|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online September 30, 2004
doi: 10.1242/10.1242/dev.01372


1 Neurobiologie des Interactions Cellulaires et Neurophysiopathologie, UMR 6184
CNRS, Institut Jean-Roche, Boulevard Pierre Dramard, 13916 Marseille Cedex 20,
France
2 Department of Cell and Molecular Physiology, Neuroscience Center and
Curriculum in Neurobiology, University of North Carolina School of Medicine,
Chapel Hill, NC 27599-7545, USA
3 Department of Cell and Developmental Biology, University of Michigan, Medical
School, Ann Arbor, MI 48109-0616, USA
Authors for correspondence (e-mail:
sarrailh.c{at}jean-roche.univ-mrs.fr;
manzoor_bhat{at}med.unc.edu)
Accepted 26 July 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Septate Junctions, F3/Contactin, Neurexin IV, Neuroglian, Axo-glial interactions
| Introduction |
|---|
|
|
|---|
Several molecular components of the vertebrate axo-glial SJs have been
identified, which include NCP1, contactin and NF-155 as the major
cell-adhesion molecules (CAM) (Girault and
Peles, 2002
). F3/F11/contactin is a GPI-anchored CAM that contains
immunoglobulin domains linked to fibronectin type III (FNIII) repeats
(Gennarini et al., 1989
;
Brümmendorf and Rathjen,
1996
). In vertebrates, contactin is predominantly expressed by
neurons and has been implicated in the control of axonal growth and
fasciculation through heterophilic interactions with multiple ligands
(Berglund et al., 1999
;
Falk et al., 2002
), including
the L1-type molecules, L1-CAM, NrCAM and neurofascin
(Brümmendorf and Rathjen,
1996
).
A major role of contactin in myelinated fibers is to organize axonal
subdomains at the nodes of Ranvier. The nodal region is highly enriched in
voltage-gated Na+ channels, thereby allowing the rapid saltatory
conduction of the action potential. At either end of the node, in the
paranodal region, a series of septate-like junctions anchors the myelin
terminal loops to the axolemma. Contactin is an essential axonal component of
the paranodal SJs, where it forms a cis-complex with NCP1
(Menegoz et al., 1997
;
Peles et al., 1997
).
Deficiency in either NCP1 or contactin results in a loss of SJs and an
aberrant organization of the paranodal region, which causes a severe reduction
in nerve conduction velocity (Bhat et al.,
2001
; Boyle et al.,
2001
). The glial ligand NF-155 was shown to form a ternary complex
with NCP1 and contactin at the axon-glial interface of the paranodes
(Charles et al., 2002
).
Nerve ensheathment in Drosophila and myelination in vertebrates
share important common features, including process extension around axons and
formation of SJs, which isolate the nerve fibers from the extracellular fluid
(Bellen et al., 1998
;
Einheber and Salzer, 2000
).
NRX IV (NRX FlyBase), the fly homolog of NCP1, plays a crucial role in
the formation of SJs in perineurial glial cells in the peripheral nervous
system (PNS) and is required for the integrity of the blood-nerve barrier and
the proper conduction of nerve impulses
(Baumgartner et al., 1996
).
NF-155 belongs to the L1-type family which in Drosophila is encoded
by a single gene, nrg (Bieber et
al., 1989
; Hortsch,
2000
). Recent studies have suggested the role of NRG along with
other components such as gliotactin and Na+K+ATPase in
the formation of SJs (Genova and Fehon,
2003
; Schulte et al.,
2003
). In order to better understand the formation and function of
SJs and to investigate the parallels that exist between Drosophila
and vertebrate SJs, additional components of SJs need to be identified. The
physiological interaction between vertebrate NCP1 and contactin suggested that
a similar molecular complex might exist at the invertebrate SJs. In the
present study, we report the characterization of the Drosophila
homolog of vertebrate contactin referred here as Drosophila Contactin
(CONT), which co-localizes with NRX IV and NRG at epithelial SJs and in
perineurial glial cells of the PNS. Our biochemical data indicate that they
form a tripartite complex. Ultrastructural and dye-exclusion analyses
demonstrate that CONT plays an important role in the organization of SJs and
maintenance of a functional paracellular barrier. Our studies thus provide
evidence that the paranodal SJs of myelinated fibers in vertebrates may share
their evolutionary origin with invertebrate SJs, thus making them amenable to
comparable genetic and molecular analysis.
| Materials and methods |
|---|
|
|
|---|
Cloning of cont
Total RNA from II and III instar larvae was extracted using TRIzol
(Invitrogen) and cDNA synthesis was carried out with the SuperScript system
(Invitrogen) according to the manufacturer's instructions. The full-length
cDNA of cont was cloned in two steps using PCR amplification with
Expand High Fidelity PCR system (Roche). First, the 5' half of
cont cDNA (2163 bp) was amplified starting at position 580 of the
FlyBase transcript sequence, using the 5'GCCTTTAGTCTGCTGCGAGA3'
sense primer and the 5'TCATAGACAGCACTCGGAGCT3' antisense primer.
This fragment was inserted into the NotI-XbaI cloning sites
of pP{CaSpeR-hs} transformation vector
(Thummel et al., 1988
).
Second, the 3' half of the cDNA sequence (2359 bp) was amplified using
the 5'CCGGAAGACACTTATGAAGAGC3' sense primer and the
5'CAAGAGAAGCACGGATGGAAT3' antisense primer. Subsequently, this
fragment was inserted into XbaI-digested pP{CaSpeR-hs}
vector DNA, which contained the 5' half of the cont cDNA. The
complete sequence of the PCR amplified regions was established by Genome
Express (France). The full-length cDNAs of cont and nrx IV
were subcloned into pCDNA3 (Invitrogen) for mammalian cell expression
experiments.
Generation of CONT antibodies
A recombinant protein was generated using the pQE30 vector
(Qiagen), which carried a his-tag fused to Ig5-6 domains and the hinge region
of CONT (corresponding to amino acid residues 772-1138). After induction, the
his-CONT fusion protein was purified under denaturing conditions by affinity
chromatography on Ni-agarose beads and used for the immunization of rats. For
the production of polyclonal antisera in guinea pigs, the cDNA coding for 172
amino acids of CONT (residues 24-195) was fused to a his-tag in
pET28a(+) (Novagen) and expressed in E. coli BL21DE3. The
recombinant protein was purified from a preparative SDS-PAGE gel and used for
the immunization of guinea pigs.
