spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 15 September 2004
doi: 10.1242/dev.01380


Development 131, 4943-4953 (2004)
Published by The Company of Biologists 2004


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.01380v1
131/20/4943    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Angulo, M.
Right arrow Articles by Serras, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Angulo, M.
Right arrow Articles by Serras, F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Activation and repression activities of ash2 in Drosophila wing imaginal discs

Mireia Angulo, Montserrat Corominas and Florenci Serras*

Departament de Genètica, Universitat de Barcelona, Diagonal 645, Barcelona 08028, Spain

* Author for correspondence (e-mail: fserras{at}ub.edu)

Accepted 23 July 2004


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Polycomb (PcG) and trithorax (trxG) group genes are chromatin regulators involved in the maintenance of developmental decisions. Although their function as transcriptional regulators of homeotic genes has been well documented, little is known about their effect on other target genes or their role in other developmental processes. In this study, we have used the patterning of veins and interveins in the wing as a model with which to understand the function of the trxG gene ash2 (absent, small or homeotic discs 2). We show that ash2 is required to sustain the activation of the intervein-promoting genes net and blistered (bs) and to repress rhomboid (rho), a component of the EGF receptor (Egfr) pathway. Moreover, loss-of-function phenotypes of the Egfr pathway are suppressed by ash2 mutants, while gain-of-function phenotypes are enhanced. Our results also show that ash2 acts as a repressor of the vein L2-organising gene knirps (kni), whose expression is upregulated throughout the whole wing imaginal disc in ash2 mutants and mitotic clones. Furthermore, ash2-mediated inhibition of kni is independent of spalt-major and spalt-related. Together, these experiments indicate that ash2 plays a role in two processes during wing development: (1) maintaining intervein cell fate, either by activation of intervein genes or inhibition of vein differentiation genes; and (2) keeping kni in an off state in tissues beyond the L2 vein. We propose that the Ash2 complex provides a molecular framework for a mechanism required to maintain cellular identities in the wing development.

Key words: ash2, Cellular memory, Imaginal disc, knirps, Drosophila


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Differential gene expression results in cell diversity, although how different cell identities are established early in development and maintained throughout life is still poorly understood. Most of the transcription factors required for early developmental decisions are expressed transiently, but the gene expression patterns they trigger are maintained during cell division and inherited by daughter cells. Actively dividing cells must preserve individual genes in an on or off expression state after an initial commitment is made, especially given that some regulators disassemble from promoters during DNA replication or mitosis. Thus, developmental decisions may be maintained by the ability to deposit epigenetic marks involving chromatin-modifying complexes to control the cellular memory of gene activity states (Francis and Kingston, 2001Go; Simon and Tamkun, 2002Go).

Genes of the Polycomb (PcG) and trithorax group (trxG) encode proteins that are engaged in the regulation of cellular memory (Orlando, 2003Go). In early Drosophila embryonic development, Hox gene expression is controlled by a genetic cascade that includes the segmentation genes (Simon, 1995Go). When the segmentation proteins decay, Hox expression is maintained in the correct spatiotemporal pattern by the action of PcG and trxG genes, which often act as transcriptional repressor- and activator-chromatin complexes (Francis and Kingston, 2001Go; Simon and Tamkun, 2002Go). In addition to Hox genes, PcG/trxG also act on other target genes (Beltran et al., 2003Go; Francis and Kingston, 2001Go). In a genome-wide prediction of PcG/trxG response elements (PRE/TRE) in Drosophila, more than 100 elements were identified that mapped to genes involved in development and cell proliferation (Ringrose et al., 2003Go). However, epigenetic marks are not only restricted to embryonic stages. At later stages, developmental fates are also frozen and inherited by the repressor and activator activities of PcG/trxG complexes. The Drosophila wing imaginal disc has proven to be a useful model with which to study how these complexes act to maintain cell identities, as shown for wingless (wg) and hedgehog (hh) pathways (Collins and Treisman, 2000Go; Maurange and Paro, 2002Go).

The non-neural tissues of the Drosophila wing are organised into two types: the A-E intervein regions and the L1-L6 veins (Fig. 1A). The specification of veins in the wing imaginal disc occurs during larval and pupal stages, and is controlled by a network of cell-to-cell interactions, including the Egfr signalling pathway (Diaz-Benjumea and Hafen, 1994Go). The rho gene, which encodes a seven-pass transmembrane serine protease, is an activator of Egfr (Bier et al., 1990Go; Sturtevant et al., 1993Go). rho is expressed in rows of cells coinciding with vein primordia and is required for vein formation, as indicated by the observation that the loss-of-function allele rhove displays truncated veins (Diaz-Benjumea and Garcia-Bellido, 1990Go; Sturtevant et al., 1993Go). Localised expression of rho and vein (vn), which encodes a diffusible neuregulin class of ligands, activates the Ras/MAPK signalling cascade necessary for vein differentiation (Sturtevant et al., 1993Go; Schnepp et al., 1996Go). By contrast, inhibition of Egfr signalling by the transcription factors blistered (bs) and net is responsible for intervein specification. bs, the Drosophila homologue of the Serum Response Factor, is expressed in a pattern associated with intervein regions and is required for the organisation and differentiation of intervein cells (Fristrom et al., 1994Go; Montagne et al., 1996Go). During disc proliferation, bs expression is independent of rho, but during the pupal period bs and rho expression become mutually exclusive (Roch et al., 1998Go). The net gene, which encodes a basic helix-loop-helix (bHLH) protein, is also expressed in the intervein regions (Brentrup et al., 2000Go). In contrast to bs, net and rho expression is mutually exclusive in the wing discs of third instar larvae. Lack of net activity causes rho expression to expand, and vice versa. Furthermore, ectopic rho expression results in repression of net, thus generating wings with ectopic vein tissue (Brentrup et al., 2000Go).



View larger version (101K):
[in this window]
[in a new window]
 
Fig. 1. Wing phenotypes of ash2 alleles. (A) Wild-type (wt) adult wing. Intervein regions (A-E, in blue), longitudinal veins (L1-L6) and anterior (a-cv) and posterior (p-cv) crossveins are marked. (B) Adult wing of ash2112411 homozygous mutant at the same magnification as A, showing anomalous L2 in which the distal half is crooked, ectopic crossvein tissue between L2-L3 and L4-L5, and a notch in the posterior margin. (C) Wing disc of wild-type third instar. (D) Wing disc of homozygous ash2112411 third instar. (E) Wing disc of homozygous ash2I1 third instar. (F,G) Mitotic clones homozygous for ash2I1 in Minute background. (F) Ventral clone where L2 appears thickened and intervein region A is reduced. (G) Dorsal clone showing ectopic vein tissue between the proximal region of L4-L5.

 
The refined localisation of the L2-L5 veins in the wing depends on positional cues established along the AP axis of the wing imaginal disc (Biehs et al., 1998Go; de Celis et al., 1996Go; Sturtevant et al., 1997Go; Sturtevant and Bier, 1995Go). The posterior compartment cells express engrailed (en), which activates hh. Hh diffuses through a few cell rows of the anterior compartment, activating vn, knot (kn) and decapentaplegic (dpp), which form the AP organising centre (Bier, 2000Go). Vn activates Egfr in the borders of the organiser, giving rise to the L3 and L4 vein primordia, while Kn prevents the domain between L3 and L4 responding to vein differentiation, ensuring the intervein fate of this region (Crozatier et al., 2002Go; Mohler et al., 2000Go). Dpp diffuses from the AP boundary and activates target genes in a threshold-dependent fashion (Lawrence and Struhl, 1996Go). The development of L5 is dependent upon the two abutting Dpp target genes, optomotor-blind (omb) and brinker (brk) (Cook et al., 2004Go). Another Dpp target is the spalt-major (salm)/spalt-related (salr) complex (sal-C) of zinc-finger transcription factors (de Celis et al., 1996Go; Lecuit et al., 1996Go; Nellen et al., 1996Go), which is expressed in the central domain of the wing. The anterior low sal-C-expressing domain promotes the activation of the knirps (kni)/knirps-related (knrl) complex (kni-C), which results in L2 specification (Lunde et al., 1998Go).

