First published online September 30, 2004
doi: 10.1242/10.1242/dev.01382
Development 131, 5053-5063 (2004)
Published by The Company of Biologists 2004
Citron Kinase is an essential effector of the Pbl-activated Rho signalling pathway in Drosophila melanogaster
Tetyana Shandala1,2,
Stephen L. Gregory1,2,
Hazel E. Dalton1,2,
Masha Smallhorn1,3 and
Robert Saint1,3,*
1 ARC Special Research Centre for the Molecular Genetics of Development,
Adelaide University, Adelaide, SA 5005, Australia
2 School of Molecular and Biomedical Science, Adelaide University, Adelaide, SA
5005, Australia
3 Molecular Genetics and Evolution, Research School of Biological Sciences,
Australian National University, Canberra, ACT 2601, Australia
*
Author for correspondence (e-mail:
robert.saint{at}anu.edu.au)
Accepted 2 August 2004
 |
SUMMARY
|
|---|
Pebble (Pbl)-activated RhoA signalling is essential for cytokinesis in
Drosophila melanogaster. Here we report that the Drosophila
citron gene encodes an essential effector kinase of Pbl-RhoA signalling
in vivo. Drosophila citron is expressed in proliferating tissues but
is downregulated in differentiating tissues. We find that Citron can bind RhoA
and that localisation of Citron to the contractile ring is dependent on the
cytokinesis-specific Pbl-RhoA signalling. Phenotypic analysis of mutants
showed that citron is required for cytokinesis in every tissue
examined, with mutant cells exhibiting multinucleate and hyperploid
phenotypes. Strong genetic interactions were observed between citron
and pbl alleles and constructs. Vertebrate studies implicate at least
two Rho effector kinases, Citron and Rok, in cytokinesis. By contrast, we
failed to find evidence for a role for the Drosophila ortholog of Rok
in cell division. We conclude that Citron plays an essential, non-redundant
role in the Rho signalling pathway during Drosophila cytokinesis.
Key words: Cytokinesis, Citron Kinase, Rho Kinase, Drosophila, Rho GTPase signalling, Pebble, Rho, GEF
 |
Introduction
|
|---|
Cytokinesis is the final step in the cell division cycle when two
prospective daughter cells are separated by ingression of the plasma membrane
between separating chromosomes. Although still poorly understood, the strict
spatial and temporal coordination of cytokinesis with the other events of
mitosis appears to be mediated by a number of proteins that form a complex
regulatory network (for a review, see
Guertin et al., 2002
). A major
component of this network is the Rho small GTPase, which serves as a switch in
a wide variety of signal transduction pathways that regulate cytoskeletal
dynamics in cellular processes such as cell migration, adhesion,
morphogenesis, axon guidance and cytokinesis
(Hall, 1998
). Guanine
nucleotide exchange factors (GEFs) catalyse the formation of the GTP-bound
active form of Rho GTPases, which can bind and activate downstream effectors
(Hart et al., 1998
). It has
been hypothesised that the activation of Rho GTPases by particular GEFs
specifies the downstream Rho effector proteins and, therefore, the pathway
that is activated (for reviews, see Miki
et al., 1993
; Schmidt and
Hall, 2002
; Takai et al.,
1998
). Drosophila pebble (pbl) and its mouse and
human homologues, named Ect2, encode GEFs that specifically activate
RhoA signalling during cytokinesis
(Prokopenko et al., 1999
;
Tatsumoto et al., 1999
).
Downstream effectors of Rho small GTPases in different cellular contexts are
starting to be defined. With respect to cytokinesis, the vertebrate Citron
Kinase (Citron) is postulated to be an in vivo target of RhoA during
cytokinesis. Citron was isolated in a yeast two-hybrid screen as a protein
capable of binding preferentially to GTP-bound RhoA
(Madaule et al., 1995
). It is
a member of a conserved family of serine/threonine kinases described in mouse,
rat, human and fly (Di Cunto et al.,
1998
; Eda et al.,
2001
; Kimura et al.,
2000
; Liu et al.,
2003
; Madaule et al.,
1995
; Madaule et al.,
2000
; Sarkisian et al.,
2002
) (Fig. 1).
Consistent with a role in activating myosin II during cytokinesis, Citron can
phosphorylate the myosin regulatory light chain (MRLC) in vitro
(Yamashiro et al., 2003
).
Citron and the GTP-bound form of Rho localise to the cleavage furrow and
midbody during cell division in mouse, rat and human cells
(Di Cunto et al., 1998
;
Eda et al., 2001
).
Furthermore, inhibition of Rho in HeLa cells by botulinum C3 exoenzyme
abolishes Citron transfer from the cytoplasm to the cleavage furrow
(Eda et al., 2001
;
Sarkisian et al., 2002
),
suggesting strongly that Rho and Citron interact during cytokinesis.
Overexpression of truncated Citron in cell culture blocks cytokinesis, though
this phenotype is not induced by full-length or kinase dead protein
(Madaule et al., 1998
).
Embryos homozygous for a mutation in the mouse Citron gene have
multinucleate testis and brain cells, indicating a role in cytokinesis
(Di Cunto et al., 2002
).
However, proliferation is not blocked in most tissues, suggesting that other
factors may compensate for the loss of Citron. One such candidate is another
Rho effector kinase, Rok. The overall domain structure of Rok resembles that
of Citron (Fig. 1). Rok has
recently been implicated in the control of cytokinesis
(Chevrier et al., 2002
;
Kosako et al., 2000
) as
inhibition of human Rok was found to delay completion of cytokinesis.
Consistent with a level of functional redundancy in their involvement in
cytokinesis, both Citron and Rok localise to the cleavage furrow during
cytokinesis (Madaule et al.,
2000
), they are both capable of binding to the same region of Rho
(Fujisawa et al., 1998
;
Yamashiro et al., 2003
) and
they both phosphorylate the regulatory subunit of myosin II in vitro
(Ueda et al., 2002
). The
vertebrate studies are consistent with Citron being a Rho effector during
cytokinesis, but the tissue-restricted mutant phenotypes observed in vivo
suggest that Citron is not an essential Rho effector for cytokinesis. With the
possibility that phenotypes are being masked by redundancy with Rok, it seemed
desirable to analyse the role of Citron in Drosophila, which often
shows less genetic redundancy than in vertebrates and is more readily amenable
to genetic analysis. Here we analyse, in vivo, the properties and functions of
the Drosophila homologue of Citron. We demonstrate that
citron is expressed specifically in proliferating tissues and is
downregulated in differentiating tissues. We find that citron plays a
non-redundant role in cytokinesis and, unlike rok, exhibits strong
genetic interactions with pbl, consistent with a role as a downstream
target of the Pebble (Pbl)-activated Rho intracellular signalling pathway
during cytokinesis.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 1. Evolutionary conservation of the Citron Kinase family of proteins. (A) The
family of Drosophila proteins containing the same conserved domains
as vertebrate Citron. Each line is a scale representation of the protein
sequence (scale bar represents 100 amino acids), with each conserved domain
marked as a different shape. S/T Kinase, protein kinase C-class
Serine/Threonine kinase domain; C1, protein kinase C-type diacylglycerol
binding domain; PH, Pleckstrin homology phospholipid binding domain; CNH,
Citron homology domain of unknown function; PBD, p21-like Cdc42 binding
domain. Numbers between the conserved domains indicate the percentage of amino
acid identity between the corresponding domains. Arrowed lines indicate the
regions known to be required for binding to Rho. (B) A C-terminal fragment of
Citron (Citron 4, amino acids 1439 to 1854) interacts specifically with
constitutively active RhoA-G14V. LexA-Citron fusion proteins 1 to 4,
represented by the lines below the domain structure of Citron in A, were
assayed for interaction with VP16-RhoA-G14V fusion protein by activation of a
lacZ reporter gene in a yeast two-hybrid assay. The strength of
interaction is indicated to the right of each Citron fragment, with ()
indicating no interaction and (+++) indicating a strong interaction.
|
|
 |
Materials and methods
|
|---|
Constructs used for the generation of transgenic flies
UAS-citronGFP was made by linker ligation and subcloning from the
citron EST clone RE26327 into pBD1010 (kindly provided by B. J.