Generation of cont mutants and transgenic flies
The P element KG9756 was mobilized to generate imprecise excisions as
previously described (Bhat et al.,
1999
). To generate a genomic rescue construct, a cosmid library
was obtained from John Tamkun (Tamkun et
al., 1992
). A 7 kb SpeI-SpeI fragment which
contained the entire cont gene was cloned in pP{CaSpeR-4},
and for heat-shock induced cont expression, cont cDNA was
cloned into pP{CaSpeR-hs}. The recombinant plasmids were used for
germline transformation to obtain transgenic flies. For heat-shock experiment,
4- to 10-hour old embryos from the parental genotype hs-cont/hs-cont;
contex956/TM3,Sb,dfd-lacZ were heat-shocked at 37°C for 60
minutes followed by recovery for 7 hours at room temperature, and processed
for immunohistochemical analysis.
Immunohistochemistry
Wild-type and mutant embryos from contex956, nrx
IV4304 and nrg1 were collected and aged
for 12-18 hours at 25°C. Embryos were processed for immunostaining as
previously described (Bhat et al.,
1999
). The following primary antibodies were used: guinea pig
anti-CONT (1:2000) (this study), rat anti-CONT (1:500) (this study) and rabbit
anti-NRX IV (1:2000) (Baumgartner et al.,
1996
). Monoclonal anti-NRG antibodies 1B7 and 3C1 have been
described previously (Bieber et al.,
1989
; Hortsch et al.,
1995
). Secondary antibodies used for immunofluorescence were
obtained from Jackson ImmunoResearch. Confocal images were captured on a
BioRad Radiance 2000 Confocal Microscope and the image files were processed
using Photoshop Software.
Electron microscopy and dye exclusion assay
contex956 and nrg1 mutant embryos
were identified against a GFP-expressing balancer chromosome. Mutant and
wild-type embryos aged 19-21 hours at 20°C were hand-dechorionated,
perforated with a tungsten needle and fixed with 2.5% glutaraldehyde in 50 mM
cacodylate buffer (pH 7.2) for 2 hours, post-fixed in 1% osmium tetraoxide for
1 hour, en bloc stained with uranyl acetate, dehydrated and embedded in Spurr.
Ultrathin sections were contrasted with uranyl acetate and examined on a
Philips CM10 electron microscope. For the dye exclusion assay,
rhodamine-labeled 10-kDa dextran (Molecular Probes) was injected into the body
cavity of stage 16 embryos as described by Lamb et al.
(Lamb et al., 1998
).
Immunoprecipitation and western blot analysis
Embryos (18 hours) were homogenized in 10 mM Tris buffer (pH 7.5), which
contained 0.32 M sucrose and protease inhibitors (1 mM PMSF, 5 µg/ml
-2-macroglobulin, 1 µg/ml leupeptin and 5 µg/ml pepstatin). The
homogenate was centrifuged for 10 minutes at 1500 g. The
supernatant was centrifuged at 100,000 g for 1 hour and the
microsomal fraction was solubilized for 30 minutes in 50 mM Tris buffer (pH
7.5), 1% NP-40. After preclearing for 2 hours at 4°C with protein
A-Sepharose, the supernatant was immunoprecipitated overnight at 4°C with
protein A Sepharose, which had been coated with either anti-NRX IV antibody (3
µl), with rabbit-anti-mouse immunoglobulins and 1B7 or 3C1 ascites fluid (5
µl) or with guinea pig anti-CONT (3 µl). For the rat anti-CONT immune
serum (5 µl), anti-rat agarose beads were used instead. The beads were
washed twice with 50 mM Tris buffer (pH 7.5), 150 mM NaCl, 1% NP-40, twice
with 50 mM Tris buffer, 150 mM NaCl, and twice with 50 mM Tris buffer.
Immunoprecipitates were analyzed by immunoblotting using anti-CONT, anti-NRX
IV or anti-NRG (3C1) antibodies in a standard western blotting procedure.
Control experiments with uncoated protein A-Sepharose or with agarose beads
coated with anti-CONT pre-immune serum, yielded negative results.
The lipid rafts from embryos (18 hours) were prepared as low density Triton
X-100-insoluble complexes as described previously
(Faivre-Sarrailh et al.,
2000
). Phosphatidylinositol-phospholipase C (PI-PLC) treatment was
carried out as described by Gennarini et al.
(Gennarini et al., 1989
).
Briefly, 100 µl aliquotes of microsomes from 18-hour-old embryos were first
incubated for 2 hours at 37°C to eliminate spontaneously released proteins
and then were treated threefold with 0.2 unit PI-PLC (GlycoSystems, Oxford)
for 40 minutes. After ultracentrifugation at 100,000 g,
pellets were resuspended in 100 µl and supernatants were analyzed by
immunoblotting with anti-Fasciclin 1 (Fas1)
(Hortsch and Goodman, 1990
)
and anti-CONT antibodies. The N-glycosylation pattern of CONT was examined
using N-glycosidase-F (Roche). The NP-40 extracts and lipid raft fractions
were incubated for 3 hours in 0.2% SDS and 1% ß-mercaptoethanol with
N-glycosidase-F (20 units/ml).
Transient transfection of N2a cells
N2a cells were grown in DMEM (Invitrogen) containing 10% FCS, as well as
penicillin (50 U/ml) and streptomycin (50 µg/ml). Transient transfections
with pCDNA3-nrx IV or pCDNA3-cont were carried out
using Lipofectamin Plus (Invitrogen). After 48 hours, cells were fixed with 4%
PFA in PBS, permeabilized with 0.1% Triton X-100 in PBS and processed for
immunostaining. Double-immunostaining was performed with anti-CONT and
anti-BiP mab (StressGen, Tebu) as an ER marker. In some experiments, living
cells were immunostained for CONT and then fixed, permeabilized and processed
for immunostaining for NRX IV.
| Results |
|---|
|
|
|---|
4.3-4.5 kb (data not shown). Further RT-PCR analysis gave no
indication that cont undergoes alternative splicing. The primary
protein structure of CONT encompasses a N-terminal signal peptide, a C-lectin
domain, six Ig domains, four FNIII repeats and a consensus sequence for
GPI-anchor addition (Fig. 1A).