Ash2 is a trxG protein that belongs to a 0.5 MDa complex thought to be involved in chromatin remodelling (Papoulas et al., 1998Go). Ash2 accumulates uniformly in imaginal discs, fat body cells and salivary glands (Adamson and Shearn, 1996Go). Loss-of-function alleles of this gene cause homeotic transformations (LaJeunesse and Shearn, 1995Go; Shearn, 1974Go; Shearn et al., 1987Go; Shearn, 1989Go; Shearn et al., 1971Go) and downregulation of Hox genes (Beltran et al., 2003Go; LaJeunesse and Shearn, 1995Go), in addition to severe abnormalities in the wing, such as reduction of intervein and enhancement of vein tissues (Adamson and Shearn, 1996Go; Amorós et al., 2002Go). To gain more insight into the function of ash2, we examined whether vein- and intervein-specific genes and vein positioning genes act as putative targets of ash2 function. We found that ash2 is involved in activating intervein-promoting genes and downregulating the Egfr pathway. Moreover, ash2 also acts as a kni repressor independently of sal-C. These results strongly support a role for ash2 in maintaining vein/intervein developmental decisions and vein patterning in the developing wing.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Drosophila strains
We used the following genetic strains as ash2 alleles: yw; ash2112411/TM6C (Deak et al., 1997Go; Amorós et al., 2002Go) and yw; ash2I1/TM6C (Amorós et al., 2002Go; Beltran et al., 2003Go). Canton S was used as a wild-type strain. To study interactions between ash2 and Egfr signalling pathway elements, we tested the hypomorphic combination rhovevn1, top1/top3C81 (Clifford and Schupbach, 1989Go; Diaz-Benjumea and Garcia-Bellido, 1990Go), the gain-of-function allele of Egfr ElpB1/CyO and the rolled gain-of-function mutation D-RafC110; rlSem (provided by A. García-Bellido). In order to eliminate the D-RafC110 allele, crosses were designed to score the male +/Y; rlSem/+; ash2I1/+ progeny. The alleles bs03267/CyO (provided by M. Affolter), E(spl)mß-lacZ (provided by S. Bray) and net1 were used as intervein markers; the stock w; h kniri–1 was used to analyse L2 development. To study the effects of ash2 on kni expression, the minimal L2-enhancer element EX-lacZ, a 1.4 kb fragment that contains an activation and repression domain of the kni gene (Lunde et al., 2003Go) was provided by E. Bier. For ectopic expression of sal-C, we used the UAS-sal64d transgenic, on the first chromosome, the UAS-salr8 transgenic, on the second chromosome, and the nubbin-Gal4 insertion line (provided by J. F. de Celis). We also analysed whether ash2 regulates brk and scalloped (sd) expression by using the brkX47-lacZ transgene (provided by G. Morata) and the sdEXT4 stock. The stocks ElpB1/Cyo, net1, w; h kniri–1 and sdEXT4 mentioned above were obtained from the Bloomington Stock Center.

Genetic mosaics
Clones mutant for ash2I1 were obtained by mitotic recombination using the FLP/FRT technique (Xu and Rubin, 1993Go). yw;FRT82Bash2I1/TM6C crossed with ywhsflp;FRT82BGFP/TM6B and wing imaginal discs from third instar Tubby+ larvae and pupae were dissected. Heat shock was carried out for 30 minutes at 37°C [52±4 hours after egg laying (AEL)] to induce clone formation. To monitor EX-lacZ (Lunde et al., 2003Go) expression, a yw; EX-lacZ; FRT82Bash2I1/TM6C stock was created and clones were induced as above.

Overexpression of sal-C was obtained by crossing UAS-Sal64d; FRT82Bash2I1/+ males flies with were ywhsflp; nubbin-Gal4; FRT82BGFP/TM6B females. Tubby+ female larvae were dissected. To monitor brk and sd expression, brkX47-lacZ; FRT82Bash2I1/+ males and sdEXT4-lacZ; FRT82Bash2I1/+ males were crossed to ywhsflp;FRT82BGFP/TM6B and Tubby+ female larvae were dissected. In both cases, only 50% of the progeny contained ash2I1 clones.

To obtain Minute+ clones the stock used was yw; FRT82B arm-lacZ M(3)/TM6C and heat shock was carried out for 7 minutes at 34°C (110±4 hours AEL). Adult ash2 mutant FLP/FRT M+ clones marked with the forked mutation were analysed in males with the following genotype: ywhsflpf36a; FRT82BP[f+]87DM(3)w[124]/FRT82Bash2I1. The heat shock was carried out for 10 minutes at 37°C (80±12 hours AEL).

Larvae and pupae of the appropriate genotypes were cultured at 25°C and timed in hours AEL or after puparium formation (APF).

Immunohistochemistry
Immunohistochemistry was performed according to standard protocols. Primary antibodies used were: guinea pig anti-Kni (1/50), provided by J. Reinitz; rabbit anti-Salm (1/500), provided by R. Barrio; rat anti-Bs (1/200), provided by M. Affolter; rabbit anti-Plexus (1/1000), provided by H. Matakatsu; rabbit anti-Vestigial (1/20), provided by S. Carroll; mouse anti-En (1/25) from the Developmental Studies Hybridoma Bank of the University of Iowa; and rabbit anti-ß-galactosidase (Cappel) (1/1000). Kni, Salm and Vestigial antibodies were pre-absorbed before use.

Secondary antibodies were obtained from Jackson Immuno Research and include: donkey anti-rat-Rhodamine Red (1/200), donkey anti-guinea pig-Cy5 (1/400), goat anti-mouse-FITC (1/200) and donkey anti-rabbit-Rhodamine Red (1/200). Propidium Iodide (Molecular Probes) was used as a nuclear marker after RNAase treatment. Fluorescence was visualised with a Leica TCS confocal microscope.

Whole-mount in situ hybridisation with larval wing discs and pupal wings
In situ hybridisation using digoxigenin-labelled antisense RNA probes was carried out essentially as described previously (Sturtevant et al., 1993Go; Brentrup et al., 2000Go).

DIG-labelled riboprobes for net RNA were synthesised using a 2.2 kb insert of netcel{Delta}922 (gift of M. Noll) linearised with EcoR1, and for rho from a rho cDNA clone (gift of E. Bier) linearised with HindIII. Sense RNA probes for net and rho did not show detectable signal.