Dickson). This construct expresses a fusion of GFP to the C terminus of
Citron, and includes all of the Citron open reading frame (ORF) except the
last amino acid, with an additional four amino acids (DRTK) between the Citron
ORF and GFP. Expression of this construct with the da-GAL4 driver
does not rescue the lethality of citron transheterozygotes. The
GenBank Accession Number for citron is AE003541, locus CG10522.
UAS-pblRNAi4A (hereafter UAS-pblRNAi)
was generated by PCR amplification of two fragments, 1184-2916 bp and
2182-2916 bp of the pbl EST SD01796, and cloning as an inverted
repeat with a 298 bp loop into pUAST via a pBluescriptKS+ intermediate.
Fly stocks
The two citron (cit) alleles used in this study,
KG01697 (a P{SUPor-P} insertion at position +2 of the 5'UTR)
and GS9053 (a UAS-carrying pGSV6 insertion at position +53 of the
5' UTR of CG10522, kindly provided by Toshiro Aigaki, Tokyo Metropolitan
University, Japan), are renamed cit1 and
cit2 respectively. Df(3)iro-2 is the smallest
available deficiency encompassing the citron locus. To confirm that
the insertions in these lines gave the phenotypes observed, they were removed
by crossing to
2-3 transposase and testing the white-eyed progeny for
lethality over Df(3)iro-2. Both alleles readily reverted with respect
to both the white marker and lethality over the deficiency. We found that
cit2 carried a second site lethal on 3R, which we removed
by recombination. Ubiquitous expression of citron from the UAS in
cit2 was driven by daughterless-Gal4
(Wodarz et al., 1995
). For
targeted expression of genes of interest, the yeast Gal4-UAS system was used
(Brand and Perrimon, 1993
).
UAS-citronGFP and UAS-pblRNAi constructs were
placed under the control of several Gal4-expressing constructs:
Kr-Gal4 (which expresses GAL4 in T2-A4), prd-GAL4 (drives
expression in each alternative segment of the embryo), en-GAL4
(directs expression in the posterior half of each embryonic segment and
posterior domain of the larval wing) and
GAL4l(3)31-1-31-1RA (hereafter
GAL431-1; a neural driver). Unless specified, fly stocks,
such as UAS-p35 and UAS-CD8GFP, were obtained from the Bloomington
Drosophila Stock Center (Indiana University, IN, USA).
Histology and cytology
Antibodies used were: rabbit anti-phosphorylated histone H3 (Upstate
Biotechnology, NY, USA), rabbit anti-ß-galactosidase (Rockland
Immunochemicals, PA, USA), mAbs 22C10 (anti-Futsch), 3A9 (anti-
Spectrin), ADL101 (anti-Lamin) (Developmental Studies Hybridoma Bank, IA,
USA), mAb anti-
-tubulin (Sigma-Aldrich, Israel), anti-IgG secondary
antibodies conjugated with AP, HRP, Cy3, Lissamine-Rhodamine (Jackson
ImmunoResearch Laboratories, PA, USA), or Alexa488, Zenon Tricolor labelling
kit #1 (for mouse antibodies) and rabbit anti-GFP and Phalloidin-Rhodamine
(Molecular probes, OR, USA). For tubulin staining, 3-6 hour embryos were fixed
for 2 minutes in 33% formaldehyde, 0.3 M PIPES pH 6.8, 1 mM EGTA, 1 mM
MgSO4 before devitellinising in 80% EtOH and staining according to
standard protocols. For karyotyping, third larval instar brains were
dissected, squashed and Giemsa stained according to the protocol of Pimpinelli
et al. (Pimpinelli et al.,
2000
). TUNEL assay (Roche Diagnostics, IN, USA) and Acridine
Orange staining was used to detect cell death
(Chen et al., 1996
;
Wolff and Ready, 1991
). For
dissociation, third larval instar brains were dissected in 1 x PBS and
incubated in 1 x PBS containing 2.5% trypsin and Hoechst 33258 (10
µg/ml) for 3 hours at room temperature with mild agitation. Dissociated
live cells were subsequently analysed by Phase-contrast imaging. In situ
hybridisation was performed according to Tautz and Pfeifle
(Tautz and Pfeifle, 1989
). For
detection of DIG-labelled riboprobes we used anti-DIG-AP Fab fragment
antibodies (Roche Diagnostics, IN, USA). Tissues were viewed with a Zeiss
Axiophot, for transmitted light, or for fluorescence, viewed with an Olympus
Provis AX70 epifluorescence microscope or a confocal microscope equipped with
a BioRad MRC1000 scanhead and a krypton/argon laser.
Yeast two-hybrid analysis of protein interactions
The yeast two-hybrid plasmid vectors pVP16 and pLexA-NLS (pNLX)
(Hollenberg et al., 1995
), and
the yeast strains L40 (MATa his3-200 trp1-901 leu2-3,112
ade2 LYS2::(lexAop) HIS3 URA3::(lexAop)8-lacZ GAL4 gal80) and
AMR70 (same genotype as L40 except MAT
), were kindly provided
by Dr S. Parkhurst (Fred Hutchinson Cancer Research Center, WA, USA).
N-terminal VP16-Rho fusion coding sequences were generated with the complete
RhoA coding sequence, a dominant negative RhoA-N19 and a constitutively active
RhoA-G14V (Prokopenko et al.,
2000
). Four pNLX-citron clones (Citron 1-4),
corresponding to amino acids 14 to 846, 160 to 942, 887 to 1599 and 1439 to
1854 respectively, were generated. L40 strains harbouring VP16-RhoA expressing
plasmids were mated with AMR70 strains containing lexA-Citron-expressing
plasmids. Interactions were tested on X-gal (blue) indicator plates
(Sambrook et al., 1989
).
RNA interference in S2 cells
Double stranded RNA to citron was made by amplifying the EST clone
RE26327 with the following primers: TAATACGACTCACTATAGGTACTGTTCGCCGTTCTGGA and
TAATACGACTCACTATAGGTACTACGTGGCCGCAATAG, then transcribing with T7 polymerase
(Megascript kit, Ambion) and annealing overnight. S2 cells were grown and RNA
interference (RNAi) performed according to Clemens et al.
(Clemens et al., 2000
), using 5
or 15 µg dsRNA.
Statistical and sequence analyses
Wing hair analysis was conducted by scoring the number of multihaired
versus single-haired cells in 14 identical frames for each genotype. A sample
of each genotype was tested for homogeneity using a
2
2x2 test. The significance of differences between two genotypes in
proportions of multihaired cells was evaluated using a
2
2x2 contingency test (Mather,
1951
). Conserved protein domains were identified by pFam
(Bateman et al., 2002
) and
SMART (Letunic et al., 2002
),
and alignments were carried out in Clone Manager (Scientific and Educational
Software) using FastScan. Sequences used were from the sptrembl database:
CG10522: Q9VTY8; Citron (Mus): O88938; Gek: Q9W1B0; MRCKß: O54875; Rok:
Q9VXE3.
 |
Results
|
|---|
Evolutionary conservation of Citron
The Drosophila genome encodes a set of Serine/Threonine kinases
related to Citron (Madaule et al.,
1998
) that show a similar domain structure: an N-terminal PKC-type
kinase domain, a coiled-coil region, a C1 (lipid binding) domain, PH
(pleckstrin homology) domain and finally a CNH (Citron homology) domain
(Fig. 1A)
(Madaule et al., 2000
).