Except for the presence of the C-lectin domain at the N terminus, the modular
domain organization of CONT is similar to vertebrate contactin
(Fig. 1B). A phylogenetic
analysis indicates that CONT is the Drosophila representative of the
vertebrate contactin family (Fig.
1C).
|
180 kDa
compared with a predicted size of 158 kDa
(Fig. 1D). Rat and guinea pig
preimmune sera consistently did not detect this 180 kDa protein band (not
shown). As CONT sequence contains 10 putative N-glycosylation sites
(Fig. 1A), the larger than
expected apparent size of CONT may be the result of an extensive
glycosylation. To test this hypothesis, microsomal fractions were treated with
N-glycosidase F. As shown in Fig.
1D, deglycosylation of the 180 kDa band results in a
155 kDa
band, corresponding to CONT protein core. CONT, which contains a GPI-anchor
motif is recovered in the detergent insoluble lipid raft fraction like the
GPI-anchored cell adhesion molecule Fas1
(Hortsch and Goodman, 1990
CONT is expressed in epithelial cells and glial cells of peripheral nerves
To determine the expression pattern of the CONT protein, 0- to 16-hour-old
embryos were immunostained with anti-CONT antibodies. Both guinea pig and rat
anti-CONT antibodies revealed that CONT is expressed in ectodermally derived
epithelial cells from stage 12. All these tissues, such as epidermis, hindgut,
foregut, salivary glands and trachea, have been shown to contain pleated SJs
(Tepass and Hartenstein, 1994
;
Baumgartner et al., 1996
). To
establish the subcellular localization of CONT more precisely and to compare
its distribution with that of NRX IV, a known SJ specific protein, and NRG, a
homolog of the vertebrate axo-glial SJ component NF-155, co-immunolocalization
studies of wild-type embryos were carried out using guinea pig anti-CONT
(Fig. 2A, blue), anti-NRX IV
(Fig. 2B, red) and anti-NRG
(Fig. 2C, green). This triple
labeling showed that CONT expression overlaps with that of NRX IV and NRG in
most epithelial tissues in which these molecules are co-expressed
(Fig. 2D, merge). Furthermore,
the onset of CONT and NRX IV expression detected by immunostaining is
identical and, like NRX IV, CONT does not have any maternal contribution (data
not shown). NRX IV is expressed in perineurial glial cells, which insulate
peripheral nerves, and in the midline glial cells that ensheath anterior and
posterior commissures. CONT colocalizes with NRX IV in perineurial glial cells
of peripheral nerves (Fig.
2E,F, asterisks), whereas it shows a distribution clearly distinct
from NRX IV in the midline glial cells
(Fig. 2F,H, arrows). As NRG is
strongly expressed in the peripheral nerves
(Fig. 2G, asterisk), regions of
overlap between the three markers are shown in the merged image
(Fig. 2H, asterisk). In the
midline, some of the glial cells express CONT, NRX IV and NRG, as indicated by
intense white color (Fig. 2H,
arrowhead pointing on the midline).
|
CONT is a component of epithelial SJs
In Drosophila, epithelial tissues of the epidermis and hindgut
contain SJs along the apicolateral domain below the zonula adherens or
adherens junctions. To determine whether CONT precisely localizes to SJs in
the epidermis and the hindgut, confocal microscopy images of these tissues,
which focus on the epithelial cells, were captured at high magnification. As
shown in Fig. 2I-L, CONT, NRX
IV and NRG display almost complete colocalization at the SJs of epidermal
cells (as indicated by the merged white color in
Fig. 2L). Although, NRG is
clearly enriched at SJs, it exhibits a broader distribution and is also
expressed along the basolateral membrane
(Fig. 2K,L, white arrows). In
addition, all three proteins colocalize along the peripheral nerves where SJs
have been identified (Fig.
2I-L, arrowheads). Similarly, we determined the distribution of
CONT in hindgut epithelial cells, which are more columnar than epidermal
epithelial cells. As shown in Fig.
2M-P, CONT, NRX IV and NRG colocalize at SJs, and here NRG also
shows an additional basolateral localization
(Fig. 2O,P, arrowheads). Thus,
the immunohistochemical analysis shows that CONT, NRX IV and NRG are
co-expressed at SJs.
Genomic structure of cont and generation of cont mutants
To determine the in vivo function of CONT, we initiated a genetic analysis
of the cont locus. Based on the genomic sequence information, the
cont gene maps to 82A6-B1 and spans
5.7 kb with eight exons
(Fig. 3A). A deficiency
chromosome
Df(3R)XM3,ru1th1st1kniri1cu1ppe1/TM3,Sb1
(082A03-06;082B) that uncovered cont locus, was obtained from
the Drosophila Stock Center and examined by Southern blot analysis to
determine whether the cont locus was deleted and also by
immunohistochemical analysis using anti-CONT antibodies to determine whether
the deficiency homozygous embryos were lacking the CONT protein. Southern blot
analysis using a region of the cont cDNA as a probe showed
half-signal intensity in Df(3R)XM3 when compared with wild-type
signals confirming the deletion of the cont gene in
Df(3R)XM3 chromosome (data not shown). Immunohistochemistry using
anti-CONT antibodies further established that Df(3R)XM3/Df(3R)XM3
homozygous embryos did not produce any CONT protein.
|
2.5 kb from the predicted 5' end of cont
(Fig. 3B) and
3.2 kb from
its ATG start codon. The transcription start site (predicted by FlyBase) of
the cont locus is just 90 bp from the 3' end of
CG11739. Standard P element mobilization procedures were followed
(Bhat et al., 1999
5 kb towards the cont locus. This excision causes
embryonic lethality. To rescue the lethality of the
contex956 excision, we generated transgenic lines using a
7 kb SpeI-SpeI genomic fragment, which breaks in the middle
of CG11739 (deleting its promoter region and the first 144 amino
acids out of a total of 321 amino acids) and has intact cont locus
(Fig. 3B). This transgene fully
rescues the lethality of homozygous contex956 excisions.
The rescued adults are fully viable, fertile and are indistinguishable from
those of the wild-type flies, and have been maintained as a stable stock.
Therefore, the lack of CG11739 gene product is not associated with a lethal
phenotype. Two additional genes in Drosophila, CG5254 and
CG6782, which also encode a mitochondrial tricarboxylate-carrier
activity, might substitute for CG11739 function. Our results indicate
that the lethality in contex956 is due to the loss of
CONT, and that this excision represents a null allele of cont.
