|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 1 September 2004
doi: 10.1242/dev.01374
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 MRC Human Genetics Unit, Western General Hospital, Crewe Road, Edinburgh EH4
2XU, UK
2 The Victor Chang Cardiac Research Institute, 384 Victoria Street, Darlinghurst
2010, NSW, Australia
* Author for correspondence (e-mail: p.currie{at}victorchang.unsw.edu.au)
Accepted 15 July 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Hypaxial muscle, Met, Zebrafish
| Introduction |
|---|
|
|
|---|
Until recently it was believed that the specification of limb muscle
precursors was entirely dependent on limb-derived environmental cues. Flank
somites grafted into the limb region result in the grafted tissue contributing
to the forming limb musculature, despite their non-limb level origin
(Chevallier et al., 1977
;
Christ et al., 1977
;
Hayashi and Ozawa, 1995
).
Furthermore, when ectopic limbs are induced adjacent to flank somites, these
somites are re-specified to generate migratory muscle precursors that develop
into normal limb muscles. However, Alvares et al.
(Alvares et al., 2003
) have
recently shown that limb muscle precursors are not naïve, and the ability
of somites to produce limb muscle precursors depends on the axial level from
which individual somites derive. Somites transplanted from limb level to the
flank retain the ability to initiate limb myoblast specific gene expression.
Furthermore, altering the positional identity of somites, through the
manipulation of Hox gene expression, again changes the ability of cells to
express limb myoblast-specific marker genes. However, despite an underlying
reliance on positional information, the positional identity of somites can be
completely over-ridden by signals emanating from the limb environment, as
flank somites can contribute to limb muscle formation when grafted adjacent to
the limb environment. Thus, the specification of limb muscle precursors is
influenced by two different layers of regulatory control: one reliant on the
position of an individual somite; the second dependent on signals produced by
the limb environment, which are sufficient, in themselves, for limb myoblast
induction.
Several genes have been identified that are required for the formation of
the limb musculature. Perhaps the best understood of the cohort of limb muscle
control genes, from a mechanistic point of view, is the receptor tyrosine
kinase Met and its ligand hepatocyte growth factor (Hgf) (reviewed by
Birchmeier et al., 2003
). The
EMT of limb myoblasts is mediated by Met and Hgf, a process shown to be
necessary for limb myoblast migration
(Yang et al., 1996
;
Heymann et al., 1996
;
Brand-Saberi et al., 1996
).
During limb formation, met is expressed in the medial and lateral
lips of the dermomyotome at all axial levels
(Yang et al., 1996
). Localized
activation of Met occurs through the restricted expression of hgf,
which is present within the mesenchyme of the limb bud, during limb muscle
migration. Targeted inactivation of either met or hgf within
the mouse embryo results in a lack of appendicular muscle of the limbs, as
well as other hypaxially derived migratory muscles such as the diaphragm and
tongue, despite these cells being initially specified normally
(Bladt et al., 1995
;
Schmidt et al., 1995
). Limb
muscle precursors, however, are unable to migrate from the somite into the
limb bud in met and hgf mutants, as indicated by the
continued expression of lbx1 in the dorsolateral lip of somites at
limb levels (Dietrich et al.,
1999
). In addition, implanting Hgf-soaked beads at inter-limb
level, where Hgf is not normally expressed, can result in cells undergoing an
EMT before delaminating from the somites in this region
(Heymann et al., 1996
;
Brand-Saberi et al., 1996
).
Thus, the formation of appendicular muscles of the amniote limb is
characterized by a Met/Hgf dependent EMT and consequent long-range migration
of limb muscle precursors to their site of differentiation within the dorsal
and ventral muscle masses of the limbs.
Analyses in fish species, however, have revealed the existence of two
phylogenetically distinct processes operating to generate the appendicular
muscles of the fin. The first mechanism, which is thought to be analogous to
that present in amniote embryos, has been shown to operate in zebrafish
(Neyt et al., 2000
). However,
a second primitive mode of appendicular muscle formation was found to occur
within chondricthyan species such as the spotted dogfish shark
(Scyliorhinus canicula). An examination of fin muscle formation at a
number of different developmental stages revealed the existence of direct
myotomal extensions headed by epithelial buds within the developing fin bud,
which lay down differentiating myocytes in a proximal-to-distal manner as the
epithelial bud extends within the fin
(Dohrn, 1884
;
Braus, 1899
;
Goodrich, 1958
;
Neyt et al., 2000
) (reviewed
by Galis, 2001
). Furthermore,
S. canicula somite extensions do not express genes that mark
migrating limb/fin myoblasts in other species, reinforcing the primitive
nature of the control Selachian fin muscle formation.