CG10522 and Genghis khan (gek) are the only
Drosophila genes encoding this domain order. By sequence arrangement
and function, Gek is more closely related to the Cdc42 effector, MRCK
(Fig. 1A)
(Luo et al., 1997
). CG10522
has no PH domain, although the flanking sequences are conserved. The PH domain
is present in Gek and the vertebrate homologues, suggesting that the common
ancestor of these kinases had a PH domain that was lost in CG10522. The
related Rho effector kinase, Rok, lacks a CNH domain and has a different
domain order (Fig. 1A). The
domain organisation, size, and levels of sequence identity all point to
CG10522 encoding the fly homologue of Citron, so hereafter we refer to CG10522
as citron (cit). We tested whether Drosophila
Citron, like the mammalian Citron, binds active Rho. In a yeast
two-hybrid assay, we found that the C-terminal-most 416 amino acids
of Drosophila Citron interact specifically with constitutively active
RhoA (Fig. 1B and data not
shown). Surprisingly, this interaction region, which encompasses the CNH, is
distinct from the Rho interaction domain of mammalian Citron that lies
N-terminal to the CNH and C1 domains, within a coiled-coil region
(Fig. 1A) (Madaule et al., 1998
). Thus,
although the interaction between Citron and active RhoA is functionally
conserved, the interaction domain appears to be different.
Drosophila citron is expressed in proliferative tissues and downregulated in differentiating cells
Patterns of gene expression can provide clues to gene function. In situ
hybridisation showed that Drosophila citron transcripts occur in
nurse cells during oogenesis and ubiquitously in early blastoderm embryos
(Fig. 2A,B). This indicates the
presence of a significant maternal store of transcript. The maternal
transcripts persist only until germ band extension, as transcripts are not
seen after this stage in embryos lacking zygotic citron (compare
Fig. 2C and 2D). With the
progression of embryogenesis, citron transcripts are restricted to
cells in the central and peripheral nervous systems (CNS and PNS respectively,
Fig. 2E-H). citron
expression is gradually lost from the CNS and PNS, correlating with
differentiation within these tissues (Jan
and Jan, 1993
). In third instar larvae, citron
transcripts were uniformly distributed in all imaginal discs, with the
exception of the posterior, differentiating region of the eye disc (data not
shown). This pattern of expression, which is initially ubiquitous then
restricted to the nervous system (Foe et
al., 1993
) is very similar to that observed for known cell cycle
genes [e.g. three rows, D'Andrea et al.
(D'Andrea et al., 1993
)],
consistent with a role for citron in proliferation. The association
of citron expression with proliferating tissues contrasts with the
widespread expression of another Rho effector kinase rok, and of
RhoA, the putative upstream activator of Citron, consistent with Rok
and RhoA having roles beyond proliferation
(Hariharan et al., 1995
).

View larger version (122K):
[in this window]
[in a new window]
|
Fig. 2. citron is expressed maternally and in proliferating tissues during
Drosophila development. Whole-mount in situ hybridisation
with a Drosophila citron DIG-labelled RNA probe. (A) A stage 10A
oocyte showing citron transcripts in the nurse cells. (B) Uniform
distribution of citron transcripts in a blastoderm embryo. Maternally
provided citron mRNA has degraded by stage 9, compare wild-type (C)
and homozygous Df(3)iro-2 mutant (D) embryos. (E-H) Zygotic
tissue-specific expression of citron in the proliferating CNS (arrow)
and PNS (arrowhead) starts during germ-band retraction. Anterior is to the
left, dorsal to the top.
|
|
Citron localisation to the cleavage furrow requires activation of RhoA
To explore the intracellular localization of Citron, transgenic
UAS-citron-GFP flies were generated to produce Citron fused at the C
terminus to Green Fluorescent Protein (GFP). The Citron-GFP fusion protein
expressed in embryos and larval brains was scattered throughout the cytoplasm
during interphase (data not shown). In dividing cells, Citron-GFP was observed
to accumulate at the constricting membrane following anaphase and persisted in
the midbody between divided daughter cells upon completion of cytokinesis
(Fig. 3A-D, see Movie 1 in
supplementary material). The cleavage furrow is enriched in many proteins that
are required for the progression of cell division, including RhoA, MRLC and
myosin II (for a review, see Guertin et
al., 2002
). We confirmed that Citron-GFP localises to this
contractile ring by showing an overlap of the GFP signal with a stain for
RacGAP50C (data not shown), a known cytokinesis regulator that associates with
the contractile ring (Somers and Saint,
2003
), and by live imaging of contraction (see Movie 1 in
supplementary material). The striking similarity in intracellular localisation
of fly, mouse, rat and human homologues of Citron suggests that the function
of these proteins during mitosis is conserved (this study)
(Di Cunto et al., 1998
).
Localisation of mammalian Citron to the cleavage furrow during cytokinesis is
blocked by treatment with a Rho GTPase inhibitor
(Eda et al., 2001
). The
Rho-GEF, Pbl, targets RhoA during cytokinesis
(O'Keefe et al., 2001
;
Prokopenko et al., 1999
). By
examining Citron-GFP localisation in a pbl mutant embryo, we would
avoid the drastic disruption that could occur if Rho signalling was blocked
indiscriminately (Crawford et al.,
1998
). In the absence of Pbl, Citron-GFP fusion protein did not
accumulate at the cleavage furrow at telophase
(Fig. 3E-H). These data
indicate that Citron accumulates at the contractile ring in response to
activation of Rho by the Rho-GEF Pbl.

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 3. Subcellular localisation of Citron-GFP to the contractile ring during
cytokinesis depends on the normal activation of Rho signalling. (A-H)
Citron-GFP was expressed in the 3-6 hour embryonic epidermis using
paired-Gal4. DNA is stained with Hoechst 33258 (B,F),
Citron-GFP is stained with anti-GFP (C,G), and microtubules are stained with
anti- -tubulin antibodies (D,H). (A,E) Merged images with Citron-GFP
stained green, DNA stained blue and microtubules stained red. (A-D) A
wild-type embryo showing Citron-GFP in the contractile ring (arrow) as it
constricts around the central spindle microtubules. Citron-GFP is not
localised in the adjacent anaphase cell that is yet to constrict (arrowhead).
(E-G) An embryo mutant for the Rho activator pebble showing typical
tetranucleate and binucleate cells and bipolar and tripolar spindles of cells
failing cytokinesis. Citron-GFP shows no localisation to the contractile ring
in pebble mutant telophase cells. It is found diffusely through the
cytoplasm of telophase cells and not at the positions where contractile rings
would normally form (arrowheads). (I-J) Drosophila Schneider line 2
cultured cells stained for DNA (green) and actin (red). Incubation with
citron dsRNA (I) or dsRNA corresponding to the Rho activator
pebble (J) causes the formation of multinucleate cells.
|
|
Loss of citron function leads to multinucleate embryonic PNS cells
To test citron function, we initially inhibited Citron expression
in Drosophila Schneider line 2 (S2) cultured cells using RNAi. Many
citron dsRNA-treated cells (
30%, compared with <2% in
controls) became multinucleate (Fig.