Interdependence of CONT, NRX IV and NRG for their SJ localization
Vertebrate NCP1, contactin and NF-155 co-localize at the paranodal SJs
(Bhat et al., 2001
) and each of
these proteins are found to be mislocalized in the mutant backgrounds of one
another (Bhat et al., 2001
;
Boyle et al., 2001
). In order
to further investigate the analogy between the paranodal and invertebrate SJs,
we examined whether CONT, NRX IV and NRG are mutually dependent on each other
for their SJ localization. We first analyzed whether the loss of NRX IV would
result in the mislocalization of CONT and NRG, and found that nrx
IV-null mutant embryos exhibit a diffuse distribution of CONT along the
basolateral cell membrane as opposed to its sharp localization at the SJs, as
seen in the wild-type embryos (compare white arrowheads in
Fig. 4B with
Fig. 4F). In addition, we
observed that CONT immunoreactivity is often associated with intracellular
vesicles (Fig. 4F,H, red
arrowheads), suggesting that CONT may not be either efficiently transported or
stabilized at the cell surface in nrx IV mutants. In addition, NRG,
which is present at high levels at the SJs in the wild-type embryos
(Fig. 4C) is mislocalized in
nrx IV mutant embryos and shows a more basolateral localization
(arrowhead in Fig. 4G). These
results indicate that NRX IV is required for proper SJ localization of CONT
and NRG.
|
Next, we analyzed Cont-null mutant embryos for SJ localization of NRX IV and NRG. As shown in Fig. 4M-P, with the loss of CONT (Fig. 4M), NRX IV and NRG are mislocalized to the basolateral membrane (compare arrowheads in Fig. 4N with 4A, and arrowheads in Fig. 4O with 4C). Taken together, the immunohistochemical analyses of nrx IV, nrg and cont-null mutants demonstrate that these proteins are mutually dependent on each other for their localization to SJs.
CONT expression restores NRX IV and NRG localization to SJs
As shown in the preceding section, the loss of CONT results in the
mislocalization of NRX IV and NRG to the basolateral membrane. To further
demonstrate that the mislocalization phenotype observed in cont
mutants is due to the loss of CONT only, and not due to any other gene
expression disrupted by the P element excision, 4- to 10-hour-old embryos
obtained from hs-cont/hs-cont; contex956/TM3,Sb,dfd-lacZ
parental genotype were heat-shocked at 37°C for 60 minutes to induce CONT.
After 7 hours incubation at room temperature, the embryos were processed for
immunostaining using antibodies against CONT, NRX IV or NRG.
hs-cont/hs-cont; contex956/contex956 homozygous
embryos were identified by the absence of ß-galactosidase. As shown in
Fig. 4Q-S, induction of CONT
expression (4Q, blue) restores the localization of NRX IV to SJs (Fig.
4R, compare arrowheads in
4R with
4A). Similarly, localization of
NRG was analyzed in these embryos. As shown in
Fig. 4T-V, CONT expression
results in the enrichment of NRG at the SJs (compare arrowheads in
Fig. 4U with 4C). In addition,
the SJ localization of NRX IV and NRG was restored in homozygous
contex956 embryos by expression of wild-type CONT from the
SpeI-SpeI genomic rescue fragment
(Fig. 4W-Z). Taken together,
the rescue experiments demonstrate that CONT is required for the localization
of NRX IV and NRG at epithelial SJs, and further strengthen our conclusion
that the mislocalization phenotype of NRX IV and NRG is solely due to the loss
of CONT in cont-null embryos.
CONT is required for SJ organization
To demonstrate the role of CONT in SJ organization, ultrastructural
analysis of cont mutant embryos was carried out in the epidermis
(Fig. 5). In wild-type animals,
the pleated SJs are characterized by rows of septa running in the apical half
of the lateral membranes, below the adherens junctions. Ultrastructural
analysis revealed a complete loss of transverse septa in nrx IV
mutants (Baumgartner et al.,
1996
). By contrast, strands of septa are encountered in 92% of
cont embryos at stage 15 (n=13)
(Fig. 5B). However, the
wild-type pattern of SJs, which show long stretches of ladder-like structure,
was not seen in cont mutants and only small clusters of septa were
observed occasionally. A quantitative analysis was performed by selecting
intercellular junctions that showed strands of septa in the epidermis of
cont homozygous and cont/GFP embryos. As exemplified in
Fig. 5A in control
cont/GFP embryos, septa alignments are mainly found below adherens
junctions where the intercellular membranes are very convoluted because of
interdigitations of the two opposing cells. These interdigitating membranes
with SJs have been previously reported
(Noirot-Thimothée and Noirot,
1980
). In cont/GFP embryos, the mean number of septa in
an average SJ is 44.7±1.9 (five embryos, 16 intercellular junctions)
whereas in cont mutant embryos, intercellular junctions showing such
large SJ strands are never found. Whenever any septa are present, they are
often more basal in their position (Fig.
5B, arrow), and the mean number of septa is significantly reduced
27.1±3 (six embryos, 23 intercellular junctions scored). At higher
magnification, electron dense intramembranous structures on both sides of the
junction display a scalloped appearance in cont/GFP embryos
(Fig. 5D, arrowheads). These
intramembranous particles are not distinctly visible in cont mutant
embryos, suggesting that CONT may be involved in the formation and/or
organization of these electron-dense structures
(Fig. 5E). Interestingly, the
regular spacing between septa (
20-22 nm) does not seem to be affected in
cont mutants (Fig.
5D,E).
|
CONT is required for epithelial barrier formation
Next, we examined whether CONT plays a role in the transepithelial barrier
formation using the method established by Lamb et al.
