|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 15 September 2004
doi: 10.1242/dev.01380
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Departament de Genètica, Universitat de Barcelona, Diagonal 645, Barcelona 08028, Spain
* Author for correspondence (e-mail: fserras{at}ub.edu)
Accepted 23 July 2004
| SUMMARY |
|---|
|
|
|---|
Key words: ash2, Cellular memory, Imaginal disc, knirps, Drosophila
| Introduction |
|---|
|
|
|---|
Genes of the Polycomb (PcG) and trithorax group (trxG) encode proteins that
are engaged in the regulation of cellular memory
(Orlando, 2003
). In early
Drosophila embryonic development, Hox gene expression is controlled
by a genetic cascade that includes the segmentation genes
(Simon, 1995
). When the
segmentation proteins decay, Hox expression is maintained in the correct
spatiotemporal pattern by the action of PcG and trxG genes, which often act as
transcriptional repressor- and activator-chromatin complexes
(Francis and Kingston, 2001
;
Simon and Tamkun, 2002
). In
addition to Hox genes, PcG/trxG also act on other target genes
(Beltran et al., 2003
;
Francis and Kingston, 2001
).
In a genome-wide prediction of PcG/trxG response elements (PRE/TRE) in
Drosophila, more than 100 elements were identified that mapped to
genes involved in development and cell proliferation
(Ringrose et al., 2003
).
However, epigenetic marks are not only restricted to embryonic stages. At
later stages, developmental fates are also frozen and inherited by the
repressor and activator activities of PcG/trxG complexes. The
Drosophila wing imaginal disc has proven to be a useful model with
which to study how these complexes act to maintain cell identities, as shown
for wingless (wg) and hedgehog (hh)
pathways (Collins and Treisman,
2000
; Maurange and Paro,
2002
).
The non-neural tissues of the Drosophila wing are organised into
two types: the A-E intervein regions and the L1-L6 veins
(Fig. 1A). The specification of
veins in the wing imaginal disc occurs during larval and pupal stages, and is
controlled by a network of cell-to-cell interactions, including the
Egfr signalling pathway
(Diaz-Benjumea and Hafen,
1994
). The rho gene, which encodes a seven-pass
transmembrane serine protease, is an activator of Egfr
(Bier et al., 1990
;
Sturtevant et al., 1993
).
rho is expressed in rows of cells coinciding with vein primordia and
is required for vein formation, as indicated by the observation that the
loss-of-function allele rhove displays truncated veins
(Diaz-Benjumea and Garcia-Bellido,
1990
; Sturtevant et al.,
1993
). Localised expression of rho and vein
(vn), which encodes a diffusible neuregulin class of ligands,
activates the Ras/MAPK signalling cascade necessary for vein differentiation
(Sturtevant et al., 1993
;
Schnepp et al., 1996
). By
contrast, inhibition of Egfr signalling by the transcription factors
blistered (bs) and net is responsible for intervein
specification. bs, the Drosophila homologue of the Serum
Response Factor, is expressed in a pattern associated with intervein regions
and is required for the organisation and differentiation of intervein cells
(Fristrom et al., 1994
;
Montagne et al., 1996
). During
disc proliferation, bs expression is independent of rho, but
during the pupal period bs and rho expression become
mutually exclusive (Roch et al.,
1998
). The net gene, which encodes a basic
helix-loop-helix (bHLH) protein, is also expressed in the intervein regions
(Brentrup et al., 2000
). In
contrast to bs, net and rho expression is mutually exclusive
in the wing discs of third instar larvae. Lack of net activity causes
rho expression to expand, and vice versa. Furthermore, ectopic
rho expression results in repression of net, thus generating
wings with ectopic vein tissue (Brentrup et
al., 2000
).
|
Ash2 is a trxG protein that belongs to a 0.5 MDa complex thought to be
involved in chromatin remodelling
(Papoulas et al., 1998
). Ash2
accumulates uniformly in imaginal discs, fat body cells and salivary glands
(Adamson and Shearn, 1996
).
Loss-of-function alleles of this gene cause homeotic transformations
(LaJeunesse and Shearn, 1995
;
Shearn, 1974
;
Shearn et al., 1987
;
Shearn, 1989
;
Shearn et al., 1971
) and
downregulation of Hox genes (Beltran et
al., 2003
; LaJeunesse and
Shearn, 1995
), in addition to severe abnormalities in the wing,
such as reduction of intervein and enhancement of vein tissues
(Adamson and Shearn, 1996
;
Amorós et al., 2002
). To
gain more insight into the function of ash2, we examined whether
vein- and intervein-specific genes and vein positioning genes act as putative
targets of ash2 function. We found that ash2 is involved in
activating intervein-promoting genes and downregulating the Egfr pathway.