These studies raise a number of important issues about the molecular nature of fin muscle formation in zebrafish. Are fin muscle precursor cells influenced by the local fin adjacent environment, or do they possess an intrinsic ability to form fin musculature based on anterior posterior positioning within the embryo? Is the Met-dependent EMT evident within amniote species a true component of the derived mode of fin and limb muscle formation, or is it a synapomorphy that was generated in response to the differing architecture of the tetrapod body plan? To answer these questions, we have investigated the competence of zebrafish somites positioned at different anteroposterior levels to contribute to pectoral fin muscle formation and examined the role that Met-mediated signaling plays in the formation of hypaxial and specifically appendicular muscle formation in zebrafish.
| Materials and methods |
|---|
|
|
|---|
-actin GFP
transgenic embryos (Higashijima et al., 1996). We chose the 13-17 somite stage
of development to perform transplantation because it is the earliest point at
which successful transplantation could be achieved. It also encompasses a
developmental period prior to both formation of the fin primordia and to the
onset of fin muscle precursor specific gene expression within fin adjacent
somites. Consequently, any restriction in the ability of somites to contribute
to the fin musculature would reflect an intrinsic fate restriction of somitic
cells rather than previous exposure to inductive cues from the fin, which may
influence the fate of naïve somites. An initial dissection was made in
which the trunk was separated from the head and yolk using two 30-gauge
needles. The trunk section of the dissected embryo was then incubated in 25
mg/ml pancreatin (Sigma) until the somites visibly started to dissociate.
Pancreatin was then inactivated by serially moving the somites into small
droplets of L15+10% FCS media. Somitic tissue was selected under a fluorescent
dissection microscope (Leica MZ FLIII), and individual somites dissociated
using a fire-polished small-bore Pasteur pipette and stored on ice in L15
media during host preparation. Dechorionated wild-type host embryos (13-17
somites), derived from spawnings of AB strain adults were placed on a glass
coverslip and the majority of surrounding medium removed. Two drops of 0.7%
agarose containing 0.17 mg/ml tricaine were placed directly on the embryo and
the embryo oriented such that the lateral surfaces of anterior somites are
directly positioned against the surface of the coverslip. Once the agarose has
set, the agarose block containing the embryo was trimmed, inverted and
remounted again in a drop of agarose/triacane placed on a deep well depression
slide. Prior to transplantation, the coverslip was removed and the host
embryo, together with the depression slide in which it is mounted, is immersed
into a petri dish containing L15 media. Under a dissecting microscope, the
somitic region into which the donor somitic tissue is to be transplanted is
extirpated using a microforged, hooked glass capillary and the region for
transplant enlarged using a second ball-headed, microforged glass capillary
needle. The dissected donor somites were directly pipetted, again using a
fire-polished glass pipette, adjacent to the extirpated region of the host and
positioned into the transplant region using a ball-headed glass capillary
needle. Transplanted embryos were left undisturbed, immersed within the L15
media for at least 30 minutes before removing the embryo from the agarose by
manual dissection. Individual transplanted embryos are transferred to 12-well
tissue culture plates containing systems water and antibiotics and incubated
to the desired age at 28.5°C.
Time-lapse analysis of muscle migration
Embryos transgenic for the
actin GFP transgene were anaesthetized
(0.17 mg/ml tricane, Sigma) at 36 hpf, embedded in 0.7% agarose/0.17 mg/ml
tricaine, and orientated obliquely on a large coverslip such that the anterior
somites and yolk were positioned directly against the glass. The embedded
embryo was inverted into a deep well depression glass slide into which embryo
media (Westerfield, 1994
) plus
0.17 mg/ml tricaine had been placed. The edge of the depression was coated
with small amounts of petroleum jelly so that when the coverslip was inverted
onto the depression slide, an airtight seal was produced, and the sample did
not dry out during time-lapse. Cell movements were visualized on an Axioskop
FS (Zeiss, Germany) by taking near simultaneous DIC and fluorescent images
every 5 minutes using a Hamamatsu ORCA digital camera driven by IPLab software
(Scanalytic, Fairfax, VA, USA).
Cloning of zebrafish met and hgf
A full description of the cloning of met and hgf
sequences can be found in the legend for Fig. S1 in the supplementary
material.
Morpholino injections, in situ hybridization, antibody stains and histological methods
Two antisense morpholino oligos were designed against the met
sequence (Genetools, OR). The initial morpholino (CM1
ATAGTGAATTGTCATCTTTGTTCCT) was designed to anneal against ATG-containing
sequences, and the second was targeted against the 5' untranslated
region of met (CM2 CTGTAAAATAAAGACACCTGTCGGA). A control morpholino
was also injected that contained a 4 bp mismatch to CM1 (CM1mm,
ATAATGGATTGTCATCCTTGCTCCT). Morpholinos were injected into
actin GFP
transgenic embryos at the two-cell stage, at concentrations of 0.5 and 0.75
mM. In situ hybridization was carried out as described previously
(Jowett and Lettice, 1994
)
with some minor modifications. Cryosectioning of somite transplants were
performed after overnight fixation in 4% PFA, using standard procedures
(Westerfield, 1994
). Wax
sections of embryos processed for in situ hybridization or
immunohistochemistry were performed using standard techniques
(Nusslein-Volhard and Dahm,
2002
).