RT-PCR
Total RNA from wild-type and ash2I1 homozygous larvae was extracted using Trizol (GibcoBRL) and a poly(dT)-24 primer was used for cDNA synthesis. The reaction was carried out in a final volume of 25 µl with five units of avian myeloblastosis virus-RT (Promega) and 200 units of Moloney murine leukaemia virus RT (Gibco). One microlitre of the RT reaction was used for PCR. The specific primers used [5'-cgccgccctgcccttcttc-3' (forward) and 5'gggctgctgctagtcggagtggt 3' (reverse)] were designed to amplify a 369 bp product of the kni gene.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
ash2 is required to downregulate Egfr activity
The ash2112411 mutation is a single PlacW insertion (Deak et al., 1997Go) in the fourth intron of the ash2 gene (Amorós et al., 2002Go) that causes pharate lethality. Homozygous flies that reach the adult stage (12% at 25°C) are sterile and show reduced wing size, crooked L2 and ectopic vein tissue, mainly extra crossveins and thicker veins (Fig. 1A,B). The ash2I1 allele was generated after an imprecise excision of the ash2112411 insertion and is lethal in late third instar/early pupae. Molecular analysis of the ash2I1 mutation has shown that it comprises a 2 bp deletion and a 5 bp insertion that result in the absence of the full-length 2 kb transcript (Beltran et al., 2003Go). Imaginal discs of both alleles are reduced in size, ash2I1 being smaller than ash2112411 (Fig. 1C-E). The smaller size and abnormal shape suggests that the ash2I1 mutation alters proliferation and patterning. Clones homozygous for ash2I1 exhibit impaired proliferation, intervein reduction and extra vein tissue, preferentially close to the normal veins, which appear thickened (Amoros et al., 2002Go) (Fig. 1F,G). This phenotype is a consequence of intervein cells acquiring morphological features of vein cells, which are typically smaller, more pigmented and with shorter and thicker trichomes than wild-type intervein cells. This extra vein phenotype led us to question whether ash2 functions as a negative regulator of vein differentiation in intervein territories. To test this hypothesis, we assessed genetic interactions with alleles of genes involved in vein/intervein development.

We perturbed the Ras/MAPK signalling pathway in the wing using mutants of genes required for Egfr activation. We first analysed loss-of-function mutants of the pathway. In flies mutant for the hypomorphic viable combination rhove vn1, activation of the MAPK pathway in presumptive vein cells is prevented and, as a consequence, veins fail to differentiate. By contrast, the triple mutant rhove vn1 ash2112411 develops veins (Fig. 2A,B). We observed varying degrees of rescue, ranging from wings that develop only L2 to wings that develop veins almost completely, even with extra crossvein tissue or proximal vein fusions between L2-L3 and L4-L5. Rescue of L2 and L5 is more pronounced than L3 and L4, which are never distally complete, and many wings show notches in the posterior wing margin (77% of cases, n=75 wings; Fig. 2B). In 25% of these cases, wings show a tube-like shape, possibly owing to detachment of the dorsal and ventral cell layers. This variety of phenotypes is probably due to the variable expressivity found in the ash2112411 allele. The top1/top3C81 allelic combination is a hypomorphic mutation of Egfr (top) in which wings lack the anterior crossvein (a-cv) and a segment of vein L4 (Fig. 2C). Rescue of missing vein tissues is observed in top1/top3C81; ash2I1/+ flies, as shown by the presence of a-cv (58% of the cases, n=93), a complete L4 (4%), or restoration of both a-cv and L4 (28%; Fig. 2D).



View larger version (79K):
[in this window]
[in a new window]
 
Fig. 2. ash2 downregulates the Egfr pathway during vein development. (A) Lack of wing veins in rhove vn1 homozygous flies. (B) In the triple mutant rhove vn1 ash2112411, the loss of veins is rescued. (C) top1/top3C81 adult wing that lacks the a-cv and the middle part of L4. (D) The combination top1/top3C81 with one copy of the ash2I1 allele restores the wild-type vein pattern. (E) The gain-of-function ElpB1 results in ectopic vein tissue in distal L2. (F) ElpB1; ash2112411 individuals show a reduction in wing size, with notches appearing in the posterior margin and extra vein tissue (extra crossveins and a proximal L2-L3 fusion). (G) rlSem/+ flies develop wings with ectopic branches of veins. (H) Ectopic vein tissue is enhanced in rlSem; ash2I1 transheterozygous flies. All wings are shown at the same magnification.

 
We also tested whether ash2 alleles enhance gain-of-function phenotypes of the Egfr pathway. The EllipseB1 (ElpB1) allele is an activated form of Egfr. In addition to other phenotypes, ElpB1 individuals consistently develop wings with ectopic vein tissue in L2 (Fig. 2E). In ElpB1; ash2I1/+ no enhancement was found (data not shown), but ElpB1/+; ash2112411/ash2112411 individuals had reduced wings with ectopic vein tissue (46%, n=50; Fig. 2F), including vein fusion of the proximal regions and extra crossveins between L2 and L3, and between L4 and L5, but never between L3 and L4. In this case, a graded enhancement was also found, ranging from a wing similar to that of ash2112411 to ectopic vein tissue covering most of the wing. Similarly, the MAPK gain-of-function allele, rlsem, generates ectopic vein tissue, a phenotype that is enhanced in ash2I1 combinations (61%, n=70; Fig. 2G,H).

As these results indicate that ash2 antagonises the Egfr pathway, we tested whether rho expression is affected. In situ hybridisation for rho mRNA in third instar ash2I1 discs showed either no expression at all or expression in only a few scattered cells (Fig. 3A,B), possibly owing to a strong perturbation of patterning in these discs. However, in ash2112411 homozygous pupal wings, rho is expressed and organised in veins, but the domains of rho expression are larger (Fig. 3C-F).



View larger version (83K):
[in this window]
[in a new window]
 
Fig. 3. In situ hybridisation for rho in discs and pupal wings. (A) Wild-type disc. (B) rho organisation is lost in ash2I1 homozygous discs. (C) Wild-type pupal wing. (D) High magnification of a wild-type vein. (E) ash2112411 homozygous pupal wing. Veins L2 and L3 are wider. (F) High magnification of a severe ash2112411 wing showing vein thickening.

 
ash2 is required for the differentiation of intervein tissue
As several genes that promote intervein specification are antagonists of the Egfr signalling pathway, we tested whether the phenotypes described above are associated with loss of intervein gene activity. During larval stages, net is the key gene involved in intervein development and acts as an antagonist of rho (Brentrup et al., 2000Go). In third instar wing discs, net transcripts are confined to broad domains corresponding to prospective interveins, in a pattern complementary to rho (Brentrup et al., 2000Go). net RNA expression is considerably reduced in ash2 mutants, although in ash2112411, some expression is still found in the central domain of the wing pouch (Fig. 4A-C). Likewise, homozygous flies for the net1/net1 allele develop extra vein tissue, which is preferentially associated with transverse connections between L2 and L3 and between L4 and L5 (Fig. 4D), resulting in wing blades with an increased number of cells (Diaz-Benjumea and Garcia-Bellido, 1990Go; Garcia-Bellido and de Celis, 1992Go). The mutant combination net1/net1; ash2I1/+ results in extra vein connections along the proximal and distal L2-L3 region, thickening of veins, blistering and a lanceolated shape to the wing. In addition, the intervein tissue is strongly reduced between veins L2-L3 and L4-L5, and to a lesser extent in A and E intervein regions (Fig. 4E). A more extreme phenotype (75%, n=20 wings; Fig. 4F) was obtained in net1/net1; ash2112411/ash2112411 wings, in which the intervein areas between L2-L3 and L4-L5 are totally missing and result in thicker and fused veins (Fig. 4G). The region between L3 and L4 did not show extra vein tissue and was much less affected.



View larger version (126K):
[in this window]
[in a new window]
 
Fig. 4. ash2 is required for net activation. (A-C) Expression of net mRNA in third instar wing discs. (A) Wild-type discs showing net transcripts in intervein regions. The position of veins (lacking net mRNA) is indicated. (B) net expression is reduced in discs ash2112411/ash2112411. However, the central domain of the wing pouch shows expression of net. (C) Absence of net mRNA in ash2I1 wing discs. (D) Wing of net1 homozygous mutant with ectopic vein tissue. (E) net1/net1; ash2I1 heterozygous flies show posterior wing blistering and enhanced ectopic vein connections, especially between L2-L3. (F) Wings of net1; ash2112411 homozygous flies exhibit a total fusion of L2-L3 and L4-L5 with the corresponding loss of intervein regions B and D. The size of the wing is also reduced and the posterior margin is partially lost. (G) High magnification of L2 and L3 fusion, which is mostly associated with L2 thickening, as L5 is for L4-L5 fusion. Note the ventral pattern of corrugation in L2 and the sensillia campaniforme, and dorsal corrugation in L3.