Moreover, ash2 also acts as a kni repressor independently of
sal-C. These results strongly support a role for ash2 in
maintaining vein/intervein developmental decisions and vein patterning in the
developing wing.
| Materials and methods |
|---|
|
|
|---|
Genetic mosaics
Clones mutant for ash2I1 were obtained by mitotic
recombination using the FLP/FRT technique
(Xu and Rubin, 1993
).
yw;FRT82Bash2I1/TM6C crossed with
ywhsflp;FRT82BGFP/TM6B and wing imaginal discs from third instar
Tubby+ larvae and pupae were dissected. Heat shock was carried out
for 30 minutes at 37°C [52±4 hours after egg laying (AEL)] to
induce clone formation. To monitor EX-lacZ
(Lunde et al., 2003
)
expression, a yw; EX-lacZ; FRT82Bash2I1/TM6C stock was
created and clones were induced as above.
Overexpression of sal-C was obtained by crossing UAS-Sal64d; FRT82Bash2I1/+ males flies with were ywhsflp; nubbin-Gal4; FRT82BGFP/TM6B females. Tubby+ female larvae were dissected. To monitor brk and sd expression, brkX47-lacZ; FRT82Bash2I1/+ males and sdEXT4-lacZ; FRT82Bash2I1/+ males were crossed to ywhsflp;FRT82BGFP/TM6B and Tubby+ female larvae were dissected. In both cases, only 50% of the progeny contained ash2I1 clones.
To obtain Minute+ clones the stock used was yw; FRT82B arm-lacZ M(3)/TM6C and heat shock was carried out for 7 minutes at 34°C (110±4 hours AEL). Adult ash2 mutant FLP/FRT M+ clones marked with the forked mutation were analysed in males with the following genotype: ywhsflpf36a; FRT82BP[f+]87DM(3)w[124]/FRT82Bash2I1. The heat shock was carried out for 10 minutes at 37°C (80±12 hours AEL).
Larvae and pupae of the appropriate genotypes were cultured at 25°C and timed in hours AEL or after puparium formation (APF).
Immunohistochemistry
Immunohistochemistry was performed according to standard protocols. Primary
antibodies used were: guinea pig anti-Kni (1/50), provided by J. Reinitz;
rabbit anti-Salm (1/500), provided by R. Barrio; rat anti-Bs (1/200), provided
by M. Affolter; rabbit anti-Plexus (1/1000), provided by H. Matakatsu; rabbit
anti-Vestigial (1/20), provided by S. Carroll; mouse anti-En (1/25) from the
Developmental Studies Hybridoma Bank of the University of Iowa; and rabbit
anti-ß-galactosidase (Cappel) (1/1000). Kni, Salm and Vestigial
antibodies were pre-absorbed before use.
Secondary antibodies were obtained from Jackson Immuno Research and include: donkey anti-rat-Rhodamine Red (1/200), donkey anti-guinea pig-Cy5 (1/400), goat anti-mouse-FITC (1/200) and donkey anti-rabbit-Rhodamine Red (1/200). Propidium Iodide (Molecular Probes) was used as a nuclear marker after RNAase treatment. Fluorescence was visualised with a Leica TCS confocal microscope.
Whole-mount in situ hybridisation with larval wing discs and pupal wings
In situ hybridisation using digoxigenin-labelled antisense RNA probes was
carried out essentially as described previously
(Sturtevant et al., 1993
;
Brentrup et al., 2000
).
DIG-labelled riboprobes for net RNA were synthesised using a 2.2
kb insert of netcel
922 (gift of M. Noll) linearised with
EcoR1, and for rho from a rho cDNA clone (gift of
E. Bier) linearised with HindIII. Sense RNA probes for net
and rho did not show detectable signal.
RT-PCR
Total RNA from wild-type and ash2I1 homozygous larvae
was extracted using Trizol (GibcoBRL) and a poly(dT)-24 primer was used for
cDNA synthesis. The reaction was carried out in a final volume of 25 µl
with five units of avian myeloblastosis virus-RT (Promega) and 200 units of
Moloney murine leukaemia virus RT (Gibco). One microlitre of the RT reaction
was used for PCR. The specific primers used
[5'-cgccgccctgcccttcttc-3' (forward) and
5'gggctgctgctagtcggagtggt 3' (reverse)] were designed to amplify a
369 bp product of the kni gene.