Bead implants and antibody ablation
Anti-human HGF antibody (R&D Systems, UK) and a control antibody,
anti-human slow MyHC (Chemicon, USA), were both diluted to 500 µg/ml in PBS
and injected into
-actin GFP embryos at either 16-20 somites or 28 hpf
stages of development. Embryos were incubated at 28.5°C in system water
with Methylene Blue, until they reached 48 hpf and analyzed for defects in
hypaxial muscle formation. Recombinant Hgf protein (R&D Systems, UK) was
diluted in PBS to 50 µg/ml and incubated with shards of Affi Blue beads
(BioRad, USA) that had been trimmed with 30 gauge needles to an appropriate
diameter, for 1-2 hours at room temperature in a moist chamber. Beads were
then back loaded into an injection pipette, under control of a hydraulic
microdrive (Narashige, Japan), and injected sub-epidermally at the appropriate
positions.
| Results |
|---|
|
|
|---|
actin promoter
(Higashijima et al., 1997Three different types of transplantation experiment were performed. Initially, we randomly chose somites from any rostral/caudal level and transplanted into the region of somite 4 within the host. Contribution to the fin musculature by donor tissue could be detected by the presence of GFP-positive cells, derived from the transgenically marked donor tissue transplanted into somite 4, within the developing fin. Surprisingly, our analyses revealed that only 5% of successful transplants (n=22) were able to contribute to the fin musculature. This suggested that the somites already possessed, at the 13- to 17-somite stage, some restriction in competence for provision of fin muscles.
To determine how somites are restricted in their ability to contribute to
fin musculature, they were isolated from
actin GFP donors and
dissected into two groups. The first series of transplants used tissue derived
from the six rostral-most somites and the second group of dissections used
somites caudal to somite 9 at the 13-17 somite stage. This combination of
dissections was aimed at minimizing errors in dissection level leading to an
overlap in the rostrocaudal level from which donor somites were derived.
Individual somites from each group were transplanted ventrally into the host
somite at the approximate level of somite 4, and the contribution of donor
tissue to the fin musculature monitored by the presence or absence of
GFP-positive myoblasts within the host fin. Rostral transplants gave rise to
fin myoblasts 45% of the time (Fig.
1, n=11), while transplants caudal to somite 9 gave rise
to fin myoblasts in only one instance (n=18), which we attribute to
an experimental error in correctly assigning dissected somites to either the
rostral or caudal donor class. We could also show that the failure to give
rise to fin myoblasts did not result from a difference in developmental age
between the transplanted tissue of posterior and anterior somites at 13-17
somites. Transplants of donor somites performed at 24 hpf, a time at which
somites posterior to somite 9 would have been of roughly similar developmental
age as the anterior somites within 13- to 17-somite stage embryo, also failed
to give rise to fin myoblasts (n=16). Collectively, we have
interpreted these results to mean that somites transplanted in this manner
possess an anteroposterior fate restriction at a very early stage of their
development that cannot be over-ridden by local inductive signals.
|
actin transgene strain to trace the
migration of the PHM (Figs 2,
3). The expression of the GFP
transgene during the migration of the PHM, as well as markers of muscle
differentiation such as MyHC and MyoD
(Neyt et al., 2000
|
|
met expression is restricted to somite levels that contribute to the hypaxial musculature and is also expressed in the posterior lateral line primordia
The results of our transplantation studies revealed a surprisingly early
competence restriction to the anterior somites for the ability to produce
hypaxial musculature. We wished to determine if molecular correlates of this
competence were similarly restricted. In order to address this issue, we
identified zebrafish orthologs of met and hgf, and examined
their expression during fin myoblast migration
(Fig. 4). A single open reading
frame was identified within the zebrafish genome that encoded the Met receptor
(Fig. 4A, see Fig. S1 in the
supplementary material). We find that, in contrast to amniote embryos,
met somitic expression is specifically restricted to the ventral
lateral margin of anterior somites, which we have shown generates hypaxial
muscle in zebrafish and cannot be detected within other somites positioned at
more posterior levels (Fig.
4C-E). During fin myoblast and PHM migration, expression can be
detected in migrating myoblast cells, but in the case of the PHM, expression
is restricted only to cells exiting the somite
(Fig. 4H-K). By contrast, at 48
hpf, a stage at which the majority of fin myoblast migration is thought to
have been completed (Neyt et al.,
2000
), met expression remains high in the post migratory
dorsal and ventral muscle masses of the fin with expression within the PHM no
longer detectable at this stage, despite its continued migration towards its
attachment point at the cleithrum (Fig.
4L, Fig. 2).
|
20 hpf, at
the onset of migration (data not shown). By 24 hpf, met is highly
expressed within the PLLP, which has begun its migration caudal to the otic
vesicle (Fig. 4C-E). Expression
of met in the PLLP is evident throughout the entire period of its
migration (Fig. 4F,G) towards
the tail tip but is not expressed at any stage within deposited proneuromast
or neuromast clusters.