 
We also generated double mutant flies to test whether ash2 interacts with the intervein-promoting gene bs. The loss-of-function allele bs03267, a PlacZ insertion within the bs gene, is not viable in homozygosis (Karpen and Spradling, 1992Go). In pharate bs03267 homozygotes, the whole wing blade is transformed into corrugated vein tissue, whilst the hinge region is almost intact. Heterozygous bs03267 flies display small patches of ectopic veins in the proximity of L2 and L5 (Roch et al., 1998Go) (Fig. 5A). However, flies that are homozygous for ash2112411 and heterozygous for bs03267 exhibit blistering (Fig. 5B), reduced wing size associated with localised reduction of the intervein tissue (Fig. 5B,C) and development of extra crossveins (Fig. 5C,D). Veins L2 and L3 are thicker and totally or partially fused in the proximal region. Similarly, the D-intervein region between veins L4 and L5 is reduced and these veins are partially fused and thicker. Moreover, in pupal bs03267/+; ash2112411/ash2112411 wings, rho is expressed in broader domains (Fig. 5E,F). Interestingly, the C-intervein region is much less affected. This region is smaller than the corresponding wild type, probably owing to the overall wing reduction. However, as for net, neither ectopic vein tissue in the C-intervein region nor fusion of L3-L4 was found (Fig. 5C).



View larger version (99K):
[in this window]
[in a new window]
 
Fig. 5. ash2 is required for activation of bs. (A) Wings of heterozygous bs03267 flies display a small ectopic vein in intervein region D. (B,C) bs03267/+; ash2112411/ash2112411wings show blisters with extra vein tissue (B) and reduction of interveins B and D alongside partial fusion of L2-L3 and L4-L5 (C). (D) Detail of extra crossveins connecting L2 and L3. (E) rho expression in a bs03267/+; ash2112411/ash2112411 pupal wing. (F) High magnification of the same image. (G) Bs staining in a wild-type third instar wing disc. The vein territories and the DV boundary are devoid of antibody staining, which is only associated with intervein territories. (H) ash2I1 clones in a wing imaginal disc (visualised as black spots by the absence of GFP). (I) Bs staining of the same disc. The reduction of Bs staining is more pronounced in the clone located between L2 and L3 (arrow) than in the one between L3 and L4 (arrowhead). (J) Merged green and red channels. (K-M) 24-30 hours APF wings stained with anti-Bs. (K) Wild type. (L) ash2112411/ash2112411 where extra vein tissue is restricted to wider p-cv and an extra proximal crossvein (arrow). (M) ash2112411/ash2112411 pupal wing of an individual with thicker vein tissues. In both L and M, some interveins are reduced and show some negatively stained cells within the interveins. (N) ash2I1 mitotic clones in pupal wings. (O) Bs staining of the same wing. (P) Merged green and red channels. (Q-S) High magnification of an ash2I1 clone.

 
To determine whether ash2 function is necessary for transcriptional activation of bs, we used genetic mosaics. In wild-type third instar imaginal wings, bs is expressed in stripes corresponding to the intervein regions (Fig. 5G). When ash2I1 mutant clones fall within intervein tissue, bs expression is reduced. The most severe cases correspond to those clones located in B or D regions, where Bs expression is completely eliminated. Downregulated expression of bs is weaker in clones located in A, C and E regions (Fig. 5H-J). bs and rho expression is only mutually exclusive during pupal development, when bs promotes intervein differentiation and is expressed in intervein regions with abrupt borders with veins (Roch et al., 1998Go). In ash2112411 pupal wings, bs is also expressed in interveins, although the size of the expression domains is smaller than the corresponding wild type. These bs-expressing domains are separated by wide stripes, corresponding to veins (Fig. 5K-M). The pattern of bs expression in ash2112411 interveins is non-uniform, as indicated by the presence of negatively stained cells spread throughout the wing. Accordingly, pupal ash2I1 clones result in a clearer downregulation of bs (Fig. 5N-S).

Enhancer of split [E(spl)mß], a gene downstream of Notch, is also expressed in the wing pouch in broad domains that correspond to most interveins (de Celis et al., 1997Go). However, when we generated clones of ash2I1, we observed no effect on either E(spl)mß or plexus (px), another intervein-associated gene (Matakatsu et al., 1999Go) (data not shown).

As the phenotypes of double mutants in ash2 and either net or bs are reminiscent of mutants with reduced Dpp signalling (de Celis et al., 1996Go), we investigated whether the expression pattern of the Dpp target gene salm is altered in these flies or in ash2 single mutants. We found that in ash2I1/ash2I1 discs salm is slightly downregulated (Fig. 6A,B). In addition, ash2I1 clones resulted in weak cell-autonomous downregulation of salm (Fig. 6F-H). However, homozygous ash2112411 discs express salm in a central domain (Fig. 6C), as in net1/net1; ash2112411/ash2112411 and bs03267/+; ash2112411/ash2112411 discs (Fig. 6D,E). In all these cases, the expression pattern resembles wild type. We also tested for possible alterations of brk, an antagonist of the Dpp signalling pathway that is expressed in peripheral cells of the wing disc in a pattern complementary to the sal-C domain (Campbell and Tomlinson, 1999Go; Jazwinska et al., 1999Go). However, ash2I1 clones in the wing did not show any perturbation of brk expression (Fig. 6I-L).



View larger version (83K):
[in this window]
[in a new window]
 
Fig. 6. Patterns of sal (A-H) and brk (I-L) expression in wing discs. (A) Wild type. (B) ash2I1/ash2I1 showing reduced sal expression. (C) ash2112411/ash2112411. (D) net1/net1; ash2112411/ash2112411. (E) bs03267/+; ash2112411/ash2112411. (F-H) ash2I1 mutant clones, marked by the absence of GFP. (G) salm expression is reduced in ash2I1 clones. (H) Merged green and red channels. (I) brk expression is visualised by means of the brk-lacZ reporter X47 in a wild-type wing disc. (J) High magnification of the boxed area indicated in I, ash2I1 clones lack GFP. (K) There is no change in ß-galactosidase expression in ash2I1 mutant cells. (L) Merged images of J and K. Scale bars: 20 µm.

 
ash2 inhibits kni expression
We next examined whether the function of ash2 is exclusive to vein/intervein differentiation or whether vein positioning genes are also targeted. As ash2112411 shows a crooked L2 and the expression of kni-C is required to organise this vein, we studied a possible interaction between the two genes. Analysis with anti-Kni reveals kni expression in L2 and in some cells of the wing pouch margin in wild-type discs (Fig. 7A), while in ash2I1 homozygous mutant discs its expression is expanded throughout the whole disc (Fig. 7B). Some expansion of kni expression is also found in ash2112411 discs, which in addition show discrete Kni-staining of L2 (Fig. 7C). We also tested the effects in mitotic clones and found that kni is upregulated in ash2I1 clones (Fig. 7D-L). This effect is cell-autonomous. Activation of kni was observed in twin and Minute+ clones generated in early developing discs, as well as in small clones generated late in development, suggesting that the activation of kni by ash2I1 can occur at any stage of larval development.