(Lamb et al., 1998
). This
method relies on the ability of the salivary gland epithelia to exclude
rhodamine-dextran (
10 kDa) after its injection into the body cavity of
live embryos during late embryogenesis. After the dye injection, confocal
sections were acquired on live embryos at time intervals ranging from 10 to 50
minutes. In control heterozygous cont/GFP embryos, the dye remained
excluded from the salivary gland lumen after 50 minutes of injection
(n=11) (Fig. 6A,
arrow). In cont mutants, diffusion of the dye into the lumen of
salivary glands was observed within 20 minutes of the injection
(n=12). Similar kinetics of dye diffusion into salivary gland lumen
have been observed for gliotactin and megatrachea mutants,
which display disorganization or absence of septal clusters
(Behr et al., 2003
;
Schulte et al., 2003
). None of
the cont mutants excluded the dye from their lumen
(Fig. 6B, arrow). The dye also
entered freely in the tracheal lumen of the cont mutant embryos
(Fig. 6C, arrowhead) in
addition to the lumen of the salivary glands
(Fig. 6C, asterisk). Thus, the
dye exclusion data, in combination with the ultrastructural analysis,
demonstrate that CONT is required for the organization and function of the
SJs.
|
|
As Drosophila S2 cells constitutively express NRX IV and CONT, we
addressed this question using neuroblastoma N2a cells as a heterologous
expression system. In transfected N2a cells, NRX IV is efficiently expressed
at the cell surface (Fig. 8A).
By contrast, in cells expressing CONT, the CONT protein appears to remain
localized intracellularly and double-staining with the ER marker BiP indicates
that CONT is retained in the ER (Fig.
8B-D). Immunofluorescence staining under permeabilizing conditions
of N2a cells, which were co-transfected with CONT and NRX IV, revealed that
CONT is transported to and co-localized with NRX IV at the plasma membrane
(Fig. 8E,F). Similar results
were obtained with intact living cells
(Fig. 8G,H). Thus, these
results indicate that NRX IV mediates the cell-surface targeting of CONT.
Next, we co-immunoprecipitated CONT with NRX IV from co-transfected COS cell
lysates (Fig. 7D), as a further
evidence that these proteins interact in cis. Such a cis-interaction has been
reported for their vertebrate counterparts contactin and NCP1
(Peles et al., 1997
).
|
| Discussion |
|---|
|
|
|---|
Conserved heterophilic binding activities of contactin and NCP molecules
A single representative of the contactin gene family was identified in the
Drosophila genome, whereas six genes have been identified to date in
vertebrates. A phylogenetic analysis indicates that CONT is not a specific
ortholog of any one of the vertebrate contactin-type proteins. As CONT is a
component of SJs, it appears to be the functional counterpart of vertebrate
contactin, which is a component of paranodal SJs. In vertebrates, contactin
interacts with NCP1/caspr in cis at the paranodal SJs
(Peles et al., 1997
), whereas
a contactin-related protein TAG-1 has been identified as a glial component of
the juxta-paranodes (Traka et al.,
2002
) and interacts with NCP2/caspr2
(Poliak et al., 1999
;
Traka et al., 2003
). The
binding partners for other NCP members are still not known, which may include
other members of the contactin family. The Drosophila genome encodes
only one contactin which interacts with the only member of the
Drosophila NCP family, NRX IV. Therefore, it seems that heterophilic
binding between contactin and NCP molecules has occurred early during
evolution and has been conserved following gene duplication in both gene
families.
Targeting of the contactin complex to the cell membrane
In vertebrates, efficient transport of NCP1 from the endoplasmic reticulum
to the surface of transfected cells requires association with the GPI-linked
contactin (Faivre-Sarrailh et al.,
2000
; Bonnon et al.,
2003
). NCP1 accumulates intracellularly and fails to be recruited
to paranodes in the nerves of contactin-deficient mice demonstrating that
contactin is essential for axonal sorting of NCP1 in vivo
(Boyle et al., 2001
). It came
as a surprise, that in Drosophila, a different mode of operation
appears to control the membrane expression of the contactin-NCP complex and,
conversely, NRX IV is required for the distribution of CONT at the cell
surface. In nrx IV mutant embryos, CONT is not efficiently expressed
at the plasma membrane, but rather appears to accumulate in vesicular
organelles in the cytoplasm of epithelial cells. In transfected N2a cells,
CONT remains associated with the ER and is only efficiently transported to the
cell surface upon co-transfection with NRX IV. Such a mechanism of
co-targeting would allow the controlled sorting of CONT to the cell surface,
where it may essentially be present in a cis-complex with NRX IV.
Role of the CONT, NRX IV, NRG complex in the organization of SJs
CONT, NRX IV and NRG are interdependent for their restricted distribution
at the apicolateral membrane, but the molecular arrangement of this ternary
complex is still unknown. It has previously been shown that NRX IV does not
mediate homophilic adhesion (Baumgartner et
al., 1996
). As NRX IV is required for transport of CONT to the
cell surface, we can assume that the two molecules interact with each other in
a cis configuration, within the same plane of the membrane. In the vertebrate
paranodal junctions, a ternary complex of NCP1/contactin interacting with
NF-155 is crucial for mediating the axo-glial heterotypic contact. A different
context is encountered in Drosophila, in which SJs occur via the
homotypic adhesion of two epithelial or glial cells. NRG is a potent
homophilic adhesion molecule (Hortsch et
al., 1995
). It is currently unknown whether the CONT/NRX IV
complex interacts with NRG in a cis- or in a trans-manner.
We and others have shown that NRG is a component of the Drosophila
SJs in epithelial cells and is involved in the apicolateral restricted
distribution of NRX IV and CONT. The ultrastructural analysis reveals that
small strands of septa can be formed in the absence of NRG. This is in
agreement with the studies of Genova and Fehon
(2003
), which indicated that
mutation in nrg disrupts the paracellular barrier in the embryonic
salivary gland, and induce alteration of the SJs. Similarly, small strands of
septa are occasionally formed in the cont mutant, although the
organization of these septa in the apical membrane is severely impaired. The
transverse septa, which are characteristic of the pleated SJs, are missing in
nrx IV mutants (Baumgartner et
al., 1996
) and, therefore, NRX IV is crucial for the assembly of
SJ strands. This activity may rely on its interaction with the scaffolding
protein coracle, which is also strictly required for septa formation
(Lamb et al., 1998
).
As NRX IV does not display homophilic binding
(Baumgartner et al., 1996
), its
role in septa formation may also rely on binding with a still unidentified
adhesion molecule. Molecular interactions between NRX IV, CONT and NRG are
likely to be involved in the organization and lateral positioning of the
junctional strands. Therefore, the molecular requirement for septa formation
in Drosophila is somewhat similar to what has been reported for the
vertebrate paranodal SJs. In the mouse, disruption of contactin and NCP1 genes
both result in the disappearance of intermembranous septa and disorganization
of paranodal junctions (Bhat et al.,
2001
; Boyle et al.,
2001
). The loss-of-function analysis of the glial NF-155 should
reveal whether NF-155 is required for the formation of paranodal SJs.