3I, comparable to pbl dsRNA treatment in
Fig. 3J), indicating that
mitosis was not accompanied by cell division. This result is in line with the
identification of citron by cell culture-based RNAi screening with a
multinucleate phenotype (Kiger et al.,
2003
; Rogers et al.,
2003
). To assess whether Citron is required for cytokinesis in
vivo, we made use of the available citKG01697 and
citGS9053 alleles, which have P-element transposon
insertions in the 5'UTR of the Drosophila citron locus. We
subsequently refer to these alleles as cit1 and
cit2 respectively. To avoid the possibility of
homozygosing second site mutations, all analyses used transheterozygotes
between cit1, cit2 or Df(3)iro-2, a
small deficiency spanning the citron locus. All homozygous and
transheterozygous genotypes were lethal, showing that citron is
essential for Drosophila development. A considerable number of
citron transheterozygotes died during larval development, and the
remainder died before eclosion. Transheterozygotes between citron
alleles and the deficiency did not show an earlier lethal phase or stronger
phenotypes in our assays than citron mutant homozygotes or
transheterozygotes, indicating that cit1 and
cit2 are strong alleles if not genetically null. The
insertions were responsible for the lethality observed, as both alleles could
be reverted to viability by the expression of P transposase (see Materials and
methods). Furthermore, since the cit2 insertion carries a
UAS element, we were able to show that ubiquitous citron gene
expression rescued cit2/Df(3)iro-2 transheterozygotes to
viability, confirming that loss of the citron transcript is
responsible for the phenotypes we describe. Depletion of maternal deposition
of citron using the FLP/FRT ovoD1 system
(Chou and Perrimon, 1996
) led
to female sterility, indicating that Citron is required during oogenesis. To
characterize the citron mutants, we initially looked for disruption
to neural cell development. As previously shown
(Fig. 2), maternal
citron seems to be depleted by stage 10, the stage at which embryonic
sensory organ precursors commence a wave of cell divisions
(Campos-Ortega and Hartenstein,
1997
). We reasoned that loss of zygotic citron might have
some effect on these PNS cell divisions and on neural divisions in the larva.
In wild-type embryos the PNS is organised in distinct, highly stereotyped
clusters within each segment (Campos-Ortega
and Hartenstein, 1997
; Hummel
et al., 2000
). For instance, the dorsal external sensory (DES)
cluster forms a grape-like structure with cells closely linked to each other
(Fig. 4A). The lateral
chordotonal organ (CH) cluster typically contains five oval-shaped cells of
similar size extending parallel processes dorsally
(Fig. 4A'). Examination
of the PNS in cit1/Df(3)iro-2 and
cit2/Df(3)iro-2 transheterozygous embryos using the 22C10
monoclonal antibody (Zipursky et al.,
1984
) revealed a modest disruption to nervous system organization
(Fig. 4B,B') with some
disorganisation of clusters and defects in axonal projections, suggestive of a
role in neuronal morphology and axonogenesis. Similar phenotypes have
previously been shown for hypomorphic alleles of pbl, which encodes
an upstream activator of the Rho GTPase
(Salzberg et al., 1994
;
Salzberg et al., 1997
).
Importantly, there was a loss of neurons and concomitant appearance of
binucleate neurons in approximately 15% of citron mutant PNS cells
(Fig. 4C,C', arrows, E),
consistent with the failure of cytokinesis.

View larger version (75K):
[in this window]
[in a new window]
|
Fig. 4. Citron function during cytokinesis in the Drosophila embryonic PNS
depends on Rho activation. Flat preparations of the PNS from abdominal
segments of stage 16 embryos stained for the neuronal specific antibody 22C10
(A,A',B,B',D,D'). (C-C''') Embryonic PNS cells
stained with: 22C10 (C, blue in C'''), nuclear envelope marker
anti-Lamin (C', red in C''') and plasma membrane marker
anti- Spectrin (C'', green in C'''). Anterior is to the
left and dorsal up. (A,B,D) Dorsal external sensory (DES) cluster area.
(A',B',C-C''',D') Lateral chordotonal organ (CH)
cluster area. (A,A') w1118 (control) embryos showing
typical organization of the DES and CH cell clusters.
(B,B',C-C''') cit2/Df(3)iro-2
mutant embryos exhibit variable abnormalities, such as absence of cells and
multinucleate cells (arrows). The number of nuclei in these cells was
estimated by presence of Lamin-positive nuclear envelopes within
-Spectrin delineated cellular membrane. A general disorganisation of
both clusters and axonal misrouting was also observed. (D,D')
cit2/Df(3)iro-2 mutant embryos that are also
heterozygous for pbl3, showing an increase in the number
of multinucleate cells (arrow). (E) To quantitate the effect of loss of one
copy of the pbl gene on the cit phenotype, the number of
mono- and multinucleate PNS cells in a defined region was scored for each
genotype (cells were scored in 30 identical frames). Bars represent the
percentage of multinucleate cells in each genotype. Error bars represent one
standard deviation.
|
|
Citron mutant larval brains contain polyploid and multinucleate cells
The presence of maternal citron transcripts and the late embryonic
PNS phenotype suggested that maternally-derived Citron permits early
proliferation, but is lost later in embryogenesis. After embryogenesis there
is little proliferation in the nervous system until the CNS begins to divide
rapidly at the end of the second larval instar
(Truman et al., 1993
), by
which stage the zygotic mutant phenotype should be evident. citron
mutant larval brains contained massively enlarged nuclei
(Fig. 5A,B), DNA stains showing
large diffuse aggregates of apparently hyperploid cells. In addition,
dissociated mutant larval brain cells from any allelic combination were
binucleate at a far higher rate (26/103) than normal (1/100;
Fig. 5C). Chromosome
preparations from mutant brains (Fig.
5D-F) showed tetraploid metaphase figures
(Fig. 5D), confirming that
citron mutant brain cells can complete S phase and enter mitosis
following a previously failed mitosis or cytokinesis. We also observed
hyperploid cells undergoing anaphase (Fig.
5E), suggesting that a failure of chromosome disjunction was not
the primary defect. Furthermore, the frequency of diploid anaphases and
telophases was similar in all citron allelic combinations
(approximately 37% of mitotic cells) and did not significantly differ from
wild-type control (39%). Consistent with this, immunohistochemical analysis
showed that centrosomes separate normally in the polyploid cells, since we
observed an assembly of microtubule spindles apparently emanating from
multiple centrosomes (Fig.
5G-G'',H-H''). Some mutant brain cells were massively
hyperploid (Fig. 5F,H')
showing that in the absence of Citron, brain cells can undergo multiple
mitotic cycles without dividing. However, with increasing cell ploidy,
microtubules form abnormal spindles (Fig.
5G,H) and chromosomes fail to assemble at the metaphase equator
(Fig. 5G',H').
These defects are clearly the later consequences of an earlier cell division
failure, so we conclude that the primary citron larval brain
phenotype is a failure of cell division.
Imaginal disc cells mutant for citron exhibit cell division defects accompanied by high levels of apoptosis
Examination of citron mutant larvae revealed a variable but marked
reduction in the size of their imaginal discs
(Fig. 6A,B). In line with these
observations, we could only generate one or two cell somatic clones of
homozygous mutant cells in the wing (data not shown). Cell sizes were not
obviously different in the mutants, but wing and leg discs stained with
anti-phospho Histone H3 (anti-PH3) showed a mild reduction in the number of
mitotic cells relative to wild-type (down to 60% of wild-type for
cit1and 77% for cit2,
Fig. 6C,D and data not shown).
Since this level of perturbation might not be expected to produce such small
discs, we examined the possibility that a stronger cell division phenotype
could have been masked by the rapid clearance of mutant cells by apoptosis.
The TUNEL assay for apoptotic cells and staining with the cell death marker
Acridine Orange, revealed an increased level of apoptosis in mutant imaginal
discs (Fig. 6E-H). Confirmation
that apoptosis was clearing cells with a cytokinesis defect came from
expression of the apoptosis inhibitor, p35
(Dorstyn and Kumar, 1997
), in
citron mutant imaginal discs, which led to the accumulation of
multinucleate cells (see Fig. S1 in supplementary material).