View larger version (86K):
[in this window]
[in a new window]
 
Fig. 7. ash2 regulates kni expression. kni in wild-type (A), ash2I1/ash2I1 (B) and ash2112411/ash2112411 (C) wing discs. (D) Minute+ clones homozygous for ash2I1 induced at 110±4 hours AEL are marked by the absence of ß-galactosidase. (E) Expression of kni is cell-autonomously upregulated by the loss of ash2 function (arrow). There is residual kni expression in heterozygous tissue. (F) Merged images of C and D. (G) Clones homozygous for ash2I1 induced at 52±4 hours AEL are marked as black spots by the absence of GFP and twin clones of wild-type cells appear as intense green spots. (H) kni expression is upregulated in homozygous ash2I1 mutant cells and residual kni disappears in cells homozygous for GFP. (I) Merged green and red channels of F and G. (J) Detail of a clone. Homozygous GFP cells are outlined in white (HMZ) and homozygous ash2I1 cells are outlined in yellow. HTZ. heterozygous tissue. (K) Anti-Kni staining of the same disc. One mutant copy of ash2 is enough to de-repress kni expression. (L) Merged images of I and J, and an additional channel with nuclear labelling (propidium iodide, shown in blue). (M) Detail of endogenous Kni (red) showing nuclear localisation (blue) in the L2 domain (pink in lower panel corresponds to nuclear labelling). (N) Detail of an ash2I1 clone; Kni is mainly cytoplasmic, although nuclei also contain some protein. (O) Adult kniri–1/kniri–1 wing. (P) kniri–1/kniri–1 ash2112411/ash2112411 wing showing rescue of L2 vein. (Q) rho expression in pupal kniri–1/kniri–1 wing. (R) rho expression in pupal kniri–1/kniri–1 ash2112411/ash2112411 wing. There is distal expression in L2. (S) RT-PCR showing increased kni mRNA in ash2I1 homozygous larvae compared with wild type. Rp49 is shown as a control. Scale bars: 20 µm.

 
We observed that although ash2 homozygous cells within the Minute+ clone show a strong activation of kni, the heterozygous cells show residual activity in the whole wing disc (Fig. 7E). To test whether this residual activity is due to the lack of one copy of the ash2 gene, we generated twin clones (Fig. 7G-I) and found that the residual kni expression seen in heterozygous cells was completely missing in cells homozygous for the wild-type allele (Fig. 7J-L). This result supports kni de-repression not only in ash2 homozygous cells but also in ash2 heterozygous cells. However, whereas Kni in the L2 vein is nuclear, in homozygous ash2 clones, the localisation is both cytoplasmic and nuclear (Fig. 7M,N), suggesting that although there is an increase in Kni protein, it may not be fully functional. To gain insight into the interaction between ash2 and kni we analysed mutant combinations of ash2 and the hypomorphic allele kniri–1. In kniri–1 wings, the L2 vein fails to develop and the rest of the veins develop normally (Fig. 7O), whereas in kniri–1 ash2112411 double homozygous mutants, the L2 vein is partially (25%, n=58) or almost completely restored (75%, n=58; Fig. 7P) and rho is expressed in the L2 primordium (Fig. 7Q,R). Further evidence in favour of a role for ash2 as a repressor of kni was gained by semi-quantitative RT-PCR. We found that RNA from ash2I1 homozygous larvae contains significantly increased levels of kni, compared with wild-type larvae (Fig. 7S).

ash2 regulates kni expression independently of sal-C
We also examined whether repression of kni by ash2 is mediated by regulators of kni expression in the wing. A well-known regulator of kni in L2 is sal-C. Low levels of sal-C activate kni expression in the presumptive L2 region, whereas higher levels repress kni-C expression (de Celis and Barrio, 2000Go; Lunde et al., 1998Go). As we observed some perturbation of salm expression in ash2I1 tissues, we investigated whether the low levels of salm could be responsible for the ectopic kni expression. To achieve this, we generated ash2I1 clones in UAS-salm or UAS-salr backgrounds, using a nubbin-Gal4 driver. Adult wings overexpressing salm or salr lose L2 and L5 and show severe size reduction (de Celis et al., 1996Go) (Fig. 8A). Surprisingly, we observed that ash2 clones generated in those flies exhibit de-repression of kni, even when high levels of Salm are maintained in the clone (Fig. 8B-E). Therefore, we conclude that de-repression of kni induced by loss of function of ash2 is independent of sal-C. This interpretation is strengthened by the observation that in mitotic clones and in homozygous ash2I1 mutants the ectopic expression of kni is not exclusive to the sal-C domain (Fig. 7B,G). In regions outside the sal-C central domain, loss of ash2 also activates kni, in anterior as well as posterior cells.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 8. kni upregulation by ash2I1 is independent of sal-C downregulation. (A) Overexpression of sal-C from UAS-sal64d using a nubbin-Gal4 driver results in loss of L2 and L5 and severe reduction of wing size. (B) Wing imaginal disc showing ectopic expression of salm throughout the wing pouch. (C) ash2I1 homozygous clones are devoid of GFP. (D) kni expression is also upregulated in ash2I1 mutant clones even, when salm is overexpressed. (E) Merged images. Scale bars: 20 µm.

 
None of the other possible activators or inhibitors of the L2 enhancer, such as sd, vg or en, showed significant alteration of their expression in ash2I1 clones (data not shown). Moreover, using a lacZ reporter construct that includes a minimal L2 enhancer element containing only the activator and repressor sites (EX-lacZ) (Lunde et al., 2003Go), we observed no ß-galactosidase expression in ash2I1 homozygous discs or in mitotic clones (data not shown). Taken together, these results indicate that the ash2-induced repression of kni is independent of sal-C, and suggest that ash2 could be interacting with a kni enhancer other than L2.


    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
An important step towards understanding how cell determination is maintained is the identification of targets of the PcG and trxG genes. Although ash2 has been considered to be a member of the trxG (Adamson and Shearn, 1996Go), its biological and molecular function is still unknown. In this work, we show evidence that ash2 is required for normal vein/intervein patterning, and demonstrate that it plays a role in two major biological events – determination of intervein identity and maintenance of kni repression beyond L2.

Identifying intervein and vein target genes of ash2
Loss of ash2 function causes differentiation of ectopic vein tissue, indicating that ash2 is required for intervein development, where it functions as an activator of the intervein-promoting genes net and bs, restricting rho expression to vein regions. In addition, the loss-of-function phenotypes of Egfr alleles are rescued in ash2 mutants, while the gain-of-function phenotypes are enhanced. Furthermore, rho mRNA exhibits an expanded expression pattern in ash2 mutant tissues. Thus, ash2 promotes the maintenance of intervein fate, either by activation of net and bs or by repression of the Egfr pathway. As rho and bs/net expression is mutually exclusive, we cannot determine whether the Ash2 complex interacts directly with one or all of them. However, as bs expression is inhibited by the loss-of-function of ash2 during larval and pupal stages, we can propose that ash2 acts as a long-term chromatin imprint of bs that is stable throughout development.

Our results in adult clones and from analysis of genetic interactions suggest that ash2 acts principally by maintaining B and D intervein regions, as the C intervein remains unaltered in ash2 mutants. This region is under the control of organising genes that respond to the Hh signal (Tabata and Kornberg, 1994Go; Zecca et al., 1995Go). One of these genes is kn, which prevents vein differentiation in the C intervein (Crozatier et al., 2002Go; Mohler et al., 2000Go) and is required for the expression of bs in this domain (Vervoort et al., 1999Go). bs expression is regulated by two enhancer elements: the boundary enhancer, which is dependent on hh and controls bs expression in the C intervein region through kn; and another enhancer dependent on Dpp activity, which controls bs expression in B and D intervein domains (Nussbaumer et al., 2000Go). Thus, the role of ash2 as a positive regulator of bs is mainly restricted to regions beyond the kn domain where the Dpp dependent bs enhancer is active.