Distinct roles for the multiple septate junction molecules
Invertebrate SJs display similar molecular composition and morphology to
the vertebrate paranodal junctions, but also display functional analogy with
the vertebrate tight junctions by forming a diffusion barrier. A remarkable
difference between the septate and tight junctions resides in their
ultrastructural morphology. SJs are characterized by rows of intermembrane
septa, whereas tight junctions have membrane-kissing points resulting from the
sealing of claudin strands (Tepass and
Hartenstein, 1994
; Morita et
al., 1999
). Recent studies report the identification of two
claudins, megatrachea (Behr et al.,
2003
) and sinuous (Wu et al.,
2004
), as components of the Drosophila SJs that are
essential for the barrier function. This is an indication that the two types
of junctions display some molecular similarities in addition to their
functional analogy. The question of whether the vertebrate paranodal junctions
also contain claudins is still unresolved.
In addition, an increasing number of adhesion proteins have been recently
reported to be essential for the organization of invertebrate SJs and
formation of the paracellular diffusion barrier, including the Ig-CAM
lachesin, and the cholinesterase-like molecule gliotactin
(Genova and Fehon, 2003
;
Schulte et al., 2003
;
Llimargas et al., 2004
).
Strikingly, all these components are interdependent for their distribution at
SJs [e.g. NRX IV is mislocalized to the basolateral membrane in
megatrachea, sinuous, gliotactin, or lachesin mutant embryos
(Behr et al., 2003
;
Schulte et al., 2003
;
Llimargas et al., 2004
;
Wu et al., 2004
)]. A lack of
intermembrane septa has been observed in lachesin
(Llimargas et al., 2004
) and
megatrachea (Behr et al.,
2003
) mutants, whereas sinuous mutant embryos display a
phenotype similar to the cont mutant, showing some strands of septa
that are disorganized (Wu et al.,
2004
). A unique function has been proposed for gliotactin that
only colocalizes with other SJ markers at the tricellular junctions.
Ultrastructural analysis indicated that septa are present in the
gliotactin mutant but the rows of septa are not tightly arrayed, and
gliotactin may serve as an anchor at the tricellular corners and induce apical
compaction of the SJ strands (Schulte et
al., 2003
). Now, the question that arises is what is molecular
interplay between all these SJ markers? The future challenges would be to
molecularly dissect the structural elements forming the intermembrane septa,
and finding out how the distinct SJ components determine elongation of the
strands and compaction of the parallel rows in the apical half of epithelial
cell membrane, that is central to establishing an effective diffusion
barrier.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Auld, V. J., Fetter, R. D., Broadie, K. and Goodman, C. S. (1995). Gliotactin, a novel transmembrane protein on peripheral glia, is required to form the blood-nerve barrier in Drosophila.Cell 81,757 -767.[CrossRef][Medline]
Baumgartner, S., Littleton, J. T., Broadie, K., Bhat, M. A., Harcke, R., Lengyel, J. A., Chiquet Ehrismann, R., Prokop, A. and Bellen, H. J. (1996). A Drosophila neurexin is required for septate junction and blood-nerve barrier formation and function. Cell 13,1059 -1068.
Behr, M., Riedel, D. and Schuh, R. (2003). The claudin-like megatrachea is essential in septate junctions for the epithelial barrier function in Drosophila. Dev. Cell 5, 611-620.[CrossRef][Medline]
Bellen, H. J., Lu, Y., Beckstead, R. and Bhat, M. A. (1998). Neurexin IV, Caspr and paranodin-novel members of the neurexin family, encounters of axons and glia. Trends Neurosci. 10,444 -449.
Berglund, E. O., Murai, K., Fredette, B., Sekerkova, G., Marturano, B., Weber, L., Mugnaini, E. and Ranscht, B. (1999). Ataxia and abnormal cerebellar microorganization in mice with ablated contactin gene expression. Neuron 24,739 -750.[CrossRef][Medline]
Bhat, M. A. (2003). Molecular organization of axo-glial junctions. Curr. Opin. Neurobiol. 13,552 -559.[CrossRef][Medline]
Bhat, M. A., Izaddoost, S., Lu, Y., Cho, K. O., Choi, K. W. and Bellen, H. J. (1999). Discs Lost, a novel multi-PDZ domain protein, establishes and maintains epithelial polarity. Cell 96,833 -845.[CrossRef][Medline]
Bhat, M. A., Rios, J. C., Lu, Y., Garcia-Fresco, G. P., Ching, W., Martin, M. S., Li, J., Einheber, S., Chesler, M., Rosenbluth, J. et al. (2001). Axonglia interactions and the domain organization of myelinated axons require neurexin IV/caspr/paranodin. Neuron 30,369 -383.[CrossRef][Medline]
Bieber, A. J., Snow, P. M., Hortsch, M., Patel, N. H., Jacobs, J. R., Traquina, Z. R., Schilling, J. and Goodman, C. S. (1989). Drosophila neuroglian, a member of the immunoglobulin superfamily with extensive homology to the vertebrate neural adhesion molecule L1. Cell 59,447 -460.[CrossRef][Medline]
Bonnon, C., Goutebroze, L., Denisenko-Nehrbass, N., Girault, J.
A. and Faivre-Sarrailh, C. (2003). The paranodal complex of
F3/contactin and caspr/paranodin traffics to the cell surface via a
non-conventional pathway. J. Biol. Chem.
278,48339
-48347.