| Results |
|---|
|
|
|---|
We perturbed the Ras/MAPK signalling pathway in the wing using mutants of genes required for Egfr activation. We first analysed loss-of-function mutants of the pathway. In flies mutant for the hypomorphic viable combination rhove vn1, activation of the MAPK pathway in presumptive vein cells is prevented and, as a consequence, veins fail to differentiate. By contrast, the triple mutant rhove vn1 ash2112411 develops veins (Fig. 2A,B). We observed varying degrees of rescue, ranging from wings that develop only L2 to wings that develop veins almost completely, even with extra crossvein tissue or proximal vein fusions between L2-L3 and L4-L5. Rescue of L2 and L5 is more pronounced than L3 and L4, which are never distally complete, and many wings show notches in the posterior wing margin (77% of cases, n=75 wings; Fig. 2B). In 25% of these cases, wings show a tube-like shape, possibly owing to detachment of the dorsal and ventral cell layers. This variety of phenotypes is probably due to the variable expressivity found in the ash2112411 allele. The top1/top3C81 allelic combination is a hypomorphic mutation of Egfr (top) in which wings lack the anterior crossvein (a-cv) and a segment of vein L4 (Fig. 2C). Rescue of missing vein tissues is observed in top1/top3C81; ash2I1/+ flies, as shown by the presence of a-cv (58% of the cases, n=93), a complete L4 (4%), or restoration of both a-cv and L4 (28%; Fig. 2D).
|
As these results indicate that ash2 antagonises the Egfr pathway, we tested whether rho expression is affected. In situ hybridisation for rho mRNA in third instar ash2I1 discs showed either no expression at all or expression in only a few scattered cells (Fig. 3A,B), possibly owing to a strong perturbation of patterning in these discs. However, in ash2112411 homozygous pupal wings, rho is expressed and organised in veins, but the domains of rho expression are larger (Fig. 3C-F).
|
|
|
Enhancer of split [E(spl)mß], a gene downstream of
Notch, is also expressed in the wing pouch in broad domains that correspond to
most interveins (de Celis et al.,
1997
). However, when we generated clones of
ash2I1, we observed no effect on either
E(spl)mß or plexus (px), another
intervein-associated gene (Matakatsu et
al., 1999
) (data not shown).
As the phenotypes of double mutants in ash2 and either
net or bs are reminiscent of mutants with reduced Dpp
signalling (de Celis et al.,
1996
), we investigated whether the expression pattern of the Dpp
target gene salm is altered in these flies or in ash2 single
mutants. We found that in ash2I1/ash2I1 discs
salm is slightly downregulated
(Fig. 6A,B). In addition,
ash2I1 clones resulted in weak cell-autonomous
downregulation of salm (Fig.
6F-H). However, homozygous ash2112411 discs
express salm in a central domain
(Fig. 6C), as in
net1/net1;
ash2112411/ash2112411 and bs03267/+;
ash2112411/ash2112411 discs
(Fig. 6D,E). In all these
cases, the expression pattern resembles wild type. We also tested for possible
alterations of brk, an antagonist of the Dpp signalling pathway that
is expressed in peripheral cells of the wing disc in a pattern complementary
to the sal-C domain (Campbell and
Tomlinson, 1999
; Jazwinska et
al., 1999
). However, ash2I1 clones in the wing
did not show any perturbation of brk expression
(Fig. 6I-L).
|
|
ash2 regulates kni expression independently of sal-C
We also examined whether repression of kni by ash2 is
mediated by regulators of kni expression in the wing. A well-known
regulator of kni in L2 is sal-C. Low levels of
sal-C activate kni expression in the presumptive L2 region,
whereas higher levels repress kni-C expression
(de Celis and Barrio, 2000
;
Lunde et al., 1998
). As we
observed some perturbation of salm expression in
ash2I1 tissues, we investigated whether the low levels of
salm could be responsible for the ectopic kni expression. To
achieve this, we generated ash2I1 clones in
UAS-salm or UAS-salr backgrounds, using a
nubbin-Gal4 driver. Adult wings overexpressing salm or
salr lose L2 and L5 and show severe size reduction
(de Celis et al., 1996
)
(Fig. 8A). Surprisingly, we
observed that ash2 clones generated in those flies exhibit
de-repression of kni, even when high levels of Salm are maintained in
the clone (Fig. 8B-E). Therefore, we conclude that de-repression of kni induced by loss of
function of ash2 is independent of sal-C. This
interpretation is strengthened by the observation that in mitotic clones and
in homozygous ash2I1 mutants the ectopic expression of
kni is not exclusive to the sal-C domain
(Fig. 7B,G). In regions outside
the sal-C central domain, loss of ash2 also activates
kni, in anterior as well as posterior cells.
|
| Discussion |
|---|
|
|
|---|
Identifying intervein and vein target genes of ash2
Loss of ash2 function causes differentiation of ectopic vein
tissue, indicating that ash2 is required for intervein development,
where it functions as an activator of the intervein-promoting genes
net and bs, restricting rho expression to vein
regions. In addition, the loss-of-function phenotypes of Egfr alleles
are rescued in ash2 mutants, while the gain-of-function phenotypes
are enhanced. Furthermore, rho mRNA exhibits an expanded expression
pattern in ash2 mutant tissues. Thus, ash2 promotes the
maintenance of intervein fate, either by activation of net and
bs or by repression of the Egfr pathway. As rho and
bs/net expression is mutually exclusive, we cannot determine
whether the Ash2 complex interacts directly with one or all of them. However,
as bs expression is inhibited by the loss-of-function of
ash2 during larval and pupal stages, we can propose that
ash2 acts as a long-term chromatin imprint of bs that is
stable throughout development.