View larger version (83K):
[in this window]
[in a new window]
|
Fig. 6. Loss of Drosophila citron gene function results in a dramatic
reduction in imaginal disc size. Imaginal discs from wild-type (A,C,E,G) and
cit2/Df(3)iro-2 mutant (B,D,F,H) third instar larvae
labelled with Hoechst 33258 to detect DNA (A,B) or with anti-PH3 to detect
cells in mitosis (C,D, shown at high magnification) or labelled using TUNEL to
detect cells undergoing apoptosis (E,F and high magnification in G,H).
Transheterozygous mutant imaginal discs exhibit a dramatic reduction in size
(e.g. leg discs shown in B, compare with wild type in A), contain fewer cells
progressing through mitosis (compare D with C) and many more cells undergoing
apoptosis (compare mutant wing disc in F and H with wild type in E and G).
Scale bars: 25 µm.
|
|
Genetic interactions confirm Citron as a positive factor in Rho signalling
As discussed above, Citron has been proposed to act downstream of Rho in
the regulation of cytokinesis. However, little in vivo evidence has been found
to support this proposition. To test whether Citron participates in Rho
signalling we examined genetic interactions between citron and a
known regulator of the Rho pathway, the Rho-GEF-encoding gene,
pebble. The first assay chosen was the ability to modify the moderate
citron embryonic PNS phenotype
(Fig.
4B,B',C-C''',E). We chose pbl mutants
rather than Rho mutants because Pbl appears to be a specific Rho activator for
cytokinesis (Prokopenko et al.,
1999
), whereas loss of Rho also affects many other processes
(Crawford et al., 1998
). We
found that removing one copy of pbl in cit mutants resulted
in a significant reduction in the overall number of cells in the PNS, while
most of the remaining cells (52%) appeared to be multinucleate
(Fig. 4D,D',E). Therefore, a mild reduction in Pbl-mediated Rho activation during cytokinesis
resulted in a significant enhancement of the cit mutant embryonic PNS
defects. A complementary approach was to monitor whether under- or
overexpression of citron could modify a loss-of-Pbl phenotype. Since
strong pbl phenotypes arise too early and are too drastic to be of
use, we generated an RNAi construct to inhibit Pbl synthesis later in
development. Expression of this pblRNAi construct in the
posterior half of the wing resulted in a decrease in the size of the
corresponding region (Fig. 7C
compared with Fig. 7A).
Analysis of the affected area revealed that more than 67% of cells produce
multiple hairs in contrast to the invariably single-haired cells in wild-type
(Fig. 7C',D'
compared with
7A',B'), a
phenotype observed when cytokinesis is blocked, for example by inhibition of
RacGAP50C (Somers and Saint,
2003
). As expected, co-staining of pupal wings with phalloidin and
the DNA stain Hoechst 33258 revealed that the
pblRNAi-expressing cells were abnormally large and
typically multinucleate (Fig.
7D), resembling the embryonic phenotype of pbl mutants
(Hime and Saint, 1992
). The
intermediate nature of the en-GAL4>UAS-pblRNAi wing
size and multiple hair phenotypes allowed detection of enhancement and
suppression by prospective interactors. Firstly, to test the specificity of
this assay system we examined the pblRNAi phenotype in a
RhoA/+ background. Significant diminution of the
pbl-depleted region of the wing
(Fig. 7E) showed that the
pblRNAi phenotype was enhanced by removal of one copy of
wild-type RhoA, as seen in other genetic assays for pbl
function (O'Keefe et al.,
2001
). We quantified the multiple hair phenotype in a defined wing
region posterior to vein L5 (Fig.
7A, framed area). A significant increase in the proportion of
multihaired cells from 67% to 84% upon loss of one copy of RhoA
(Fig. 7C',E',
Fig. 8E) showed that this assay
could detect reductions in the dose of cytokinesis effector genes. Removal of
one copy of wild-type citron also reduced the size of the posterior
half of the wing in en-GAL4>UAS-pblRNAi flies
(Fig. 8A,B) and enhanced the
multiple hair phenotype (up to 86%; Fig.
8E). Identical effects were observed in Df(3)iro-2
heterozygous mutants (Fig. 8E
and data not shown). The genetic interactions between loss of function
citron and pbl phenotypes support the role of Citron as a
Rho effector in cytokinesis. Ectopic expression of citron in various
Drosophila tissues generated no dramatic phenotype in wild-type or
pblRNAi backgrounds
(Fig. 8C,E) (T.S.,
unpublished), suggesting that the activity of Rho is rate limiting for Citron
function.

View larger version (79K):
[in this window]
[in a new window]
|
Fig. 7. Reduction of Pebble function in wings by RNA interference causes
cytokinetic failure. (A,C,E) Low magnification images of whole adult wings.
(A',C',E') Corresponding high magnification images of the
posterior region of the wing (framed in A) that was used to evaluate
phenotypes (see Fig. 8E).
(A,A') A wild-type wing showing normal size and shape of the wing (A)
and ordered arrangement of hairs (A'). (B,B') A high magnification
of a wild-type pupal wing stained with Phalloidin to detect F-actin (red) and
Hoechst 33258 for DNA (blue). Each individual wild-type cell has one nucleus
(B) and one prehair F-actin bundle (B'). (C,C') An
en-GAL4>UAS-pblRNAi wing showing diminution of
Engrailed-domain of the wing (C) and wing hair phenotype (C') resulting
from reduced pbl activity. Many
en-GAL4>UAS-pblRNAi adult wing cells have more that one
hair. (D,D') A high magnification view of an en-GAL4>
UAS-pblRNAi mutant pupal wing stained with Phalloidin for
F-actin (red) and Hoechst 33258 for DNA (blue). Mutant cells show more than
one nucleus (D) and prehair F-actin bundles (D'). (E,E') Loss of
one copy of RhoA72R further reduces the Engrailed-specific
region of the en-GAL4>UAS-pblRNAi wing (E) and
increases the number of multihaired cells (E'). The multiple haired cell
phenotype is quantified in Fig.
8E.
|
|

View larger version (82K):
[in this window]
[in a new window]
|
Fig. 8. Citron acts as a positive factor in the Pebble-Rho signalling pathway.
Images of whole adult wings. (A) An en-GAL4>UAS-pblRNAi
wing in a wild-type background. (B) An
en-GAL4>UAS-pblRNAi wing heterozygous for
cit1 shows significant enhancement of the
pblRNAi phenotype. (C) An
en-GAL4>UAS-pblRNAi wing heterozygous for
rok2 does not appear be significantly modified. (D)
Co-expression of a gain-of-function allele of citron
(UAS-cit2) and en-GAL4>UAS-pblRNAi
slightly rescues the pblRNAi phenotype. (E) The number of
multiple haired wing cells in a defined region (posterior to L5, framed in
Fig. 7A) was scored for each
genotype shown in Fig. 7 and
Fig. 8 in order to quantitate the effect. Multiple haired cells were scored in
14 adult wings for each genotype. Bars represent the percentage of multihaired
cells in each genotype. Error bars represent one standard deviation.
Statistical significance of the difference between two pairs of genotypes was
determined using a 2 2x2 contingency test
(P<0.001). Significant enhancement of the
en-GAL4>UAS-pblRNAi phenotype was seen when flies were
heterozygous for RhoA72R, cit1 or
Df(3)iro-2 alleles.
|
|
Drosophila rok alleles do not interact genetically with the cytokinesis Rho pathway
It has been suggested that the human Rho effector kinase Rok plays some
role in cytokinesis since inhibition of Rok function by Y-27632 led to
significantly prolonged ingression of the cleavage furrow, although
cytokinesis was eventually completed
(Kosako et al., 2000
).