It has been found that some combinations of dpp alleles and mosaic clones of sal-C result in elimination of B and D intervein regions, along with fusion of their flanking veins (de Celis et al., 1996Go). Although the genetic interactions between ash2 and either bs or net could be the result of a synergistic failure to activate genes downstream of Dpp, our results indicate that this may not be the case because salm is expressed in the central domain of the wing pouch of those mutant combinations.

It has been recently shown that another trxG complex, the Brm complex, is involved in regulating wing vein development (Marenda et al., 2004Go). The authors found that components of that complex interact genetically with net and bs at pupal stages to regulate the expression of rho, and that the complex is specifically required in cells within and bordering L5 to mediate proper signalling. There are some key differences between the Brm complex and Ash2: (1) Ash2 maintains bs expression from the third instar stage; (2) the Ash2 complex is mainly required for interveins B and D; and (3) the enhancement or suppression phenotypes of the genetic interactions with Egfr and intervein-promoting alleles are much stronger for ash2 than for the Brm complex. Taken together, these results suggest that ash2 plays a crucial role in intervein identity and that each trxG complex acts in a specific spatiotemporal program to maintain organ identity.

Ash2 complex maintains kni in an off state
The positioning of vein tissues depends on the sal-C patterning dictated by the Dpp signalling pathway (Sturtevant et al., 1997Go; Sturtevant and Bier, 1995Go). Low levels of sal-C in the anterior compartment are required for the expression of kni-C, which triggers the differentiation of L2 (de Celis and Barrio, 2000Go; Lunde et al., 1998Go). We have shown that lack of ash2 activity results in downregulation of salm and upregulation of kni. Thus, it is possible that within the sal-C domain, the ectopic expression of kni is a result of low levels of salm. However, when high levels of salm or salr are maintained by ectopic activation, lack of ash2 nevertheless results in de-repression of kni. Moreover, kni is also cell-autonomously de-repressed by loss-of-function of ash2 in cells outside of the sal-C expression domain. Thus, the repression state in the whole wing must be maintained by factors other than sal-C. The kni/knirl L2-enhancer is subdivided into activation binding sites for Brk, En and the Sd/Vg complex, and repression binding sites for Sd/Vg, En, Salr and Brk (Lunde et al., 2003Go). We did not observe changes either in ß-gal expression from the EX-lacZ enhancer or in sd, vg, brk or en expression in clones lacking ash2. Therefore the de-repression of kni in ash2 mutant cells must be accounted for by a mechanism entirely different from that of the signal-dependent induction of L2, perhaps through another enhancer more global than that of L2.

The low levels of salm expression associated with ash2I1 clones may also be explained by de-repression of kni. In dorsal tracheal cells, kni/knrl activity represses salm transcription, and this repression is essential for branch formation. Similarly the establishment of the border between cells acquiring dorsal branch and dorsal trunk identity entails a direct interaction of Knirps with a salm cis-regulatory element (Chen et al., 1998Go). Also in the wing, kni and knrl are likely to refine the L2 position by positive auto-regulation of their own expression and by providing negative feedback to repress salm expression (Lunde et al., 1998Go).

It is possible that the de-repression of kni, intervein inhibition and appearance of extra vein tissues are linked events. The kni-C complex organises the development of the L2 vein by activating rho and inhibiting bs (Lunde et al., 1998Go; Montagne et al., 1996Go). Thus, kni-C participates in L2 morphogenesis by functioning downstream of salm and upstream of vein-intervein genes. The ectopic activation of kni by lack of ash2 could trigger intervein repression and vein activation. Indeed, ectopic activation of UAS-kni results in broad expression of rho and elimination of Bs expression in pupal wings, leading to the production of solid vein material (Lunde et al., 1998Go). However, in adult clones not all ash2 mutant cells develop vein tissue. This raises the possibility that de-repressed kni may not be fully functional, as ectopic kni is often localised to the cytoplasm rather than the nucleus. Alternatively, ash2 could have independent functions in the wing, maintenance of the repressed state of kni alongside maintenance of the intervein condition, by acting on different targets.

The ash2112411 mutation can partially rescue the loss of L2 in kniri–1 mutants. This is in contrast to our observation that the L2 enhancer appears not to mediate the effect of ash2. The kniri–1 allele is a 252 bp deletion in the enhancer of L2 (Lunde et al., 2003Go) that results in lack of kni expression in L2 (Lunde et al., 1998Go). It has been shown, however, that it is possible to rescue the vein-loss phenotype of kniri–1 by expressing a UAS-rho transgene in L2 (Lunde et al., 2003Go). In addition, double mutant flies for kniri–1 and net partially rescue L2 (Diaz-Benjumea and Garcia-Bellido, 1990Go). It is therefore likely that the antagonistic effect of ash2 on rho could account for the partial rescue of L2 in kniri–1 ash2112411 wings, as rho mRNA is expressed in the rescued L2.

Some PcG genes are known to be required for the maintenance of kni expression domains in the embryo (McKeon et al., 1994Go; Pelegri and Lehmann, 1994Go; Saget et al., 1998Go). It is also likely that some trxG genes or other complexes of trxG proteins, such as the Ash2 complex (Papoulas et al., 1998Go), may interact with repressor sequences necessary to keep kni expression in an off state beyond L2. Moreover, in a genome wide prediction screen it has been shown that kni contains PRE/TREs (Ringrose et al., 2003Go). Thus, we propose here that ash2 acts as regulator of kni expression in the wing through an epigenetic mechanism of cellular memory similar to the trx-G regulation of homeotic genes, albeit that it remains to be seen whether kni is a direct or indirect target of ash2.

Cellular memory and morphogen gradients
A well-studied mechanism through which to induce and preserve cell identities in wing imaginal discs is the response to gradients of the morphogen Dpp. This raises questions about the extent to which the response to Dpp occurs through concentration-dependent mechanisms or cellular memory. There is compelling evidence in favour of the existence of Dpp gradients that organise the pattern and growth of the wing imaginal disc (Podos and Ferguson, 1999Go; Strigini and Cohen, 1999Go). Dpp signalling causes a graded transcriptional regulation of brk by an interaction between the Dpp transducers and a brk morphogen-regulated silencer (Muller et al., 2003Go). Thus, brk appears to respond to direct morphogenetic signalling rather than remembering the inputs of previous developmental events. However, whereas activation of salm requires continuous signalling through the Dpp pathway (Lecuit et al., 1996Go; Nellen et al., 1996Go), other targets of Dpp, such as omb, remember exposure to the signal (Lecuit et al., 1996Go). We have shown here that stable regulation of other genes involved in wing development, such as kni repression, and net and bs activation, would also respond to the cellular memory conferred by epigenetic marks of the Ash2 complex. Thus, both mechanisms – morphogen-dependant, which will be required for growth and patterning, and epigenetic, which will keep specific genes in an off or on state – are likely to act simultaneously to maintain cellular identities within the wing.

Because many developmental regulators are only expressed transiently during development, the function of epigenetic complexes is likely to be very dynamic. The developmental events required for the construction of the wing, as with many other morphogenetic events, cannot only rely on an on or off state of gene expression. Instead, morphogenesis is rather malleable and epigenetic marks could act as a means to facilitate, rather that fix, the preservation of developmental fates. It may well be that the epigenetic marks of the Ash2 complex allow changes in chromatin structure to assist the access of proteins that activate or repress gene expression. From an epigenetic point of view, the ultimate refinement of morphogenesis and maintenance of cellular memory will depend upon the interaction of these chromatin remodelling complexes with the factors that trigger or inhibit transcription.