Our results in adult clones and from analysis of genetic interactions
suggest that ash2 acts principally by maintaining B and D intervein
regions, as the C intervein remains unaltered in ash2 mutants. This
region is under the control of organising genes that respond to the Hh signal
(Tabata and Kornberg, 1994
;
Zecca et al., 1995
). One of
these genes is kn, which prevents vein differentiation in the C
intervein (Crozatier et al.,
2002
; Mohler et al.,
2000
) and is required for the expression of bs in this
domain (Vervoort et al.,
1999
). bs expression is regulated by two enhancer
elements: the boundary enhancer, which is dependent on hh and
controls bs expression in the C intervein region through kn;
and another enhancer dependent on Dpp activity, which controls bs
expression in B and D intervein domains
(Nussbaumer et al., 2000
).
Thus, the role of ash2 as a positive regulator of bs is
mainly restricted to regions beyond the kn domain where the Dpp
dependent bs enhancer is active.
It has been found that some combinations of dpp alleles and mosaic
clones of sal-C result in elimination of B and D intervein regions,
along with fusion of their flanking veins
(de Celis et al., 1996
).
Although the genetic interactions between ash2 and either bs
or net could be the result of a synergistic failure to activate genes
downstream of Dpp, our results indicate that this may not be the case because
salm is expressed in the central domain of the wing pouch of those
mutant combinations.
It has been recently shown that another trxG complex, the Brm complex, is
involved in regulating wing vein development
(Marenda et al., 2004
). The
authors found that components of that complex interact genetically with
net and bs at pupal stages to regulate the expression of
rho, and that the complex is specifically required in cells within
and bordering L5 to mediate proper signalling. There are some key differences
between the Brm complex and Ash2: (1) Ash2 maintains bs expression
from the third instar stage; (2) the Ash2 complex is mainly required for
interveins B and D; and (3) the enhancement or suppression phenotypes of the
genetic interactions with Egfr and intervein-promoting alleles are much
stronger for ash2 than for the Brm complex. Taken together, these
results suggest that ash2 plays a crucial role in intervein identity
and that each trxG complex acts in a specific spatiotemporal program to
maintain organ identity.
Ash2 complex maintains kni in an off state
The positioning of vein tissues depends on the sal-C patterning
dictated by the Dpp signalling pathway
(Sturtevant et al., 1997
;
Sturtevant and Bier, 1995
).
Low levels of sal-C in the anterior compartment are required for the
expression of kni-C, which triggers the differentiation of L2
(de Celis and Barrio, 2000
;
Lunde et al., 1998
). We have
shown that lack of ash2 activity results in downregulation of
salm and upregulation of kni. Thus, it is possible that
within the sal-C domain, the ectopic expression of kni is a
result of low levels of salm. However, when high levels of salm
or salr are maintained by ectopic activation, lack of ash2
nevertheless results in de-repression of kni. Moreover, kni
is also cell-autonomously de-repressed by loss-of-function of ash2 in
cells outside of the sal-C expression domain. Thus, the repression
state in the whole wing must be maintained by factors other than
sal-C. The kni/knirl L2-enhancer is subdivided into
activation binding sites for Brk, En and the Sd/Vg complex, and repression
binding sites for Sd/Vg, En, Salr and Brk
(Lunde et al., 2003
). We did
not observe changes either in ß-gal expression from the EX-lacZ
enhancer or in sd, vg, brk or en expression in clones
lacking ash2. Therefore the de-repression of kni in
ash2 mutant cells must be accounted for by a mechanism entirely
different from that of the signal-dependent induction of L2, perhaps through
another enhancer more global than that of L2.
The low levels of salm expression associated with
ash2I1 clones may also be explained by de-repression of
kni. In dorsal tracheal cells, kni/knrl activity represses
salm transcription, and this repression is essential for branch
formation. Similarly the establishment of the border between cells acquiring
dorsal branch and dorsal trunk identity entails a direct interaction of Knirps
with a salm cis-regulatory element
(Chen et al., 1998
). Also in
the wing, kni and knrl are likely to refine the L2 position
by positive auto-regulation of their own expression and by providing negative
feedback to repress salm expression
(Lunde et al., 1998
).