Expression of Hgf during zebrafish pectoral fin and lateral line development
Given that it is the localized expression of the Met ligand, Hgf, which
restricts the activation of the Met receptor in amniote embryos, it was of
interest to determine how hgf was expressed during fin myoblast
migration. We also isolated fragments of two genes encoding Hgf, which we have
termed hgf1 and hgf2. The two different genes gave identical
expression profiles during development and hence will collectively be called
hgf for the purposes of this study. hgf initiates expression
broadly and at low level within somites at all axial levels at 22 hpf, with
stronger expression evident at somite boundaries
(Fig. 4M,N). Expression is also
evident within the caudal aspect of the notochord at this stage, with
widespread expression also evident in the neural tube by 24 hpf
(Fig. 4N). By 30 hpf,
hgf transcripts can be detected throughout the fin bud mesenchyme
with expression in the fin increasing at 36 and 48 hpf
(Fig. 4O-Q). At 48 hpf,
hgf transcripts can no longer be detected within the trunk of the
embryo.
Met morphants lack hypaxial muscles and possess defects in PLLP-derived neuromast deposition
To investigate the function of Met in the tissues in which it is expressed,
we `knocked-down' Met activity, using two different antisense morpholino
oligonucleotides. One morpholino was targeted to overlie the sequences
encoding the ATG (CM1) and the other to sequences 5' of the ATG, within
the 5' untranslated region of the met gene (CM2).
Microinjection of either of these morpholinos (0.5 mM) into embryos derived
from the
actin GFP transgenic strain resulted in a similar, severe,
reduction in the amount of GFP-positive cells in the dorsal and ventral muscle
masses of the pectoral fin as well as a reduction in cells of the PHM (89%,
n=269, Fig. 5A-J). By
contrast, no defect in fin muscle and PHM migration was evident in embryos
injected with a control morpholino oligonucleotide (CM1mm, n=118, 0.5
mM), containing a 4 bp mismatch to the met ATG spanning morpholino
oligonucleotide CM1.
|
As a second prominent region of expression of met was within
another migratory cell type, the PLLP, we were interested to determine if
there was a similar requirement for Met in directing either the migration of,
or the exit of, neuromast clusters from, the PLLP. The vital dye DASPEI
(Whitfield et al., 1996
) marks
the regularly spaced neuromast-derived hair cells present on both sides of the
trunk of the embryo (Fig. 6A),
and identification of fluorescent hair cell clusters therefore can be used to
monitor neuromast deposition. Microinjection of either morpholino CM1 or CM2
(0.5 mM) resulted in a similar, severe, reduction in the number of deposited
neuromast clusters as monitored by DASPEI staining
(Fig. 6A-C). By contrast, no
defect in neuromast deposition was evident in embryos injected with a control
morpholino oligonucleotide (CM1mm, n=148, 0.5 mM), containing a 4 bp
mismatch to the met ATG-spanning morpholino oligonucleotide, CM1. On
average, CM1/CM2 injected embryos possessed 2.87±1.31 (n=114)
clusters per side, as defined by the presence or absence of fluorescent hair
cells at 48 hpf. Uninjected embryos possess 6.0±0.58 (n=12)
per side at this stage of development. Furthermore, when neuromast-derived
hair cell clusters are deposited in met morpholino-injected embryos,
the number of hair cells within individual clusters is drastically reduced
(Fig. 6D,E), possessing fewer
than 50% (n=11) of the number of differentiated hair cells present in
wild-type clusters. Spacing of hair cell clusters, when deposited, was also
altered in met morphants, with larger than usual gaps evident between
clusters, spanning two to three times the number of somites present between
neuromasts in wild-type embryos (Fig.
6C). Furthermore, differentiated clusters appear to be randomly
deposited within a somite, instead of possessing the stereotypical location at
somite boundaries. The non-neural component of the lateral line, the
supporting cells, are believed to be marked by the expression of the
follistatin gene (Fig.
6F,G) (Mowbray et al.,
2001
). An analysis of follistatin expression within
met morpholino injected embryos, reveals a similar lack of support
cells to that evident for the hair cells
(Fig. 6H,I), suggesting all
PLLP-derived fates are affected by the injection of met
morpholinos.
|
Gain or loss of function of the Met ligand Hgf perturbs hypaxial muscle formation
In order to determine if ectopic activation of the Met/Hgf signaling
pathway could perturb formation of migratory myoblasts, we developed
techniques for implanting beads soaked in Hgf protein adjacent to anterior
somites. Using such techniques, we hoped to determine if application of
ectopic Hgf could produce delamination of ectopic muscle cells from adjacent
somites, as had been shown in the chick embryo, and whether there was any
restriction in the ability of somites at different anteroposterior levels to
do this, as suggested by the restricted nature of met expression.
These experiments demonstrated that if a bead was implanted lateral to the fin
at 20 hpf, by 36 hpf ectopic muscle fibers could be detected in two
stereotypical locations that were never present in control embryos. We
observed a spur of muscle from somite 4 and elongating muscle fibers on the
yolk adjacent to this somite (Fig.
