoderm-inducing factor.
Development 101,893
-908.
Darken, R. S., Scola, A. M., Rakeman, A. S., Das, G., Mlodzik,
M. and Wilson, P. A. (2002). The planar polarity gene
strabismus regulates convergent extension movements in Xenopus.
EMBO J. 21,976
-985.[CrossRef][Medline]
Domingo, C. and Keller, R. (2000). Cells remain
competent to respond to mesoderm-inducing signals present during gastrulation
in Xenopus laevis. Dev. Biol.
225,226
-240.[CrossRef][Medline]
Fiering, S., Whitelaw, E. and Martin, D. I.
(2000). To be or not to be active: the stochastic nature of
enhancer action. BioEssays
22,381
-387.[CrossRef][Medline]
Godsave, S. F. and Slack, J. M. W. (1991).
Single cell analysis of mesoderm formation in the Xenopus embryo.
Development 111,523
-530.[Abstract]
Green, J. B., New, H. V. and Smith, J. C.
(1992). Responses of embryonic Xenopus cells to activin and FGF
are separated by multiple dose thresholds and correspond to distinct axes of
the mesoderm. Cell 71,731
-739.[CrossRef][Medline]
Gurdon, J. B. (1988). A community effect in
animal development. Nature
336,772
-774.[CrossRef][Medline]
Gurdon, J. B., Lemaire, P. and Kato, K.
(1993a). Community effects and related phenomena in development.
Cell 75,831
-834.[CrossRef][Medline]
Gurdon, J. B., Tiller, E., Roberts, J. and Kato, K.
(1993b). A community effect in muscle development.
Curr. Biol. 3,1
-11.[CrossRef][Medline]
Gurdon, J. B., Harger, P., Mitchell, A. and Lemaire, P.
(1994). Activin signalling and response to a morphogen gradient.
Nature 371,487
-492.[CrossRef][Medline]
Gurdon, J. B, Standley, H., Dyson, S., Butler, K., Langon, T.,
Ryan, K., Stennard, F., Shimizu, K. and Zorn, A.
(1999). Single cells can sense their position in a morphogen
gradient. Development
126,5309
-5317.[Abstract]
Heasman, J. (1997). Patterning the Xenopus
blastula. Development
124,4179
-4191.[Abstract]
Heasman, J., Wylie, C. C., Hausen, P. and Smith, J. C.
(1984). Fates and states of determination of single vegetal pole
blastomeres of X. laevis. Cell
37,185
-194.[CrossRef][Medline]
Henry, G. L., Brivanlou, I. H., Kessler, D. S.,
Hemmati-Brivanlou, A. and Melton, D. A. (1996).
TGF-beta signals and a pattern in Xenopus laevis endodermal development.
Development 122,1007
-1015.[Abstract]
Hensey, C. and Gautier, J. (1998). Programmed
cell death during Xenopus development: a spatio-temporal analysis.
Dev. Biol. 203,36
-48.[CrossRef][Medline]
Hudson, C., Clements, D., Friday, R. V., Stott, D. and Woodland,
H. R. (1997). Xsox17alpha and -beta mediate endoderm
formation in Xenopus. Cell
91,397
-405.[CrossRef][Medline]
Hume, D. A. (2000). Probability in
transcriptional regulation and its implications for leukocyte differentiation
and inducible gene expression. Blood
96,2323
-2328.
Isaacs, H. V., Tannahill, D. and Slack, J. M.
(1992). Expression of a novel FGF in the Xenopus embryo. A new
candidate inducing factor for mesoderm formation and anteroposterior
specification. Development
114,711
-720.[Abstract]
Isaacs, H. V., Pownall, M. E. and Slack, J. M.
(1994). eFGF regulates Xbra expression during Xenopus
gastrulation. EMBO J.
13,4469
-4481.[Medline]
Jones, C. M., Kuehn, M. R., Hogan, B. L., Smith, J. C. and
Wright, C. V. (1995). Nodal-related signals induce axial
mesoderm and dorsalize mesoderm during gastrulation.