It is possible that the de-repression of kni, intervein inhibition
and appearance of extra vein tissues are linked events. The kni-C
complex organises the development of the L2 vein by activating rho
and inhibiting bs (Lunde et al.,
1998
; Montagne et al.,
1996
). Thus, kni-C participates in L2 morphogenesis by
functioning downstream of salm and upstream of vein-intervein genes.
The ectopic activation of kni by lack of ash2 could trigger
intervein repression and vein activation. Indeed, ectopic activation of
UAS-kni results in broad expression of rho and elimination
of Bs expression in pupal wings, leading to the production of solid vein
material (Lunde et al., 1998
).
However, in adult clones not all ash2 mutant cells develop vein
tissue. This raises the possibility that de-repressed kni may not be
fully functional, as ectopic kni is often localised to the cytoplasm
rather than the nucleus. Alternatively, ash2 could have independent
functions in the wing, maintenance of the repressed state of kni
alongside maintenance of the intervein condition, by acting on different
targets.
The ash2112411 mutation can partially rescue the loss
of L2 in kniri1 mutants. This is in contrast to our
observation that the L2 enhancer appears not to mediate the effect of
ash2. The kniri1 allele is a 252 bp
deletion in the enhancer of L2 (Lunde et
al., 2003
) that results in lack of kni expression in L2
(Lunde et al., 1998
). It has
been shown, however, that it is possible to rescue the vein-loss phenotype of
kniri1 by expressing a UAS-rho transgene
in L2 (Lunde et al., 2003
). In
addition, double mutant flies for kniri1 and
net partially rescue L2
(Diaz-Benjumea and Garcia-Bellido,
1990
). It is therefore likely that the antagonistic effect of
ash2 on rho could account for the partial rescue of L2 in
kniri1 ash2112411 wings, as rho
mRNA is expressed in the rescued L2.
Some PcG genes are known to be required for the maintenance of kni
expression domains in the embryo (McKeon
et al., 1994
; Pelegri and
Lehmann, 1994
; Saget et al.,
1998
). It is also likely that some trxG genes or other complexes
of trxG proteins, such as the Ash2 complex
(Papoulas et al., 1998
), may
interact with repressor sequences necessary to keep kni expression in
an off state beyond L2. Moreover, in a genome wide prediction screen it has
been shown that kni contains PRE/TREs
(Ringrose et al., 2003
). Thus,
we propose here that ash2 acts as regulator of kni
expression in the wing through an epigenetic mechanism of cellular memory
similar to the trx-G regulation of homeotic genes, albeit that it remains to
be seen whether kni is a direct or indirect target of
ash2.
Cellular memory and morphogen gradients
A well-studied mechanism through which to induce and preserve cell
identities in wing imaginal discs is the response to gradients of the
morphogen Dpp. This raises questions about the extent to which the response to
Dpp occurs through concentration-dependent mechanisms or cellular memory.
There is compelling evidence in favour of the existence of Dpp gradients that
organise the pattern and growth of the wing imaginal disc
(Podos and Ferguson, 1999
;
Strigini and Cohen, 1999
). Dpp
signalling causes a graded transcriptional regulation of brk by an
interaction between the Dpp transducers and a brk morphogen-regulated
silencer (Muller et al.,
2003
). Thus, brk appears to respond to direct
morphogenetic signalling rather than remembering the inputs of previous
developmental events. However, whereas activation of salm requires
continuous signalling through the Dpp pathway
(Lecuit et al., 1996
;
Nellen et al., 1996
), other
targets of Dpp, such as omb, remember exposure to the signal
(Lecuit et al., 1996
). We have
shown here that stable regulation of other genes involved in wing development,
such as kni repression, and net and bs activation,
would also respond to the cellular memory conferred by epigenetic marks of the
Ash2 complex. Thus, both mechanisms morphogen-dependant, which will be
required for growth and patterning, and epigenetic, which will keep specific
genes in an off or on state are likely to act
simultaneously to maintain cellular identities within the wing.
Because many developmental regulators are only expressed transiently during development, the function of epigenetic complexes is likely to be very dynamic. The developmental events required for the construction of the wing, as with many other morphogenetic events, cannot only rely on an on or off state of gene expression. Instead, morphogenesis is rather malleable and epigenetic marks could act as a means to facilitate, rather that fix, the preservation of developmental fates. It may well be that the epigenetic marks of the Ash2 complex allow changes in chromatin structure to assist the access of proteins that activate or repress gene expression. From an epigenetic point of view, the ultimate refinement of morphogenesis and maintenance of cellular memory will depend upon the interaction of these chromatin remodelling complexes with the factors that trigger or inhibit transcription.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adamson, A. L. and Shearn, A. (1996). Molecular
genetic analysis of Drosophila ash2, a member of the trithorax group
required for imaginal disc pattern formation. Genetics
144,621
-633.[Abstract]
Amoros, M., Corominas, M., Deak, P. and Serras, F.