7A,B,D, n=12). On the control side, where no bead or a
control bead soaked in PBS (n=14) was implanted, no ectopic fibers
were detected (Fig. 7C, data
not shown). In addition, implantation of Hgf-soaked beads at other positions
within the embryo did not result in ectopic muscle fiber development from
other somites or induction of met expression within adjacent somites
(n=5, data not shown). However, implanting a bead in the neural tube
of the embryo did result in the ectopic expression of met around the
bead (n=2, data not shown). These results reveal that the ability of
Hgf to stimulate exit of somitic cells is restricted to anterior, and
specifically, fin adjacent somites. It also reveals that the initiation of
hypaxial myoblast differentiation is triggered when precociously delaminating
cells emerge from the somite environment, rather than by the deployment of
some intrinsic cell-autonomous timing of the myoblasts themselves.
|
actin GFP embryos at two
different stages of development: the 16-20 somite stage, before myoblasts had
begun delaminating from the somites; and at 28 hpf, during delamination and
migration of myoblasts from the somites. Both sets of embryos were allowed to
develop and analyzed at 48 hpf. Injection of the antibody at 16- to 20-somite stage resulted in a reduction to complete absence of GFP-positive cells in the dorsoventral muscle masses of the fin and PHM in 49% of injected embryos (Fig. 7H, n=47). Fin bud formation was not affected in these embryos, as evidenced by its normal development, viewed by DIC optics (Fig. 7I). However, if the anti-HGF antibody was injected at 28 hpf, a reduction, but never a complete absence, in the number of GFP-positive cells in the dorsoventral muscle masses was seen within the fin, suggesting that cells that had already exited the somites could migrate normally to contribute to the fin musculature, but those that had yet to exit could not (Fig. 7J, 50% n=26). Strikingly, injection of the anti-HGF antibody at 28 hpf also resulted in a gap forming within the migrating PHM (Fig. 7J). The anterior most cells of the PHM on the injected side migrate to the same anterior position as the PHM cells on the contralateral uninjected side, revealing that Hgf function was not required for the onward migration of these cells. However, the presence of a posterior gap within the PHM suggests that Hgf is required for the initial delamination of PHM precursors from the somite, and once the antibody is removed or degraded from the extracellular space, PHM precursor cells are able to exit from anterior somites. This observation also reinforces the unique nature of PHM morphogenesis, which results from the ordered addition of myoblasts distal to the migrating primordia from specific somites, and the retention of this addition order throughout the migration of the PHM to its attachment to the cleithrum. Control injections with an identically prepared antibody raised against an unrelated epitope resulted in no phenotype at any stage at which it was injected (n=20).
| Discussion |
|---|
|
|
|---|
Why this should be the case remains to be fully resolved, but one clue
could come from the stereotypical position that the pectoral fin occupies in
all fish species, both extinct and extant. The pectoral fin is always tightly
physically linked to the bones of the skull through a series of fish-specific
bones such as the cleithrum, and consequently its relative rostrocaudal
positioning may not be easily altered. Within tetrapods, the pectoral girdle
is structurally and functionally detached from the skull and this lack of
physical association is believed to have allowed the fore-limb repositioning
or `posteriorization' evident within early and extant tetrapods to have
occurred (Goodrich, 1958
).
This would have required the evolution of a mechanism to uncouple the
positioning of paired appendages from a particular somite level and must have
necessarily included within it the ability to generate appendicular muscle
from any somite level at which the limb became juxtaposed. In early tetrapods,
for example, limbs may have needed to be placed at more posterior positions to
support the extra body weight that would be evident in evolving modes of
aquatic habitation or terrestrial environs. Once such a mechanism evolved, it
would have allowed greater freedom in the formation of different tetrapod body
plans, resulting in the marked alteration in the number of pre- and
post-forelimb vertebrae (a proxy for somite positioning in this context)
evident in different vertebrate species
(Burke et al., 1995
). Fish,
with their highly evolutionarily successful design, never required any
mechanism other than the specification of fin myoblasts by rostrocaudal
identity (presumably imparted by the Hox code) as the positioning of the
pectoral fin bud always occurred at the same somitic level regardless of the
species involved. Although a detailed phylogenetic survey of the relationship
of pectoral fin position and somite number has yet to be performed to
definitively support such an argument, an analysis of the existing literature
(Killeen et al., 1999
;
Okamoto and Kuwada, 1991
;
Ballard and Needham, 1964
;
Detlaff et al., 1993
),
together with our direct observations (embryos examined, zebrafish, salmon,
trout, carp, stickleback, paddlefish, sturgeon and lungfish; N.J.C. and
P.D.C., unpublished) reveal that in every bony fish species for which we could
obtain data, the pectoral fin always arises adjacent to the first six somites.
Hence, the two layers of regulation of limb myoblast formation elegantly
demonstrated by Alvares et al. (Alvares et
al., 2003
) may in fact represent the primitive `Hox-imparted' mode
of specification, which is present in all vertebrates with paired appendages,
and the derived `local induction' mode that may have arisen to accommodate the
designs of the tetrapod body plan.