Development 121,3651
-3662.[Abstract]
Kato, K. and Gurdon, J. B. (1993). Single-cell
transplantation determines the time when Xenopus muscle precursor cells
acquire a capacity for autonomous differentiation. Proc. Natl.
Acad. Sci. USA 90,1310
-1314.
Kimelman, D. and Griffin, K. J. (2000).
Vertebrate mesendoderm induction and patterning. Curr. Opin. Genet.
Dev. 10,350
-356.[CrossRef][Medline]
Ko, M. S. (1992). Induction mechanism of a
single gene molecule: stochastic or deterministic?
BioEssays 14,341
-346.[CrossRef][Medline]
Kofron, M., Demel, T., Xanthos, J., Lohr, J., Sun, B., Sive, H.,
Osada, S., Wright, C., Wylie, C. and Heasman, J.
(1999). Mesoderm induction in Xenopus is a zygotic event
regulated by maternal VegT via TGFbeta growth factors.
Development 126,5759
-5770.[Abstract]
Kofron, M., Wylie, C. and Heasman, J. (2004).
The role of Mixer in patterning the early Xenopus embryo.
Development 131,2431
-2441.
Krasner, A. S., Cheng, A. K., Dawid, I. B. and Sargent, T.
D. (1988). The gene encoding Xenopus embryonic epidermal
keratin XK70A exhibits a hybrid type I-type II intron pattern.
Nucleic Acids Res. 16,8728
.
Krieg, P. A., Varnum, S. M., Wormington, W. M. and Melton, D.
A. (1989). The mRNA encoding elongation factor 1-alpha (EF-1
alpha) is a major transcript at the midblastula transition in Xenopus.
Dev. Biol. 133,93
-100.[CrossRef][Medline]
Lemaire, P., Darras, S., Caillol, D. and Kodjabachian, L.
(1998). A role for the vegetally expressed Xenopus gene Mix.1 in
endoderm formation and in the restriction of mesoderm to the marginal zone.
Development 125,2371
-2380.[Abstract]
Levsky, J. M., Shenoy, S. M., Pezo, R. C. and Singer, R. H.
(2002). Single-cell gene expression profiling.
Science 297,836
-840.
Neves, G., Zucker, J., Daly, M. and Chess, A.
(2004). Stochastic yet biased expression of multiple Dscam splice
variants by individual cells. Nat. Genet.
36,240
-246.[CrossRef][Medline]
Newlands, S., Levitt, L. K., Robinson, C. S., Karpf, A. B.,
Hodgson, V. R., Wade, R. P. and Hardeman, E. C.
(1998). Transcription occurs in pulses in muscle fibers.
Genes Dev. 12,2748
-2758.
Nieuwkoop, P. D. and Faber, J. (1967).
Normal Table of Xenopus laevis (Daudin). Amsterdam,
The Netherlands: North-Holland Publishing Company.
Papin, C. and Smith, J. C. (2000). Gradual
refinement of activin-induced thresholds requires protein synthesis.
Dev. Biol. 217,166
-172.[CrossRef][Medline]
Rodaway, A., Takeda, H., Koshida, S., Broadbent, J., Price, B.,
Smith, J. C., Patient, R. and Holder, N. (1999).
Induction of the mesendoderm in the zebrafish germ ring by yolk cell-derived
TGF-beta family signals and discrimination of mesoderm and endoderm by FGF.
Development 126,3067
-3078.[Abstract]
Rosa, F. M. (1989). Mix.1, a homeobox mRNA
inducible by mesoderm inducers, is expressed mostly in the presumptive
endodermal cells of Xenopus embryos. Cell
57,965
-974.[CrossRef][Medline]
Saka, Y. and Smith, J. C. (2004). A Xenopus
tribbles orthologue is required for the progression of mitosis and for
development of the nervous system. Dev. Biol. (in
press).
Saitou, M., Barton, S. C. and Surani, M. A.
(2002). A molecular programme for the specification of germ cell
fate in mice. Nature
418,293
-300.[CrossRef][Medline]
Sambrook, J., Fritsch, E. F. and Maniatis, T.
(1989). Molecular Cloning. A Laboratory
Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory
Press.