(2002). The ash2 gene is involved in Drosophila wing
development. Int. J. Dev. Biol.
46,321
-324.[Medline]
Beltran, S., Blanco, E., Serras, F., Perez-Villamil, B., Guigo,
R., Artavanis-Tsakonas, S. and Corominas, M. (2003).
Transcriptional network controlled by the trithorax-group gene ash2 in
Drosophila melanogaster. Proc. Natl. Acad. Sci. USA
100,3293
-3298.
Biehs, B., Sturtevant, M. A. and Bier, E.
(1998). Boundaries in the Drosophila wing imaginal disc
organize vein-specific genetic programs. Development
125,4245
-4257.[Abstract]
Bier, E. (2000). Drawing lines in the
Drosophila wing: initiation of wing vein development.
Curr. Opin. Genet. Dev.
10,393
-398.[CrossRef][Medline]
Bier, E., Jan, L. Y. and Jan, Y. N. (1990).
rhomboid, a gene required for dorsoventral axis establishment and peripheral
nervous system development in Drosophila melanogaster. Genes
Dev. 4,190
-203.
Brentrup, D., Lerch, H., Jackle, H. and Noll, M.
(2000). Regulation of Drosophila wing vein patterning:
net encodes a bHLH protein repressing rhomboid and is repressed by
rhomboid-dependent Egfr signalling. Development
127,4729
-4741.[Abstract]
Campbell, G. and Tomlinson, A. (1999).
Transducing the Dpp morphogen gradient in the wing of Drosophila:
regulation of Dpp targets by brinker. Cell
96,553
-562.[CrossRef][Medline]
Chen, C. K., Kuhnlein, R. P., Eulenberg, K. G., Vincent, S.,
Affolter, M. and Schuh, R. (1998). The transcription factors
KNIRPS and KNIRPS RELATED control cell migration and branch morphogenesis
during Drosophila tracheal development.
Development 125,4959
-4968.[Abstract]
Clifford, R. J. and Schupbach, T. (1989).
Coordinately and differentially mutable activities of torpedo, the
Drosophila melanogaster homolog of the vertebrate EGF receptor gene.
Genetics 123,771
-787.
Collins, R. T. and Treisman, J. E. (2000).
Osa-containing Brahma chromatin remodeling complexes are required for the
repression of wingless target genes. Genes Dev.
14,3140
-3152.
Cook, O., Biehs, B. and Bier, E. (2004).
brinker and optomotor-blind act coordinately to initiate development of the L5
wing vein primordium in Drosophila. Development
131,2113
-2124.
Crozatier, M., Glise, B. and Vincent, A.
(2002). Connecting Hh, Dpp and EGF signalling in patterning of
the Drosophila wing; the pivotal role of collier/knot in the AP
organiser. Development
129,4261
-4269.
de Celis, J. F. and Barrio, R. (2000). Function
of the spalt/spalt-related gene complex in positioning the veins in the
Drosophila wing. Mech. Dev.
91, 31-41.[CrossRef][Medline]
de Celis, J. F., Barrio, R. and Kafatos, F. C.
(1996). A gene complex acting downstream of dpp in
Drosophila wing morphogenesis. Nature
381,421
-424.[CrossRef][Medline]
de Celis, J. F., Bray, S. and Garcia-Bellido, A.
(1997). Notch signalling regulates veinlet expression and
establishes boundaries between veins and interveins in the Drosophila
wing. Development 124,1919
-1928.[Abstract]
Deak, P., Omar, M. M., Saunders, R. D., Pal, M., Komonyi, O.,
Szidonya, J., Maroy, P., Zhang, Y., Ashburner, M., Benos, P. et al.
(1997). P-element insertion alleles of essential genes on the
third chromosome of Drosophila melanogaster: correlation of physical
and cytogenetic maps in chromosomal region 86E-87F.
Genetics 147,1697
-1722.[Abstract]
Diaz-Benjumea, F. J. and Garcia-Bellido, A.
(1990). Behaviour of cells mutant for an EGF receptor homologue
of Drosophila in genetic mosaics. Proc. R. Soc. Lond., B,
Biol. Sci. 242,36
-44.[Medline]
Diaz-Benjumea, F. J. and Hafen, E. (1994). The
sevenless signalling cassette mediates Drosophila EGF receptor
function during epidermal development. Development
120,569
-578.[Abstract]
Francis, N. J. and Kingston, R. E. (2001).