Identification of a new hypaxially derived muscle in zebrafish
Fate mapping and somite transplantation have defined a hypaxial muscle with
a distinct origin and morphogenesis to that of the fin musculature. Although
the continuous nature of the extension of the PHM from its origin is
reminiscent of inter-limb level hypaxial muscle formation in amniotes and
hypaxial muscle formation in general within cartilaginous fish (the primitive
mode of hypaxial muscle morphogenesis), we believe that the two processes are
not related. First, the PHM highly expresses markers such as lbx
(Neyt et al., 2000
) and
met (this study), which specifically mark limb/fin and anterior
migratory myoblasts in this and other contexts. Furthermore, inter-limb level
somites exhibit the primitive epithelial morphogenesis of hypaxial muscle
formation and the PHM does not migrate as an epithelium. However, we believe
the existence of the PHM and the fin associated migration that it undergoes
may underlie a number of previous reports, based on comparative morphology,
that suggest the pectoral fin muscle of a number of teleost species are
produced via the primitive mode of epithelial extension (reviewed by
Galis, 2001
). We also believe
that the PHM is not likely to have a directly analogous muscle in amniote
species, given its attachment to the cleithrum, which is a bone of dermal
origin found predominantly in fish and primitive tetrapods.
Control of hypaxial muscle by Met and Hgf signaling
We have demonstrated that the restricted competence of anterior zebrafish
somites to produce hypaxial and appendicular muscle is mirrored by a
restricted expression of met. In contrast to the postulated function
of Met in stimulating active migration of amniote limb myoblasts
(Birchmeier et al., 2003
), we
can only implicate Met-mediated signaling in the control of the initial
delamination of hypaxial muscle precursors from zebrafish somites. However, we
note that little genetic evidence exists to definitively show that Met
signaling is required during the migratory process in amniotes, as conditional
knockout mice have yet to be generated that remove Met or Hgf function solely
during the migratory period. Furthermore it should be noted that our results
cannot rule out a role for Hgf in mediating cell proliferation and
differentiation of post-migratory myoblasts within in the fin environment as
has been postulated previously to occur for post-migratory limb myoblasts in
the chick (Scaal et al.,
l999
).
Further models of Met and Hgf function developed from results of in vitro
studies suggest a chemotactic role for Hgf in guiding migration of stimulated
cells (Lee et al., 1999
).
Again, our results do not support such a role, as beads implanted with Hgf
protein do not alter the path of migration of either fin myoblasts or cells of
the PHM, instead resulting in a precocious delamination of cells from
Met-expressing somites. These results are in line with previous studies in
chick and mice that similarly discount a chemotactic role for Hgf in limb
myoblast migration (Heymann et al.,
1996
; Dietrich et al.,
1999
).
Met/Hgf function in control of the lateral line primordia
How might Met signal activation control proneuromast deposition from the
PLLP? Our results suggest that whatever this mechanism may be, it is
independent from the process that directs PLLP migration, which has been shown
to be controlled by the chemokine SDF1 and its receptor CXCR4
(David et al., 2002
), as PLLP
migration proceeds normally in Met-deficient embryos.
One clue may come from the fact that the PLLP, despite its migratory
morphogenesis, expresses a number of markers of epithelial identity at high
levels. We have shown that a number of these markers, such as prox1
and met itself are specifically downregulated in the trailing edge of
the PLLP before proneuromast deposition occurs. One possible model, which is
consistent with the available data, is that migration of the PLLP beyond
discrete regions of Hgf expression, present at somite boundaries, could
generate pulses of Met-mediated de-epithelization within a subset of
predetermined cells of the PLLP (Itoh and
Chitnis, 2001
). Once sufficient somite boundaries have been
traversed by the PLLP and trailing edge cells have downregulated epithelial
markers sufficiently, they loose contact with the remainder of the primordium
and are released. This model explains a number of puzzling features of
neuromast deposition, including its attenuated periodicity of approximately
every five somites and the association of differentiated neuromasts with
somite boundaries. Furthermore, the model suggests a novel mechanism of
`de-epithelialization thresholding', which is controlled by the Met receptor,
may act as a developmental timekeeper for cellular morphogenesis.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/131/19/4857/DC1
| REFERENCES |
|---|
|
|
|---|
Alvares, L. E., Schubert, F. R., Thorpe, C., Mootoosamy, R. C., Cheng, L., Parkyn, G., Lumsden, A. and Dietrich, S. (2003). Intrinsic, Hox-dependent cues determine the fate of skeletal muscle precursors. Dev. Cell 5,379 -390.[CrossRef][Medline]
Ballard, W. W. and Needham, R. G. (1964). Normal embryonic stages of Polyodon spathula (Walbaum). J. Morphol. 114,465 -477.[CrossRef][Medline]
Birchmeier, C., Birchmeier, W., Gherardi, E. and Vande Woude, G. F. (2003). Met, metastasis, motility and more. Nat. Rev. Mol. Cell Biol. 4, 915-925.[CrossRef][Medline]
Bladt, F., Riethmacher, D., Isenmann, S., Aguzzi, A. and Birchmeier, C. (1995). Essential role for the c-met receptor in the migration of myogenic precursor cells into the limb bud. Nature. 376,768 -771.[CrossRef][Medline]
Brand-Saberi, B., Muller, T. S., Wilting, J., Christ, B. and Birchmeier, C. (1996). Scatter factor/hepatocyte growth factor (SF/HGF) induces emigration of myogenic cells at interlimb level in vivo. Dev. Biol. 179,303 -308.[CrossRef][Medline]
Braus, H. (1899). Beitrage zur entwicklung der musculatur unddes peripheren nervensystems der selachier. Morphologisches Jahrbuch. 27,501 -629.