Drosophila Rok is not required for cytokinesis in wing cells, as
somatic mutant rok clones do not display any reduction of size
(Winter et al., 2001
). However
this test does not address the issues of delayed completion of cytokinesis or
redundancy between Rok and Citron. Drosophila rok is uniformly
expressed throughout development (Mizuno
et al., 1999
) and so is present in cells expressing
citron, making redundant function possible. If the cytokinetic
functions of Rok and Citron were redundant, we would expect that halving the
dose of one would enhance the cytokinetic mutant phenotype of the other. Since
rok mutants have no described cytokinetic phenotype we tested for
genetic interactions between rok2, a strong
loss-of-function allele (Winter et al.,
2001
), and Rho signalling in cytokinesis by introducing the
rok2 allele into our sensitised pbl RNAi wing
assay. In contrast to the enhancement observed by removing one copy of
citron (Fig. 8B,E),
removal of one copy of rok made no significant difference to the
pblRNAi mutant phenotype (67% and 65% respectively,
Fig. 8D,E). We therefore failed
to find evidence in support of a key role for Rok in Pbl-Rho signalling during
cytokinesis.
 |
Discussion
|
|---|
A conserved requirement for Citron in animal cytokinesis
We show here that the Drosophila melanogaster citron gene is
essential for normal cell division in all of the tissues we examined,
including the central and peripheral nervous systems, larval brain cells and
larval imaginal tissues. Consistent with a role specifically in cell division,
citron transcripts were detected in proliferating tissues, and
citron expression was downregulated in post-proliferative cells. This
contrasts with the ubiquitous expression of Rho and another Rho effector
kinase, Rok, both of which play roles in non-proliferating cells during
Drosophila development (Di Cunto
et al., 2000
; Hariharan et
al., 1995
; Mizuno et al.,
1999
). Our analysis of the Drosophila citron mutant
phenotype revealed a widespread function in proliferation. In S2 cultured
cells treated with citron dsRNA, binucleate cells were observed.
Furthermore, the PNS of transheterozygous citron mutant embryos
exhibited a loss of neurons and concomitant appearance of multinucleate
neurons, similar to the phenotype seen in hypomorphic pbl and other
cell cycle control mutants (Hartenstein
and Posakony, 1990
; Salzberg
et al., 1994
). citron mutant larval brain cells also
showed a significant number of binucleate cells. These binucleate cells
presumably occurred due to the failure of a single round of cell division.
Some of the brain cells had undergone multiple rounds of mitosis without cell
division, as evidenced by multiple microtubule spindles, an increase in the
number of chromosome complements and polyploid anaphase figures, indicating
assembly of an effective mitotic spindle. However, with further increases in
cell ploidy and centrosome numbers, the spindle did not form properly and
chromosomes were lost at metaphase, but the cells evidently continued to
cycle, eventually producing giant cells filled with chromosomes. This brain
phenotype is similar to spaghetti squash (myosin regulatory light
chain) and diaphanous mutant phenotypes
(Castrillon and Wasserman,
1994
; Karess et al.,
1991
), but is different to phenotypes of mutants such as
makós or aurora that arrest in metaphase
(Deák et al., 2003
;
Glover et al., 1995
). We
conclude, therefore, that Drosophila Citron has an important and
conserved function during cytokinesis. In contrast to larval brain cells and
embryonic PNS cells, polyploidy and binucleate cells were not observed in
larval imaginal tissues. Rather, the discs were dramatically reduced in size
and exhibited high levels of apoptosis. The analysis of other tissues shows
that citron is not generally required for cell survival and we found
that inhibition of apoptosis in citron mutant discs resulted in the
accumulation of multinucleate cells. Therefore, we reason that imaginal cells
differ from their brain counterparts by possessing a checkpoint control
mechanism that triggers apoptosis following the failure of cell division. The
key cytokinetic mutant diaphanous (dia) exhibits similar
hyperploid neuroblasts and loss of larval imaginal tissue
(Castrillon and Wasserman,
1994
).
Citron is a critical Rho effector in the regulation of cytokinesis in vivo
We have shown that Drosophila Citron, like its mammalian
counterparts, is localised to the cleavage furrow during cytokinesis. Many of
the important regulators of cytokinesis such as the RhoA GTPase and its
activators, and structural components such as myosin and actin, are
concentrated in this structure (for a review, see
Guertin et al., 2002
).
Importantly, Drosophila Citron localisation to the cleavage furrow
depends on proper activation of the RhoA cytokinesis signalling pathway. In
pbl mutant embryos lacking the Pbl Rho-GEF, which activates RhoA
during cytokinesis, accumulation of Citron-GFP into the contractile ring does
not occur. In vivo confirmation of the importance of Citron function in the
Rho cytokinesis signalling pathway came from strong genetic interactions
between cit and pbl mutants using two independent genetic
assays, one based on the appearance of multinucleate cells in the PNS and one
based on a developing wing phenotype. In both cases, loss of function of one
of the genes strongly enhanced the phenotype of the other. The citron
mutant cytokinesis phenotypes and the enhancement of cit and
pbl phenotypes by a reciprocal reduction in their gene activity
provides, for the first time, clear genetic evidence for the involvement of
Citron in the Rho cytokinesis signalling pathway. The interaction between
active Rho and Citron observed in yeast two-hybrid assays
(Madaule et al., 1995
) (this
study) and the loss of Citron localisation to the cleavage furrow in
pbl mutant embryos (this study) and in response to Rho inhibitors
(Eda et al., 2001
) demonstrate
that the role of Citron in this pathway is as a downstream effector of
Pbl-activated Rho.
Distinct roles in Drosophila for the two Rho effector kinases, Citron and Rok
The relationship between the two Rho effector kinases, Citron and Rok, is
the subject of ongoing discussion (see Li
and Minden, 2003
). We have demonstrated a non-redundant essential
role for Citron in cell division in all Drosophila tissues examined
in our study. Drosophila Rok plays an important role in planar cell
polarity (PCP) via regulatory phosphorylation of myosin light chain (MLC) and
subsequent activation of non-muscle myosin II
(Winter et al., 2001
). We
could not detect any PCP specific phenotype in citron mutants.
Moreover, overexpression or loss of one copy of citron had no effect
on a PCP-specific dishevelled1 mutant phenotype (S.L.G.,
unpublished) arguing against any involvement of Citron in the control of
planar polarity by Rho. Conversely, we could find no evidence for a role for
Rok in cell division in Drosophila. Evidence exists for such a role
for human Rok, with depletion of its activity in HeLa cells by chemical
inhibitors leading to a substantial delay in the completion of cytokinesis
(Kosako et al., 2000
).
However, other studies using the same cells and Rok inhibitor saw no effect or
early completion of cytokinesis (Chevrier
et al., 2002
; Madaule et al.,
1998
). Higher doses of Rok inhibitor could effectively prevent
cytokinesis, but these concentrations also inhibit Citron
(Ishizaki et al., 2000
). In
Drosophila, homozygous rok2 eye clones do not
differ in size from their homozygous wild-type twin spots
(Winter et al., 2001
). Our
analysis of genetic interactions also failed to produce any evidence of a role
for Rok in Rho cytokinesis signalling.
In summary, our genetic analyses have demonstrated an essential role for
Drosophila Citron in cell division and provided clear genetic
evidence for its function, in vivo, as an effector in Pbl-activated Rho
signalling during cytokinesis. Our analysis has also established a set of
genetic tools that will allow a detailed dissection of the roles of Citron
within the context of a developing organism.
Note added in proof
After acceptance of this manuscript, the citron gene described
here was reported as the gene sticky by D'Avino et al.
(D'Avino et al., 2004
).
 |
ACKNOWLEDGMENTS
|
|---|
This work was supported by the Australian Research Council. We are very
grateful to Dr Carolyn Leach for help with the statistical analysis of our
data and to Toshiro Aigaki for giving us access to his GeneSearch stocks and
database. We also thank Volkan Evci and Phoebe Vivian for technical support.