Sive, H. L., Grainger, R. M. and Harland, R. M.
(2000). Early Development of Xenopus laevis. A
Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press.
Slack, J. M. (1984). In vitro development of
isolated ectoderm from axolotl gastrulae. J. Embryol. Exp.
Morphol. 80,321
-330.[Medline]
Smith, J. C., Price, B. M., Green, J. B., Weigel, D. and
Herrmann, B. G. (1991). Expression of a Xenopus homolog of
Brachyury (T) is an immediate-early response to mesoderm induction.
Cell 67,79
-87.[CrossRef][Medline]
Snape, A., Wylie, C. C., Smith, J. C. and Heasman, J.
(1987). Changes in states of commitment of single animal pole
blastomeres of Xenopus laevis. Dev. Biol.
119,503
-510.[CrossRef][Medline]
Standley, H. J., Zorn, A. M. and Gurdon, J. B.
(2001). eFGF and its mode of action in the community effect
during Xenopus myogenesis. Development
128,1347
-1357.[Abstract]
Summerbell, D. and Wolpert, L. (1973).
Precision of development in chick limb morphogenesis.
Nature 244,228
-230.[CrossRef][Medline]
Sun, B. I., Bush, S. M., Collins-Racie, L. A., LaVallie, E. R.,
DiBlasio-Smith, E. A., Wolfman, N. M., McCoy, J. M. and Sive, H. L.
(1999). derriere: a TGF-beta family member required for posterior
development in Xenopus. Development
126,1467
-1482.[Abstract]
Tietjen, I., Rihel, J. M., Cao, Y., Koentges, G., Zakhary, L.
and Dulac, C. (2003). Single-cell transcriptional analysis of
neuronal progenitors. Neuron
38,161
-175.[CrossRef][Medline]
Trindade, M., Messenger, N., Papin, C., Grimmer, D., Fairclough,
L., Tada, M. and Smith, J. C. (2003). Regulation of
apoptosis in the Xenopus embryo by Bix3. Development
130,4611
-4622.
Wilson, P. A. and Melton, D. A. (1994).
Mesodermal patterning by an inducer gradient depends on secondary cell-cell
communication. Curr. Biol.
4, 676-686.[CrossRef][Medline]
Wylie, C. C., Snape, A., Heasman, J. and Smith, J. C.
(1987). Vegetal pole cells and commitment to form endoderm in
Xenopus laevis. Dev. Biol.
119,496
-502.[CrossRef][Medline]
Xanthos, J. B., Kofron, M., Wylie, C. and Heasman, J.
(2001). Maternal VegT is the initiator of a molecular network
specifying endoderm in Xenopus laevis. Development
128,167
-180.[Abstract]
Yasuo, H. and Lemaire, P. (1999). A two-step
model for the fate determination of presumptive endodermal blastomeres in
Xenopus embryos. Curr. Biol.
9, 869-879.[CrossRef][Medline]
Yasuo, H. and Lemaire, P. (2001). Generation of
the germ layers along the animal-vegetal axis in Xenopus laevis.Int. J. Dev. Biol. 45,229
-235.[Medline]
Zhang, J., Houston, D. W., King, M. L., Payne, C., Wylie, C. and
Heasman, J. (1998). The role of maternal VegT in
establishing the primary germ layers in Xenopus embryos.
Cell 94,515
-524.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
H. Tamada, N. V. Thuan, P. Reed, D. Nelson, N. Katoku-Kikyo, J. Wudel, T. Wakayama, and N. Kikyo Chromatin Decondensation and Nuclear Reprogramming by Nucleoplasmin Mol. Cell. Biol., February 15, 2006; 26(4): 1259 - 1271. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Weinstein Mesodermal Differentiation: Signal Integration During Development Sci. Signal., August 30, 2005; 2005(299): tr23 - tr23. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Suri, T. Haremaki, and D. C. Weinstein Xema, a foxi-class gene expressed in the gastrula stage Xenopus ectoderm, is required for the suppression of mesendoderm Development, June 15, 2005; 132(12): 2733 - 2742. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||