Burke, A. C., Nelson, C. E., Morgan, B. A. and Tabin, C. (1995). Hox genes and the evolution of vertebrate axial morphology. Development 121,333 -346.[Abstract]
Chevallier, A., Kieny, M., Mauger, A. and Sengel, P. (1977). Developmental fate of the somitic mesoderm in the chick embryo. In Vertebrate Limb and Somite Morphogenesis (ed. D. A. Ede, J. R. Hinchcliffe and J. Balls),421 -432. Cambridge: Cambridge University Press.
Christ, B., Jacob, H. and Jacob, M. (1977). Experimental analysis of the origin of the wing musculature in avian embryos. Anat. Embryol. 150,171 -186.[CrossRef][Medline]
Christ, B. and Ordahl, C. P. (1995). Early stages of chick somite development. Anat. Embryol. (Berl.) 191,381 -396.[CrossRef][Medline]
David, N. B., Sapede, D., Saint-Etienne, L., Thisse, C., Thisse,
B., Dambly-Chaudiere, C., Rosa, F. M. and Ghysen, A. (2002).
Molecular basis of cell migration in the fish lateral line: role of the
chemokine receptor CXCR4 and of its ligand, SDF1. Proc. Natl. Acad.
Sci. USA. 99,16297
-16302.
Detlaff, T. A., Ginsburgh, A. S. and Schmalhausen, O. I. (1993). Sturgeon Fishes: Developmental Biology and Aquaculture. Berlin: Springer-Verlag.
Dietrich, S., Schubert, F. R., Healy, C., Sharpe, P. T. and Lumsden, A. (1998). Specification of the hypaxial musculature. Development 125,2235 -2249.[Abstract]
Dietrich, S., Abou-Rebyeh, F., Brohmann, H., Bladt, F., Sonnenberg-Riethmacher, E., Yamaai, T., Lumsden, A., Brand-Saberi, B. and Birchmeier, C. (1999). The role of SF/HGF and c-Met in the development of skeletal muscle. Development 126,1621 -1629.[Abstract]
Dohrn, A. (1884). Die paarigen und unpaaren Flossen der Selachier. Mitteilungen Zoologischen Station Neapol. 5,161 -195.
Galis, F. (2001). Evolutionary history of vertebrate appendicular muscle. BioEssays 23,383 -387.[CrossRef][Medline]
Glasgow, E. and Tomarev, S. I. (1998). Restricted expression of the homeobox gene prox1 in developing zebrafish. Mech Dev. 76,175 -178.[CrossRef][Medline]
Gompel, N., Cubedo, N., Thisse, C., Thisse, B., Dambly-Chaudiere, C. and Ghysen, A. (2001). Pattern formation in the lateral line of zebrafish. Mech. Dev. 105, 69-77.[CrossRef][Medline]
Goodrich, E. S. (1958). Studies on the Structure and Development of Vertebrates, Vol.1 . New York: Dover Publications/London: Constable and Company.