The monoclonal antibodies 9F8A9 anti-ELAV (developed by G. M. Rubin), 22C10
(developed by S. Benzer) were obtained from the Developmental Studies
Hybridoma Bank developed under the auspices of the NICHD and maintained by The
University of Iowa, Department of Biological Sciences, IA, USA
 |
Footnotes
|
|---|
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/131/20/5053/DC1
 |
REFERENCES
|
|---|
Bateman, A., Birney, E., Cerruti, L., Durbin, R., Etwiller, L.,
Eddy, S. R., Griffiths-Jones, S., Howe, K. L., Marshall, M. and Sonnhammer, E.
L. (2002). The Pfam protein families database.
Nucleic Acids Res. 30,276
-280.[Abstract/Free Full Text]
Brand, A. H. and Perrimon, N. (1993). Targeted
gene expression as a means of altering cell fates and generating dominant
phenotypes. Development
118,401
-415.[Abstract]
Campos-Ortega, J. A. and Hartenstein, V.
(1997). The Embryonic Development of Drosophila
melanogaster. Berlin: Springer.
Castrillon, D. H. and Wasserman, S. A. (1994).
Diaphanous is required for cytokinesis in Drosophila and shares
domains of similarity with the products of the limb deformity gene.
Development 120,3367
-3377.[Abstract]
Chen, P., Nordstrom, W., Gish, B. and Abrams, J. M.
(1996). grim, a novel cell death gene in
Drosophila. Genes Dev.
10,1773
-1782.[Abstract/Free Full Text]
Chevrier, V., Piel, M., Collomb, N., Saoudi, Y., Frank, R.,
Paintrand, M., Narumiya, S., Bornens, M. and Job, D. (2002).
The Rho-associated protein kinase p160ROCK is required for centrosome
positioning. J. Cell Biol.
157,807
-817.[Abstract/Free Full Text]
Chou, T. B. and Perrimon, N. (1996). The
autosomal FLP-DFS technique for generating germline mosaics in Drosophila
melanogaster. Genetics 144,1673
-1679.[Abstract]
Clemens, J. C., Worby, C. A., Simonson-Leff, N., Muda, M.,
Maehama, T., Hemmings, B. A. and Dixon, J. E. (2000). Use of
double-stranded RNA interference in Drosophila cell lines to dissect
signal transduction pathways. Proc. Natl. Acad. Sci.
USA 97,6499
-6503.[Abstract/Free Full Text]
Crawford, J. M., Harden, N., Leung, T., Lim, L. and Kiehart, D.
P. (1998). Cellularization in Drosophila
melanogaster is disrupted by the inhibition of Rho activity and the
activation of Cdc42 function. Dev. Biol.
204,151
-164.[CrossRef][Medline]
D'Andrea, R., Lehner, C., John, U., Stratmann, R. and Saint,
R. (1993). The three rows gene of Drosophila
melanogaster encodes a novel protein required for chromosome separation
during mitosis. Mol. Biol. Cell.
4,1161
-1174.[Abstract]
D'Avino, P. P., Savoian, M. S. and Glover, D. M.
(2004). Mutations in sticky lead to defective
organization of the contractile ring during cytokinesis and are enhanced by
Rho and suppressed by Rac. J. Cell Biol.
166, 61-71.[Abstract/Free Full Text]
Deák, P., Donaldson, M. M. and Glover, D. M.
(2003). Mutations in makos, a Drosophila gene
encoding the Cdc27 subunit of the anaphase promoting complex, enhance
centrosomal defects in polo and are suppressed by mutations in
twinstar, which encodes a regulatory subunit of PP2A. J.
Cell Sci. 116,4147
-4158.[Abstract/Free Full Text]
Di Cunto, F., Calautti, E., Hsiao, J., Ong, L., Topley, G.,
Turco, E. and Dotto, G. P. (1998). Citron Rho-interacting
kinase, a novel tissue-specific ser/thr kinase encompassing the
Rho-Rac-binding protein Citron. J. Biol. Chem.
273,29706
-29711.[Abstract/Free Full Text]
Di Cunto, F., Imarisio, S., Camera, P., Boitani, C., Altruda, F.
and Silengo, L. (2002). Essential role of citron kinase in
cytokinesis of spermatogenic precursors. J. Cell Sci.
115,4819
-4826.
Di Cunto, F., Imarisio, S., Hirsch, E., Broccoli, V., Bulfone,
A., Migheli, A., Atzori, C., Turco, E., Triolo, R., Dotto, G. P. et al.
(2000). Defective neurogenesis in citron kinase knockout mice by
altered cytokinesis and massive apoptosis. Neuron
28,115
-127.[CrossRef][Medline]
Dorstyn, L. and Kumar, S. (1997). Differential
inhibitory effects of CrmA, P35, IAP and three mammalian IAP homologues on
apoptosis in NIH3T3 cells following various death stimuli. Cell
Death Differ. 4,570
-579.[CrossRef][Medline]
Eda, M., Yonemura, S., Kato, T., Watanabe, N., Ishizaki, T.,
Madaule, P. and Narumiya, S. (2001). Rho-dependent transfer
of Citron-kinase to the cleavage furrow of dividing cells. J. Cell
Sci. 114,3273
-3284.
Foe, V. E., Odell, G. M. and Edgar, B. A.
(1993). Mitosis and Morphogenesis in the Drosophila
embryo: point and counterpoint. In The Development of
Drosophila melanogaster (ed. M. Bate and A. Martinez Arias), pp.149
-300. Cold Spring Harbour, NY: Cold Spring Harbor
Laboratory Press.
Fujisawa, K., Madaule, P., Ishizaki, T., Watanabe, G., Bito, H.,
Saito, Y., Hall, A. and Narumiya, S. (1998). Different
regions of Rho determine Rho-selective binding of different classes of Rho
target molecules. J. Biol. Chem.
273,18943
-18949.[Abstract/Free Full Text]
Glover, D. M., Leibowitz, M. H., McLean, D. A. and Parry, H.
(1995). Mutations in aurora prevent centrosome separation leading
to the formation of monopolar spindles. Cell
81, 95-105.[CrossRef][Medline]
Guertin, D. A., Trautmann, S. and McCollum, D.
(2002). Cytokinesis in eukaryotes. Microbiol. Mol.
Biol. Rev. 66,155
-178.[Abstract/Free Full Text]
Hall, A. (1998). Rho GTPases and the actin
cytoskeleton. Science
279,509
-514.[Abstract/Free Full Text]
Hariharan, I. K., Hu, K.-Q., Asha, H., Quintanilla, A., Ezzell,
R. M. and Settleman, J. (1995). Characterisation of rho
GTPase family homologues in Drosophila melanogaster: overexpressing
Rho1 in retinal cells causes a late developmental defect. EMBO
J. 14,292
-302.[Medline]
Hart, M. J., Jiang, X., Kozasa, T., Roscoe, W., Singer, W. D.,
Gilman, A. G., Sternweis, P. C. and Bollag, G. (1998). Direct
stimulation of the guanine nucleotide exchange activity of p115 RhoGEF by
Galpha13. Science 280,2112
-2114.[Abstract/Free Full Text]
Hartenstein, V. and Posakony, J. W. (1990).
Sensillum development in the absence of cell division: the sensillum phenotype
of the Drosophila mutant string. Dev. Biol.
138,147
-158.[CrossRef][Medline]
Hime, G. and Saint, R. (1992). Zygotic
expression of the pebble locus is required for cytokinesis during the
postblastoderm mitoses of Drosophila. Development
114,165
-171.[Abstract]
Hollenberg, S. M., Sternglanz, R., Cheng, P. F. and Weintraub,
H. (1995). Identification of a new family of tissue-specific
basic helix loop-helix proteins with a two-hybrid system. Mol. Cell
Biol. 15,3813
-3822.[Abstract]
Hummel, T., Krukkert, K., Roos, J., Davis, G. and Klambt, C.