    ACKNOWLEDGMENTS
 
We are grateful to J. F. de Celis, F. Roch and E. Moreno for advice and constructive criticism. We thank A. García Bellido, J. F. de Celis, M. Affolter, E. Bier, E. Moreno and G. Morata for providing stocks; J. Reinitz, M. Affolter, H. Matakatsu, S. Carroll and R. Barrio for providing antibodies; and M. Noll, E. Bier and J. F. de Celis for the constructs used to make riboprobes. We also acknowledge the Bloomington Stocks Center and the Developmental Studies Hybridoma Bank for sending all the stocks and antibodies requested. We especially thank E. Moreno and S. Beltran for helpful comments on the manuscript, and M. Milán and M. Marsal for advice on pupal wings and in situ hybridisation. M.A. is the recipient of a fellowship from Universitat de Barcelona (UB). This work was supported by the Ministerio de Ciencía y Tecnologia (Spain), grants BMC2000-0766, BMC2003-05018 and HI2001-0009.


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 

Adamson, A. L. and Shearn, A. (1996). Molecular genetic analysis of Drosophila ash2, a member of the trithorax group required for imaginal disc pattern formation. Genetics 144,621 -633.[Abstract]

Amoros, M., Corominas, M., Deak, P. and Serras, F. (2002). The ash2 gene is involved in Drosophila wing development. Int. J. Dev. Biol. 46,321 -324.[Medline]

Beltran, S., Blanco, E., Serras, F., Perez-Villamil, B., Guigo, R., Artavanis-Tsakonas, S. and Corominas, M. (2003). Transcriptional network controlled by the trithorax-group gene ash2 in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 100,3293 -3298.[Abstract/Free Full Text]

Biehs, B., Sturtevant, M. A. and Bier, E. (1998). Boundaries in the Drosophila wing imaginal disc organize vein-specific genetic programs. Development 125,4245 -4257.[Abstract]

Bier, E. (2000). Drawing lines in the Drosophila wing: initiation of wing vein development. Curr. Opin. Genet. Dev. 10,393 -398.[CrossRef][Medline]

Bier, E., Jan, L. Y. and Jan, Y. N. (1990). rhomboid, a gene required for dorsoventral axis establishment and peripheral nervous system development in Drosophila melanogaster. Genes Dev. 4,190 -203.[Abstract/Free Full Text]

Brentrup, D., Lerch, H., Jackle, H. and Noll, M. (2000). Regulation of Drosophila wing vein patterning: net encodes a bHLH protein repressing rhomboid and is repressed by rhomboid-dependent Egfr signalling. Development 127,4729 -4741.[Abstract]

Campbell, G. and Tomlinson, A. (1999). Transducing the Dpp morphogen gradient in the wing of Drosophila: regulation of Dpp targets by brinker. Cell 96,553 -562.[CrossRef][Medline]

Chen, C. K., Kuhnlein, R. P., Eulenberg, K. G., Vincent, S., Affolter, M. and Schuh, R. (1998). The transcription factors KNIRPS and KNIRPS RELATED control cell migration and branch morphogenesis during Drosophila tracheal development. Development 125,4959 -4968.[Abstract]

Clifford, R. J. and Schupbach, T. (1989). Coordinately and differentially mutable activities of torpedo, the Drosophila melanogaster homolog of the vertebrate EGF receptor gene. Genetics 123,771 -787.[Abstract/Free Full Text]

Collins, R. T. and Treisman, J. E. (2000). Osa-containing Brahma chromatin remodeling complexes are required for the repression of wingless target genes. Genes Dev. 14,3140 -3152.[Abstract/Free Full Text]

Cook, O., Biehs, B. and Bier, E. (2004). brinker and optomotor-blind act coordinately to initiate development of the L5 wing vein primordium in Drosophila. Development 131,2113 -2124.[Abstract/Free Full Text]

Crozatier, M., Glise, B. and Vincent, A. (2002). Connecting Hh, Dpp and EGF signalling in patterning of the Drosophila wing; the pivotal role of collier/knot in the AP organiser. Development 129,4261 -4269.

de Celis, J. F. and Barrio, R. (2000). Function of the spalt/spalt-related gene complex in positioning the veins in the Drosophila wing. Mech. Dev. 91, 31-41.[CrossRef][Medline]

de Celis, J. F., Barrio, R. and Kafatos, F. C. (1996). A gene complex acting downstream of dpp in Drosophila wing morphogenesis. Nature 381,421 -424.[CrossRef][Medline]

de Celis, J. F., Bray, S. and Garcia-Bellido, A. (1997). Notch signalling regulates veinlet expression and establishes boundaries between veins and interveins in the Drosophila wing. Development 124,1919 -1928.[Abstract]

Deak, P., Omar, M. M., Saunders, R. D., Pal, M., Komonyi, O., Szidonya, J., Maroy, P., Zhang, Y., Ashburner, M., Benos, P. et al. (1997). P-element insertion alleles of essential genes on the third chromosome of Drosophila melanogaster: correlation of physical and cytogenetic maps in chromosomal region 86E-87F. Genetics 147,1697 -1722.[Abstract]

Diaz-Benjumea, F. J. and Garcia-Bellido, A. (1990). Behaviour of cells mutant for an EGF receptor homologue of Drosophila in genetic mosaics. Proc. R. Soc. Lond., B, Biol. Sci. 242,36 -44.[Medline]

Diaz-Benjumea, F. J. and Hafen, E. (1994). The sevenless signalling cassette mediates Drosophila EGF receptor function during epidermal development. Development 120,569 -578.[Abstract]

Francis, N. J. and Kingston, R. E. (2001). Mechanisms of transcriptional memory. Nat. Rev. Mol. Cell Biol. 2,409 -421.[CrossRef][Medline]

Fristrom, D., Gotwals, P., Eaton, S., Kornberg, T. B., Sturtevant, M., Bier, E. and Fristrom, J. W. (1994). Blistered: a gene required for vein/intervein formation in wings of Drosophila. Development 120,2661 -2671.[Abstract/Free Full Text]

Garcia-Bellido, A. and de Celis, J. F. (1992). Developmental genetics of the venation pattern of Drosophila. Annu. Rev. Genet. 26,277 -304.[CrossRef][Medline]

Jazwinska, A., Kirov, N., Wieschaus, E., Roth, S. and Rushlow, C. (1999). The Drosophila gene brinker reveals a novel mechanism of Dpp target gene regulation. Cell 96,563 -573.[CrossRef][Medline]

Karpen, G. H. and Spradling, A. C. (1992). Analysis of subtelomeric heterochromatin in the Drosophila minichromosome Dp1187 by single P element insertional mutagenesis. Genetics 132,737 -753.[Abstract]

LaJeunesse, D. and Shearn, A. (1995). Trans-regulation of thoracic homeotic selector genes of the Antennapedia and bithorax complexes by the trithorax group genes: absent, small, and homeotic discs 1 and 2. Mech. Dev. 53,123 -139.[CrossRef][Medline]

Lawrence, P. A. and Struhl, G. (1996). Morphogens, compartments, and pattern: lessons from drosophila? Cell 85,951 -961.[CrossRef][Medline]

Lecuit, T., Brook, W. J., Ng, M., Calleja, M., Sun, H. and Cohen, S. M. (1996). Two distinct mechanisms for long-range patterning by Decapentaplegic in the Drosophila wing. Nature 381,387 -393.[CrossRef][Medline]

Lunde, K., Biehs, B., Nauber, U. and Bier, E. (1998). The knirps and knirps-related genes organize development of the second wing vein in Drosophila. Development 125,4145 -4154.[Abstract]