Grandel, H., Draper, B. W. and Schulte-Merker, S. (2000). dackel acts in the ectoderm of the zebrafish pectoral fin bud to maintain AER signaling. Development. 127,4169 -4178.[Abstract]
Hayashi, K. and Ozawa, E. (1995). Myogenic cell migration from somites is induced by tissue contact with medial region of the presumptive limb mesoderm in chick embryos. Development 121,661 -669.[Abstract]
Heymann, S., Koudrova, M., Arnold, H., Koster, M. and Braun, T. (1996). Regulation and function of SF/HGF during migration of limb muscle precursor cells in chicken. Dev. Biol. 180,566 -578.[CrossRef][Medline]
Higashijima, S., Okamoto, H., Ueno, N., Hotta, Y. and Eguchi, G. (1997). High-frequency generation of transgenic zebrafish which reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin. Dev. Biol. 192,289 -299.[CrossRef][Medline]
Itoh, M. and Chitnis, A. B. (2001). Expression of proneural and neurogenic genes in the zebrafish lateral line primordium correlates with selection of hair cell fate in neuromasts. Mech. Dev. 102,263 -266.[CrossRef][Medline]
Jowett, T. and Lettice, L. (1994). Whole-mount in situ hybridizations on zebrafish embryos using a mixture of digoxigenin- and fluorescein-labelled probes. Trends Genet. 10, 73-74.[CrossRef][Medline]
Killeen, J. R., McLay, H. A. and Johnston, I. A. (1999). Temperature and neuromuscular development in embryos of the trout (Salmo trutta L). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 122,53 -64.[CrossRef][Medline]
Knight, B., Laukaitis, C., Akhtar, N., Hotchin, N. A., Edlund, M. and Horwitz, A. R. (2000). Visualizing muscle cell migration in situ. Curr. Biol. 10,576 -585.[CrossRef][Medline]
Kolatsi-Joannou, M., Woolf, A. S., Hardman, P., White, S. J., Gordge, M. and Henderson, R. M. (1995). The hepatocyte growth factor/scatter factor (HGF/SF) receptor, met, transduces a morphogenetic signal in renal glomerular fibromuscular mesangial cells. J. Cell Sci. 108,3703 -3714.[Abstract]
Lee, K. K., Wong, C. C., Webb, S. E., Tang, M. K., Leung, A. K., Kwok, P. F., Cai, D. Q. and Chan, K. M. (1999). Hepatocyte growth factor stimulates chemotactic response in mouse embryonic limb myogenic cells in vitro. J. Exp. Zool. 283,170 -180.[CrossRef][Medline]
Mankoo, B. S., Collins, N. S., Ashby, P., Grigorieva, E., Pevny, L. H., Candia, A., Wright, C. V. E., Rigby, P. W. J. and Pachnis, V. (1999). Mox-2 is a component of the genetic hierarchy controlling limb muscle development. Nature 400, 69-73.[CrossRef][Medline]
Mennerich, D., Schäfer, K. and Braun, T. (1998). Pax-3 is necessary but not sufficient for lbx1 expression in myogenic precursor cells of the limb. Mech. Dev. 73,147 -158.[CrossRef][Medline]
Metcalfe, W. K. (1989). Organisation and development of the zebrafish posterior lateral line. In Mechanosenosry Lateral Line: Neurobiology and Evolution (ed. S. Coombs, P. Görner and H. Munz), pp147 -159. New York: Springer-Verlag.
Metcalfe, W. K., Kimmel, C. B. and Schabtach, E. (1985). Anatomy of the posterior lateral line system in young larvae of the zebrafish. J. Comp. Neurol. 233,377 -389.[CrossRef][Medline]
Mowbray, C., Hammerschmidt, M. and Whitfield, T. T. (2001). Expression of BMP signalling pathway members in the developing zebrafish inner ear and lateral line. Mech. Dev. 108,179 -184.[CrossRef][Medline]
Neyt, C., Jagla, K., Thisse, C., Thisse, B., Haines, L. and Currie, P. D. (2000). Evolutionary origins of vertebrate appendicular muscle. Nature 408. 82-86.[CrossRef][Medline]
Ng, J. K., Kawakami, Y., Buscher, D., Raya, A., Itoh, T., Koth, C. M., Rodriguez Esteban, C., Rodriguez-Leon, J., Garrity, D. M., Fishman, M. C. and Izpisua Belmonte, J. C. (2002). The limb identity gene Tbx5 promotes limb initiation by interacting with Wnt2b and Fgf10. Development. 129,5161 -5170.
Nusslein-Volhard, C. and Dahm, R. (2002). Zebrafish, Practical Approach. Oxford: Oxford University Press.
Okamoto, H. and Kuwada, J. Y. (1991). Alteration of pectoral fin nerves following ablation of fin buds and by ectopic fin buds in the Japanese medaka fish. Dev. Biol. 146,62 -71.[CrossRef][Medline]
Ordahl, C. P. and le Douarin, N. M. (1992). Two myogenic lineages within the developing somite. Development 114,339 -353.[Abstract]
Scaal, M., Bonafede, A., Dathe, V., Sachs, M., Cann, G., Christ, B. and Brand-Saberi, B. (1999). SF/HGF is a mediator between limb patterning and muscle development. Development 126,4885 -4893.[Abstract]
Schäfer, K. and Braun, T. (1999). Early specification of limb muscle precursor cells by the homeobox gene Lbx1h.Nat. Genet. 23,213 -216.[CrossRef][Medline]
Schmidt, C., Bladt, F., Goedecke, S., Brinkmann, V., Zschiesche, W., Sharpe, M., Gherardi, E. and Birchmeier, C. (1995). Scatter factor/hepatocyte growth factor is essential for liver development. Nature 373,699 -702.[CrossRef][Medline]
Schulze, F. E. (1870). Über die Sinnesorgane der Seitenlinie bei Fische und Amphibia. Arch. Mikrosk. Anat. 6,62 -68.
Sheehan, S. M., Tatsumi, R., Temm-Grove, C. J. and Allen, R. E. (2000). HGF is an autocrine growth factor for skeletal muscle satellite cells in vitro. Muscle Nerve 23,239 -245.[CrossRef][Medline]
Stone, L. S. (1933). The development of lateral-line sense organ systems in amphibians observed in living and vital stained preparations. J. Comp. Neurol. 68, 83-115.[CrossRef]