(2000). Drosophila Futsch/22C10 is a MAP1B-like protein
required for dendritic and axonal development. Neuron
26,357
-370.[CrossRef][Medline]
Ishizaki, T., Uehata, M., Tamechika, I., Keel, J., Nonomura, K.,
Maekawa, M. and Narumiya, S. (2000). Pharmacological
properties of Y-27632, a specific inhibitor of Rho-associated kinases.
Mol. Pharmacol. 57,976
-983.[Abstract/Free Full Text]
Jan, Y. N. and Jan, L. Y. (1993). The
peripheral nervous system. In The Development of Drosophila
melanogaster (ed. M. Bate and A. Martinez Arias), pp.1207
-1244. Cold Spring Harbour, NY: Cold Spring
Harbor Laboratory Press.
Karess, R. E., Chang, X. J., Edwards, K. A., Kulkarni, S.,
Aguilera, I. and Kiehart, D. P. (1991). The regulatory light
chain of nonmuscle myosin is encoded by spaghetti-squash, a gene
required for cytokinesis in Drosophila. Cell
65,1177
-1189.[CrossRef][Medline]
Kiger, A., Baum, B., Jones, S., Jones, M., Coulson, A.,
Echeverri, C. and Perrimon, N. (2003). A functional genomic
analysis of cell morphology using RNA interference. J.
Biol. 2,27
.[CrossRef][Medline]
Kimura, K., Tsuji, T., Takada, Y., Miki, T. and Narumiya, S.
(2000). Accumulation of GTP-bound RhoA during cytokinesis and a
critical role of ECT2 in this accumulation. J. Biol.
Chem. 275,17233
-17236.[Abstract/Free Full Text]
Kosako, H., Yoshida, T., Matsumura, F., Ishizaki, T., Narumiya,
S. and Inagaki, M. (2000). Rho-kinase/ROCK is involved in
cytokinesis through the phosphorylation of myosin light chain and not
ezrin/radixin/moesin proteins at the cleavage furrow.
Oncogene 19,6059
-6064.[CrossRef][Medline]
Lee, T. and Luo, L. (1999). Mosaic
analysis with a repressible neurotechnique cell marker for studies of gene
function in neuronal morphogenesis. Neuron
22,451
-461.[CrossRef][Medline]
Letunic, I., Goodstadt, L., Dickens, N. J., Doerks, T., Schultz,
J., Mott, R., Ciccarelli, F., Copley, R. R., Ponting, C. P. and Bork, P.
(2002). Recent improvements to the SMART domain-based sequence
annotation resource. Nucleic Acids Res.
30,242
-244.[Abstract/Free Full Text]
Li, X. F. and Minden, A. (2003). Targeted
disruption of the gene for the PAK5 kinase in mice. Mol. Cell
Biol. 23,7134
-7142.[Abstract/Free Full Text]
Liu, H., Di Cunto, F., Imarisio, S. and Reid, L. M.
(2003). Citron kinase is a cell cycle-dependent, nuclear protein
required for G2/M transition of hepatocytes. J. Biol.
Chem. 278,2541
-2548.[Abstract/Free Full Text]
Luo, L., Lee, T., Tsai, L., Tang, G., Jan, L. Y. and Jan, Y.
N. (1997). Genghis Khan (Gek) as a putative effector for
Drosophila Cdc42 and regulator of actin polymerization.
Proc. Natl. Acad. Sci. USA
94,12963
-12968.[Abstract/Free Full Text]
Madaule, P., Eda, M., Watanabe, N., Fujisawa, K., Matsuoka, T.,
Bito, H., Ishizaki, T. and Narumiya, S. (1998). Role of
citron kinase as a target of the small GTPase Rho in cytokinesis.
Nature 394,491
-494.[CrossRef][Medline]
Madaule, P., Furuyashiki, T., Eda, M., Bito, H., Ishizaki, T.
and Narumiya, S. (2000). Citron, a Rho target that affects
contractility during cytokinesis. Microsc. Res. Tech.
49,123
-126.[CrossRef][Medline]
Madaule, P., Furuyashiki, T., Reid, T., Ishizaki, T., Watanabe,
G., Morii, N. and Narumiya, S. (1995). A novel partner for
the GTP-bound forms of Rho and Rac. FEBS Lett.
377,243
-248.[CrossRef][Medline]
Mather, K. (1951). Statistical
Analysis in Biology. London: Methuen.
Miki, T., Smith, C. L., Long, J. E., Eva, A. and Fleming, T.
P. (1993). Oncogene ect2 is related to regulators of
small GTP-binding proteins. Nature
362,462
-465.[CrossRef][Medline]
Mizuno, T., Amano, M., Kaibuchi, K. and Nishida, Y.
(1999). Identification and characterization of
Drosophila homolog of Rho-kinase. Gene
238,437
-444.[CrossRef][Medline]
O'Keefe, L., Somers, W. G., Harley, A. and Saint, R.
(2001). The Pebble GTP exchange factor and the control of
cytokinesis. Cell Struct. Funct.
26,619
-626.[CrossRef][Medline]
Pimpinelli, S., Bonaccorsi, S., Fanti, L. and Gatti, M.
(2000). Preparation and analysis of Drosophila mitotic
chromosomes. In Drosophila Protocols (ed. W. Sullivan,
M. Ashburner and R. S. Hawley), pp. 3-23. Cold Spring
Harbour, NY: Cold Spring Harbor Laboratory Press.
Prokopenko, S. N., Brumby, A., O'Keefe, L., Prior, L., He, Y.,
Saint, R. and Bellen, H. J. (1999). A putative exchange
factor for Rho1 GTPase is required for initiation of cytokinesis in
Drosophila. Genes Dev.
13,2301
-2314.[Abstract/Free Full Text]
Prokopenko, S. N., Saint, R. and Bellen, H. J.
(2000). Tissue distribution of pebble RNA and Pebble
protein during Drosophila embryonic development. Mech.
Dev. 90,269
-273.[CrossRef][Medline]
Rogers, S. L., Wiedemann, U., Stuurman, N. and Vale, R. D.
(2003). Molecular requirements for actin based lamella formation
in Drosophila S2 cells. J. Cell Biol.
162,1079
-1088.[Abstract/Free Full Text]
Salzberg, A., D'Evelyn, D., Schulze, K. L., Lee, J., Stumpf, D.,
Tsal, L. and Bellen, H. J. (1994). Mutations affecting the
pattern of the PNS in Drosophila reveal novel aspects of neuronal
development. Neuron 13,269
-287.[CrossRef][Medline]
Salzberg, A., Prokopenko, S. N., He, Y., Tsai, P., Pal, M.,
Maroy, P., Glover, D. M., Deak, P. and Bellen, H. J. (1997).
P-element insertion alleles of essential genes on the third chromosome of
Drosophila melanogaster: mutations affecting embryonic PNS
development. Genetics
147,1723
-1741.[Abstract]
Sambrook, J., Fritsch, E. F. and Maniatis, T.
(1989). Molecular Cloning: A Laboratory Manual.
2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory
Press.
Sarkisian, M. R., Li, W., Di Cunto, F., D'Mello, S. R. and
LoTurco, J. J. (2002). Citron-kinase, a protein essential to
cytokinesis in neuronal progenitors, is deleted in the flathead mutant rat.
J. Neurosci. 22,RC217
.[Abstract/Free Full Text]
Savoian, M. S. and Rieder, C. L. (2002).
Mitosis in primary cultures of Drosophila melanogaster larval
neuroblasts. J. Cell Sci.
115,3061
-3072.[Abstract/Free Full Text]
Schmidt, D. J. and Hall, A. (2002). Guanine
nucleotide exchange factors for Rho GTPases: turning on the switch.
Genes Dev.