Mechanisms of transcriptional memory. Nat. Rev. Mol. Cell
Biol. 2,409
-421.[CrossRef][Medline]
Fristrom, D., Gotwals, P., Eaton, S., Kornberg, T. B.,
Sturtevant, M., Bier, E. and Fristrom, J. W. (1994).
Blistered: a gene required for vein/intervein formation in wings of
Drosophila. Development
120,2661
-2671.
Garcia-Bellido, A. and de Celis, J. F. (1992).
Developmental genetics of the venation pattern of Drosophila. Annu.
Rev. Genet. 26,277
-304.[CrossRef][Medline]
Jazwinska, A., Kirov, N., Wieschaus, E., Roth, S. and Rushlow,
C. (1999). The Drosophila gene brinker reveals a
novel mechanism of Dpp target gene regulation. Cell
96,563
-573.[CrossRef][Medline]
Karpen, G. H. and Spradling, A. C. (1992).
Analysis of subtelomeric heterochromatin in the Drosophila
minichromosome Dp1187 by single P element insertional mutagenesis.
Genetics 132,737
-753.[Abstract]
LaJeunesse, D. and Shearn, A. (1995).
Trans-regulation of thoracic homeotic selector genes of the Antennapedia and
bithorax complexes by the trithorax group genes: absent, small, and homeotic
discs 1 and 2. Mech. Dev.
53,123
-139.[CrossRef][Medline]
Lawrence, P. A. and Struhl, G. (1996).
Morphogens, compartments, and pattern: lessons from drosophila?
Cell 85,951
-961.[CrossRef][Medline]
Lecuit, T., Brook, W. J., Ng, M., Calleja, M., Sun, H. and
Cohen, S. M. (1996). Two distinct mechanisms for long-range
patterning by Decapentaplegic in the Drosophila wing.
Nature 381,387
-393.[CrossRef][Medline]
Lunde, K., Biehs, B., Nauber, U. and Bier, E.
(1998). The knirps and knirps-related genes organize development
of the second wing vein in Drosophila. Development
125,4145
-4154.[Abstract]
Lunde, K., Trimble, J. L., Guichard, A., Guss, K. A., Nauber, U.
and Bier, E. (2003). Activation of the knirps locus links
patterning to morphogenesis of the second wing vein in Drosophila.Development 130,235
-248.
Marenda, D. R., Zraly, C. B. and Dingwall, A. K.
(2004). The Drosophila Brahma (SWI/SNF) chromatin
remodeling complex exhibits cell-type specific activation and repression
functions. Dev. Biol.
267,279
-293.[CrossRef][Medline]
Matakatsu, H., Tadokoro, R., Gamo, S. and Hayashi, S.
(1999). Repression of the wing vein development in
Drosophila by the nuclear matrix protein plexus.
Development 126,5207
-5216.[Abstract]
Maurange, C. and Paro, R. (2002). A cellular
memory module conveys epigenetic inheritance of hedgehog expression during
Drosophila wing imaginal disc development. Genes
Dev. 16,2672
-2683.
McKeon, J., Slade, E., Sinclair, D. A., Cheng, N., Couling, M.
and Brock, H. W. (1994). Mutations in some Polycomb group
genes of Drosophila interfere with regulation of segmentation genes.
Mol. Gen. Genet. 244,474
-483.[CrossRef][Medline]
Mohler, J., Seecoomar, M., Agarwal, S., Bier, E. and Hsai,
J. (2000). Activation of knot (kn) specifies the 3-4
intervein region in the Drosophila wing.
Development 127,55
-63.[Abstract]
Montagne, J., Groppe, J., Guillemin, K., Krasnow, M. A.,
Gehring, W. J. and Affolter, M. (1996). The
Drosophila Serum Response Factor gene is required for the formation
of intervein tissue of the wing and is allelic to blistered.
Development 122,2589
-2597.[Abstract]
Muller, B., Hartmann, B., Pyrowolakis, G., Affolter, M. and
Basler, K. (2003). Conversion of an extracellular Dpp/BMP
morphogen gradient into an inverse transcriptional gradient.
Cell 113,221
-233.[CrossRef][Medline]
Nellen, D., Burke, R., Struhl, G. and Basler, K.
(1996). Direct and long-range action of a DPP morphogen gradient.
Cell 85,357
-368.[CrossRef][Medline]
Nussbaumer, U., Halder, G., Groppe, J., Affolter, M. and
Montagne, J. (2000). Expression of the blistered/DSRF gene is
controlled by different morphogens during Drosophila trachea and wing
development. Mech. Dev.