Boyle, M. E., Berglund, E. O., Murai, K. K., Weber, L., Peles, E. and Ranscht, B. (2001). Contactin orchestrates assembly of the septate-like junctions at the paranode in myelinated peripheral nerve. Neuron 30,385 -397.[CrossRef][Medline]
Brümmendorf, T. and Rathjen, F. (1996). Structure/function relationships of axon-associated adhesion receptors of the immunoglobulin superfamily. Curr. Opin. Neurobiol. 6, 584-592.[CrossRef][Medline]
Charles, P., Tait, S., Faivre-Sarrailh, C., Barbin, G., Gunn-Moore, F., Denisenko-Nehrbass, N., Guennoc, A. M., Girault, J. A., Brophy, P. J. and Lubetzki, C. (2002). Neurofascin is a glial receptor for the paranodin/Caspr-contactin axonal complex at the axoglial junction. Curr. Biol. 12,217 -220.[CrossRef][Medline]
Denisenko-Nehrbass, N., Oguievetskaia, K., Goutebroze, L., Galvez, T., Yamakawa, H., Ohara, O., Carnaud, M. and Girault, J. A. (2003). Protein 4.1B associates with both Caspr/paranodin and Caspr2 at paranodes and juxtaparanodes of myelinated fibres. Eur. J. Neurosci. 17,411 -416.[CrossRef][Medline]
Einheber, S. and Salzer, J. L. (2000). A glial investment of axons defrayed. Neuron 28,627 -628.[Medline]
Faivre-Sarrailh, C., Gauthier, F., Denisenko-Nehrbass, N., le
Bivic, A., Rougon, G. and Girault, J. A. (2000). The
GPI-anchored adhesion molecule F3/contactin is required for surface transport
of paranodin/caspr. J. Cell Biol.
149,491
-502.
Falk, J., Bonnon, C., Girault, J. A. and Faivre-Sarrailh, C. (2002). F3/contactin, a neuronal cell adhesion molecule implicated in axogenesis and myelination. Biol. Cell. 94,327 -334.[CrossRef][Medline]
Fehon, R. G., Dawson, I. A. and Artavanis-Tsakonas, S. (1994). A Drosophila homologue of membrane-skeleton protein 4.1 is associated with septate junctions and is encoded by the coracle gene. Development 120,545 -557.[Abstract]
Furley, A. J., Morton, S. B., Manalo, D., Karagogeos, D., Dodd, J. and Jessell, T. M. (1990). The axonal glycoprotein TAG-1 is an immunoglobulin superfamily member with neurite outgrowth promoting activity. Cell 61,157 -170.[CrossRef][Medline]
Gennarini, G., Cibelli, G., Rougon, G., Mattei, M. and Goridis,
C. (1989). The mouse neuronal cell surface protein F3, a
phosphatidylinositol-anchored member of the immunoglobulin superfamily related
to the chicken contactin. J. Cell Biol.
109,775
-788.
Genova, J. L. and Fehon, R. G. (2003).
Neuroglian, gliotactin, and the Na+/K+ ATPase are essential for septate
junction function in Drosophila. J. Cell Biol.
161,979
-989.
Girault, J. A. and Peles, E. (2002). Development of nodes of Ranvier. Curr. Opin. Neurobiol. 12,476 -485.[CrossRef][Medline]
Gollan, L., Sabanay, H., Poliak, S., Berglund, E. O., Ranscht,
B. and Peles, E. (2002). Retention of a cell adhesion complex
at the paranodal junction requires the cytoplasmic region of Caspr.
J. Cell Biol. 157,1247
-1256.
Hortsch, M. (2000). Structural and functional evolution of the L1 family, are four adhesion molecules better than one? Mol. Cell. Neurosci. 15,1 -10.[CrossRef][Medline]
Hortsch, M. and Goodman, C. S. (1990).
Drosophila Fasciclin I, a neural cell adhesion molecule, has a
phosphatidylinositol lipid memebrane anchor that is developmentally regulated.
J. Biol. Chem. 265,15104
-15109.
Hortsch, M., Wang, Y. M., Marikar, Y. and Bieber, A. J.
(1995). The cytoplasmic domain of the Drosophila cell
adhesion molecule neuroglian is not essential for its homophilic adhesive
properties in S2 cells. J. Biol. Chem.
270,18809
-18817.
Kirkpatrick, C. and Peifer, M. (1995). Not just glue, cell-cell junctions as cellular signaling centers. Curr. Opin. Genet. Dev. 5,56 -65.[CrossRef][Medline]
Lamb, R. S., Ward, R. E., Schweizer, L. and Fehon, R. G.
(1998). Drosophila coracle, a member of the protein 4.1
superfamily, has essential structural functions in septate junctions and
developmental functions in embryonic and adult epithelial cells.
Mol. Biol. Cell 9,3505
-3519.
Llimargas, M., Strigini, M., Katidou, M., Karagogeos, D. and
Casanova, J. (2004). Lachesin is a component of a septate
junction-based mechanism that controls tube size and epithelial integrity in
the Drosophila tracheal system. Development,
131,181
-190.
Menegoz, M., Gaspar, P., le Bert, M., Galvez, T., Burgaya, F., Palfrey, C., Ezan, P., Arnos, F. and Girault, J. A. (1997). Paranodin, a glycoprotein of neuronal paranodal membranes. Neuron 19,319 -331.[CrossRef][Medline]
Morita, K., Furuse, M., Fujimoto, K. and Tsukita, S.
(1999). Claudin multigene family encoding four-transmembrane
domain protein components of tight junction strands. Proc. Natl.
Acad. Sci. USA 96,511
-516.
Noirot-Thimothé, C. and Noirot, C. (1980). Septate and scalariform junctions in arthropods.Int. J. Cytol. 63,97 -140.
Ogawa, J., Kaneko, H., Masuda, T., Nagata, S., Hosoya, H. and Wattman, K. (1996). Novel neural adhesion molecules in the Contactin/F3 subgroup of the immunoglobulin superfamily, isolation and characterization of cDNAs from rat brain. Neurosci. Lett. 218,173 -176.[CrossRef][Medline]
Peles, E., Nativ, M., Lustig, M., Grumet, M., Schilling, J., Martinez, R., Plowman, G. D. and Schlessinger, J. (1997). Identification of a novel contactin-associated transmembrane receptor with multiple domains implicated in protein-protein interactions. EMBO J. 16,978 -988.[CrossRef][Medline]
Plagge, A., Sendtner-Voelderndorff, L., Sirim, P., Freigang, J., Rader, C., Sonderegger, P. and Brümmendorf, T. (2001). The contactin-related protein FAR-2 defines Purkinje cell clusters and labels subpopulations of climbing fibers in the developing cerebellum. Mol. Cell. Neurosci. 18,91 -107.[CrossRef][Medline]
Poliak, S., Gollan, L., Martinez, R., Custer, A., Einheber, S., Salzer, J. L., Trimmer, J. S., Shrager, P. and Peles, E. (1999). Caspr2, a new member of the neurexin superfamily, is localized at the juxtaparanodes of myelinated axons and associates with K+ channels. Neuron 24,1037 -1047.[CrossRef][Medline]
Rios, J. C., Rubin, M., St Martin, M., Downey, R. T., Einheber,
S., Rosenbluth, J., Levinson, S. R., Bhat, M. A. and Salzer, J. L.