Lunde, K., Trimble, J. L., Guichard, A., Guss, K. A., Nauber, U. and Bier, E. (2003). Activation of the knirps locus links patterning to morphogenesis of the second wing vein in Drosophila.Development 130,235 -248.[Abstract/Free Full Text]

Marenda, D. R., Zraly, C. B. and Dingwall, A. K. (2004). The Drosophila Brahma (SWI/SNF) chromatin remodeling complex exhibits cell-type specific activation and repression functions. Dev. Biol. 267,279 -293.[CrossRef][Medline]

Matakatsu, H., Tadokoro, R., Gamo, S. and Hayashi, S. (1999). Repression of the wing vein development in Drosophila by the nuclear matrix protein plexus. Development 126,5207 -5216.[Abstract]

Maurange, C. and Paro, R. (2002). A cellular memory module conveys epigenetic inheritance of hedgehog expression during Drosophila wing imaginal disc development. Genes Dev. 16,2672 -2683.[Abstract/Free Full Text]

McKeon, J., Slade, E., Sinclair, D. A., Cheng, N., Couling, M. and Brock, H. W. (1994). Mutations in some Polycomb group genes of Drosophila interfere with regulation of segmentation genes. Mol. Gen. Genet. 244,474 -483.[CrossRef][Medline]

Mohler, J., Seecoomar, M., Agarwal, S., Bier, E. and Hsai, J. (2000). Activation of knot (kn) specifies the 3-4 intervein region in the Drosophila wing. Development 127,55 -63.[Abstract]

Montagne, J., Groppe, J., Guillemin, K., Krasnow, M. A., Gehring, W. J. and Affolter, M. (1996). The Drosophila Serum Response Factor gene is required for the formation of intervein tissue of the wing and is allelic to blistered. Development 122,2589 -2597.[Abstract]

Muller, B., Hartmann, B., Pyrowolakis, G., Affolter, M. and Basler, K. (2003). Conversion of an extracellular Dpp/BMP morphogen gradient into an inverse transcriptional gradient. Cell 113,221 -233.[CrossRef][Medline]

Nellen, D., Burke, R., Struhl, G. and Basler, K. (1996). Direct and long-range action of a DPP morphogen gradient. Cell 85,357 -368.[CrossRef][Medline]

Nussbaumer, U., Halder, G., Groppe, J., Affolter, M. and Montagne, J. (2000). Expression of the blistered/DSRF gene is controlled by different morphogens during Drosophila trachea and wing development. Mech. Dev. 96, 27-36.[CrossRef][Medline]

Orlando, V. (2003). Polycomb, epigenomes, and control of cell identity. Cell 112,599 -606.[CrossRef][Medline]

Papoulas, O., Beek, S. J., Moseley, S. L., McCallum, C. M., Sarte, M., Shearn, A. and Tamkun, J. W. (1998). The Drosophila trithorax group proteins BRM, ASH1 and ASH2 are subunits of distinct protein complexes. Development 125,3955 -3966.[Abstract]

Pelegri, F. and Lehmann, R. (1994). A role of polycomb group genes in the regulation of gap gene expression in Drosophila. Genetics 136,1341 -1353.[Abstract]

Podos, S. D. and Ferguson, E. L. (1999). Morphogen gradients: new insights from DPP. Trends Genet. 15,396 -402.[CrossRef][Medline]

Ringrose, L., Rehmsmeier, M., Dura, J. M. and Paro, R. (2003). Genome-wide prediction of Polycomb/Trithorax response elements in Drosophila melanogaster. Dev. Cell 5, 759-771.[CrossRef][Medline]

Roch, F., Baonza, A., Martin-Blanco, E. and Garcia-Bellido, A. (1998). Genetic interactions and cell behaviour in blistered mutants during proliferation and differentiation of the Drosophila wing. Development 125,1823 -1832.[Abstract]

Saget, O., Forquignon, F., Santamaria, P. and Randsholt, N. B. (1998). Needs and targets for the multi sex combs gene product in Drosophila melanogaster. Genetics 149,1823 -1838.[Abstract/Free Full Text]

Schnepp, B., Grumbling, G., Donaldson, T. and Simcox, A. (1996). Vein is a novel component in the Drosophila epidermal growth factor receptor pathway with similarity to the neuregulins. Genes Dev. 10,2302 -2313.[Abstract/Free Full Text]

Shearn, A. (1974). Complementation analysis of late lethal mutants of Drosophila melanogaster.Genetics 77,115 -125.[Abstract/Free Full Text]

Shearn, A. (1989). The ash-1, ash-2 and trithorax genes of Drosophila melanogaster are functionally related. Genetics 121,517 -525.[Abstract/Free Full Text]

Shearn, A., Rice, T., Garen, A. and Gehring, W. (1971). Imaginal disc abnormalities in lethal mutants of Drosophila. Proc. Natl. Acad. Sci. USA 68,2594 -2598.[Abstract/Free Full Text]

Shearn, A., Hersperger, E. and Hersperger, G. (1987). Genetic studies of mutations at low loci of Drosophila melanogaster which cause a wide variety of homeotic transformations. Roux's Arch. Dev. Biol. 196,231 -242.[CrossRef]

Simon, J. (1995). Locking in stable states of gene expression: transcriptional control during Drosophila development. Curr. Opin. Cell Biol. 7, 376-385.[CrossRef][Medline]

Simon, J. A. and Tamkun, J. W. (2002). Programming off and on states in chromatin: mechanisms of Polycomb and trithorax group complexes. Curr. Opin. Genet. Dev. 12,210 -218.[CrossRef][Medline]

Strigini, M. and Cohen, S. M. (1999). Formation of morphogen gradients in the Drosophila wing. Semin. Cell Dev. Biol. 10,335 -344.[CrossRef][Medline]

Sturtevant, M. A. and Bier, E. (1995). Analysis of the genetic hierarchy guiding wing vein development in Drosophila.Development 121,785 -801.[Abstract]

Sturtevant, M. A., Roark, M. and Bier, E. (1993). The Drosophila rhomboid gene mediates the localized formation of wing veins and interacts genetically with components of the EGF-R signaling pathway. Genes Dev. 7, 961-973.[Abstract/Free Full Text]

Sturtevant, M. A., Biehs, B., Marin, E. and Bier, E. (1997). The spalt gene links the A/P compartment boundary to a linear adult structure in the Drosophila wing. Development 124,21 -32.[Abstract]

Tabata, T. and Kornberg, T. B. (1994). Hedgehog is a signaling protein with a key role in patterning Drosophila imaginal discs. Cell 76,89 -102.[CrossRef][Medline]

Vervoort, M., Crozatier, M., Valle, D. and Vincent, A. (1999). The COE transcription factor Collier is a mediator of short-range Hedgehog-induced patterning of the Drosophila wing. Curr. Biol. 9,632 -639.[CrossRef][Medline]

Xu, T. and Rubin, G. M. (1993). Analysis of genetic mosaics in developing and adult Drosophila tissues. Development 117,1223 -1237.[Abstract]

Zecca, M., Basler, K. and Struhl, G. (1995). Sequential organizing activities of engrailed, hedgehog and decapentaplegic in the Drosophila wing. Development 121,2265 -2278.[Abstract]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Genes Dev.Home page
J. Secombe, L. Li, L. Carlos, and R. N. Eisenman
The Trithorax group protein Lid is a trimethyl histone H3K4 demethylase required for dMyc-induced cell growth
Genes & Dev., March 1, 2007; 21(5): 537 - 551.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.01380v1
131/20/4943    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Angulo, M.
Right arrow Articles by Serras, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Angulo, M.
Right arrow Articles by Serras, F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?