96, 27-36.[CrossRef][Medline]
Orlando, V. (2003). Polycomb, epigenomes, and
control of cell identity. Cell
112,599
-606.[CrossRef][Medline]
Papoulas, O., Beek, S. J., Moseley, S. L., McCallum, C. M.,
Sarte, M., Shearn, A. and Tamkun, J. W. (1998). The
Drosophila trithorax group proteins BRM, ASH1 and ASH2 are subunits
of distinct protein complexes. Development
125,3955
-3966.[Abstract]
Pelegri, F. and Lehmann, R. (1994). A role of
polycomb group genes in the regulation of gap gene expression in
Drosophila. Genetics
136,1341
-1353.[Abstract]
Podos, S. D. and Ferguson, E. L. (1999).
Morphogen gradients: new insights from DPP. Trends
Genet. 15,396
-402.[CrossRef][Medline]
Ringrose, L., Rehmsmeier, M., Dura, J. M. and Paro, R.
(2003). Genome-wide prediction of Polycomb/Trithorax response
elements in Drosophila melanogaster. Dev. Cell
5, 759-771.[CrossRef][Medline]
Roch, F., Baonza, A., Martin-Blanco, E. and Garcia-Bellido,
A. (1998). Genetic interactions and cell behaviour in
blistered mutants during proliferation and differentiation of the
Drosophila wing. Development
125,1823
-1832.[Abstract]
Saget, O., Forquignon, F., Santamaria, P. and Randsholt, N.
B. (1998). Needs and targets for the multi sex combs gene
product in Drosophila melanogaster. Genetics
149,1823
-1838.
Schnepp, B., Grumbling, G., Donaldson, T. and Simcox, A.
(1996). Vein is a novel component in the Drosophila
epidermal growth factor receptor pathway with similarity to the neuregulins.
Genes Dev. 10,2302
-2313.
Shearn, A. (1974). Complementation analysis of
late lethal mutants of Drosophila melanogaster.Genetics 77,115
-125.
Shearn, A. (1989). The ash-1, ash-2 and
trithorax genes of Drosophila melanogaster are functionally related.
Genetics 121,517
-525.
Shearn, A., Rice, T., Garen, A. and Gehring, W.
(1971). Imaginal disc abnormalities in lethal mutants of
Drosophila. Proc. Natl. Acad. Sci. USA
68,2594
-2598.
Shearn, A., Hersperger, E. and Hersperger, G.
(1987). Genetic studies of mutations at low loci of
Drosophila melanogaster which cause a wide variety of homeotic
transformations. Roux's Arch. Dev. Biol.
196,231
-242.[CrossRef]
Simon, J. (1995). Locking in stable states of
gene expression: transcriptional control during Drosophila
development. Curr. Opin. Cell Biol.
7, 376-385.[CrossRef][Medline]
Simon, J. A. and Tamkun, J. W. (2002).
Programming off and on states in chromatin: mechanisms of Polycomb and
trithorax group complexes. Curr. Opin. Genet. Dev.
12,210
-218.[CrossRef][Medline]
Strigini, M. and Cohen, S. M. (1999). Formation
of morphogen gradients in the Drosophila wing. Semin. Cell
Dev. Biol. 10,335
-344.[CrossRef][Medline]
Sturtevant, M. A. and Bier, E. (1995). Analysis
of the genetic hierarchy guiding wing vein development in Drosophila.Development 121,785
-801.[Abstract]
Sturtevant, M. A., Roark, M. and Bier, E.
(1993). The Drosophila rhomboid gene mediates the
localized formation of wing veins and interacts genetically with components of
the EGF-R signaling pathway. Genes Dev.
7, 961-973.
Sturtevant, M. A., Biehs, B., Marin, E. and Bier, E.
(1997). The spalt gene links the A/P compartment boundary to a
linear adult structure in the Drosophila wing.
Development 124,21
-32.[Abstract]
Tabata, T. and Kornberg, T. B. (1994). Hedgehog
is a signaling protein with a key role in patterning Drosophila
imaginal discs. Cell 76,89
-102.[CrossRef][Medline]
Vervoort, M., Crozatier, M., Valle, D. and Vincent, A.
(1999). The COE transcription factor Collier is a mediator of
short-range Hedgehog-induced patterning of the Drosophila wing.
Curr. Biol. 9,632
-639.[CrossRef][Medline]
Xu, T. and Rubin, G. M. (1993). Analysis of
genetic mosaics in developing and adult Drosophila tissues.
Development 117,1223
-1237.[Abstract]
Zecca, M., Basler, K. and Struhl, G. (1995).
Sequential organizing activities of engrailed, hedgehog and decapentaplegic in
the Drosophila wing. Development
121,2265
-2278.[Abstract]
This article has been cited by other articles:
![]() |
J. Secombe, L. Li, L. Carlos, and R. N. Eisenman The Trithorax group protein Lid is a trimethyl histone H3K4 demethylase required for dMyc-induced cell growth Genes & Dev., March 1, 2007; 21(5): 537 - 551. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||