(2003). Paranodal interactions regulate expression of sodium
channel subtypes and provide a diffusion barrier for the node of Ranvier.
J. Neurosci. 23,7001
-7011.
Schulte, J., Tepass, U. and Auld, V. J. (2003).
Gliotactin, a novel marker of tricellular junctions, is necessary for septate
junction development in Drosophila. J. Cell Biol.
161,991
-1000.
Tamkun, J. W., Deuring, R., Scott, M. P., Kissinger, M., Pattatucci, A. M., Kaufmann, T. C. and Kennison, J. A. (1992). brahma, a regulator of Drosophila homeotic genes structurally related to the yeast transcriptional activator SNF2/SWI2. Cell 68,561 -572.[CrossRef][Medline]
Tepass, U. and Hartenstein, V. (1994). The development of cellular junctions in the Drosophila embryo. Dev. Biol. 161,563 -596.[CrossRef][Medline]
Thummel, C. S., Boulet, A. M. and Lipshitz, H. D. (1988). Vectors for Drosophila P-element-mediated transformation and tissue culture transfection. Gene 74,445 -456.[CrossRef][Medline]
Traka, M., Dupree, J. L., Popko, B. and Karagogeos, D.
(2002). The neuronal adhesion protein TAG-1 is expressed by
Schwann cells and oligodendrocytes and is localized to the juxtaparanodal
region of myelinated fibers. J. Neurosci.
22,3016
-3024.
Traka, M., Goutebroze, L., Denisenko, N., Bessa, M., Nifli, A.,
Havaki, S., Iwakura, Y., Fukamauchi, F., Watanabe, K., Soliven, B. et al.
(2003). Association of TAG-1 with Caspr2 is essential for the
molecular organization of juxtaparanodal regions of myelinated fibers.
J. Cell Biol. 162,1161
-1172.
Ward, R. E., Lamb, R. S. and Fehon, R. G.
(1998). A conserved functional domain of Drosophila
coracle is required for localization at the septate junction and has
membrane-organizing activity. J. Cell Biol.
140,1463
-1473.
Willott, E., Balda, M. S., Fanning, A. S., Jameson, B., van
Itallie, C. and Anderson, J. M. (1993). The tight junction
protein ZO-1 is homologous to the Drosophila discs-large tumor
suppressor protein of septate junctions. Proc. Natl. Acad. Sci.
USA 90,7834
-7838.
Woods, D. F., Hough, C., Peel, D., Callaini, G. and Bryant, P.
J. (1996). Dlg protein is required for junction structure,
cell polarity, and proliferation control in Drosophila epithelia.
J. Cell Biol. 134,1469
-1482.
Wu, V. M., Schulte, J., Hirschi, A., Tepass, U. and Beitel, G.
J. (2004). Sinuous is a Drosophila claudin required
for septate junction organization and epithelial tube size control.
J. Cell Biol. 164,313
-323.
Yoshihara, Y., Kawasaki, M., Tamada, A., Nagata, S., Kagamiyama, H. and Mori, K. (1995). Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3, four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. J. Neurobiol. 28,51 -69.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
T. Stork, S. Thomas, F. Rodrigues, M. Silies, E. Naffin, S. Wenderdel, and C. Klambt Drosophila Neurexin IV stabilizes neuron-glia interactions at the CNS midline by binding to Wrapper Development, April 15, 2009; 136(8): 1251 - 1261. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Wheeler, S. Banerjee, K. Blauth, S. L. Rogers, M. A. Bhat, and S. T. Crews Neurexin IV and Wrapper interactions mediate Drosophila midline glial migration and axonal ensheathment Development, April 1, 2009; 136(7): 1147 - 1157. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Magie and M. Q. Martindale Cell-Cell Adhesion in the Cnidaria: Insights Into the Evolution of Tissue Morphogenesis Biol. Bull., June 1, 2008; 214(3): 218 - 232. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Osterfield, R. Egelund, L. M. Young, and J. G. Flanagan Interaction of amyloid precursor protein with contactins and NgCAM in the retinotectal system Development, March 15, 2008; 135(6): 1189 - 1199. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Stork, D. Engelen, A. Krudewig, M. Silies, R. J. Bainton, and C. Klambt Organization and Function of the Blood Brain Barrier in Drosophila J. Neurosci., January 16, 2008; 28(3): 587 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Koles, J.-M. Lim, K. Aoki, M. Porterfield, M. Tiemeyer, L. Wells, and V. Panin Identification of N-Glycosylated Proteins from the Central Nervous System of Drosophila Melanogaster Glycobiology, December 1, 2007; 17(12): 1388 - 1403. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bonnon, C. Bel, L. Goutebroze, B. Maigret, J.-A. Girault, and C. Faivre-Sarrailh PGY Repeats and N-Glycans Govern the Trafficking of Paranodin and Its Selective Association with Contactin and Neurofascin-155 Mol. Biol. Cell, January 1, 2007; 18(1): 229 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Schulte, K. Charish, J. Que, S. Ravn, C. MacKinnon, and V. J. Auld Gliotactin and Discs large form a protein complex at the tricellular junction of polarized epithelial cells in Drosophila J. Cell Sci., November 1, 2006; 119(21): 4391 - 4401. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schneider, A. A. Khalil, J. Poulton, C. Castillejo-Lopez, D. Egger-Adam, A. Wodarz, W.-M. Deng, and S. Baumgartner Perlecan and Dystroglycan act at the basal side of the Drosophila follicular epithelium to maintain epithelial organization Development, October 1, 2006; 133(19): 3805 - 3815. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Fusaoka, T. Inoue, K. Mineta, K. Agata, and K. Takeuchi Structure and function of primitive immunoglobulin superfamily neural cell adhesion molecules: a lesson from studies on planarian Genes Cells, May 1, 2006; 11(5): 541 - 555. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Banerjee, A. M. Pillai, R. Paik, J. Li, and M. A. Bhat Axonal ensheathment and septate junction formation in the peripheral nervous system of Drosophila. J. Neurosci., March 22, 2006; 26(12): 3319 - 3329. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||