|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online September 30, 2004
doi: 10.1242/10.1242/dev.01393
1 Department of Pediatrics, Yale University School of Medicine, 464 Congress
Avenue, New Haven, CT, 06519-1361, USA
2 Department of Comparative Medicine, Yale University School of Medicine, 464
Congress Avenue, New Haven, CT, 06519-1361, USA
3 Department of Pathology, Yale University School of Medicine, 464 Congress
Avenue, New Haven, CT, 06519-1361, USA
4 Yale Child Health Research Center, Yale University School of Medicine, 464
Congress Avenue, New Haven, CT, 06519-1361, USA
5 Department of Pediatrics, Bridgeport Hospital, Bridgeport, CT 06610, USA
6 Department of Pediatrics, Baylor College of Medicine, Houston, TX 77030,
USA
* Author for correspondence (e-mail: clifford.bogue{at}yale.edu)
Accepted 11 August 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Homeobox, Transcription factor, Cardiac morphogenesis, Repressor, Vasculogenesis, Endocardial cushion, Epithelial-mesenchymal transformation, Vegf
| Introduction |
|---|
|
|
|---|
Hhex is first expressed in cells that contribute to the murine
cardiovascular system at E7.0, when it is detected in the extraembryonic
mesoderm in a narrow band of cells within the nascent blood islands of the
visceral yolk sac (Ghosh et al.,
2000
; Thomas et al.,
1998
). The blood islands are the regions of the embryo where
primitive erythrocyte and blood vessel formation is initiated in a bipotential
cell called the hemangioblast (Choi et
al., 1998
). Expression of Hhex in these cells is
transient and is downregulated upon differentiation into endothelial cells. In
the embryo proper, at the neural plate stage, Hhex is expressed in
proximolateral mesoderm, a site where angioblasts are thought to arise
(Coffin et al., 1991
;
Coffin and Poole, 1991
) and a
domain that includes tissue fated to form heart
(Thomas et al., 1998
). During
headfold formation (E8.0), expression is seen in the ventral foregut endoderm
adjacent to the heart and in endocardial cells of the developing cardiac
tubes, but not in the intervening myocardial cell layer. Expression in the
endocardium persists through E10.5. Additionally Hhex is expressed in
regions where definitive vessels are known to form and in a pattern consistent
with coalescing endothelial progenitors, such as the dorsal aortae, or the
sprouting of new vessels (e.g. intersomitic vessels), suggesting that
Hhex may participate in the initial phases of both vasculogenesis and
angiogenesis. Hhex expression in the angioblasts of early blood
vessels is transient and downregulated as angioblasts differentiate into
endothelial cells. Interestingly, Hhex expression in the endocardium
persists longer than in endothelial cells of developing blood vessels,
prompting the speculation that Hhex plays additional roles in cardiac
development separate from its role in endothelial progenitors. This
endothelial expression pattern is conserved across species as shown from
studies in the frog (Newman et al.,
1997
), chick (Yatskievych et
al., 1999
) and zebrafish (Liao
et al., 2000
).
In addition to the expression data outlined above, there are functional
data to suggest that Hhex plays a role in vascular development.
Overexpression of Xhex in Xenopus results in an increased
number of ectopic prevascular cells and a disorganization of vascular
structure (Newman et al.,
1997
). Gain-of-function studies in which Hhex was
ectopically expressed in zebrafish led to premature or ectopic expression of
endothelial (and erythroid) genes, and Hhex could restore the
expression of endothelial and blood genes in cloche mutants, a
zebrafish mutation that affects early endothelial and blood cell
differentiation (Liao et al.,
2000
). Interestingly, endothelial gene expression was not altered
in Hhex loss-of-function mutants. Hhex and scl,
another transcription factor important for both endothelial and hematopoietic
development, can cross-regulate each other.
Gene targeting experiments have confirmed a critical role for Hhex
in many developmental processes. Mice homozygous for a disruption of the
Hhex gene die at mid-gestation (E13.5-E15.5) and have defects in
forebrain, thyroid, monocyte and liver development
(Keng et al., 2000
;
Martinez Barbera et al., 2000
)
(C. W. Bogue, unpublished). Recent data from our laboratory indicate that
disruption of the Hhex gene also leads to a profound block in B-cell
development (Bogue et al.,
2003
). In addition, investigators using in vitro
Hhex/ embryonic stem (ES) cell
differentiation, in vivo yolk sac hematopoietic progenitor assays, and
chimeric mouse analysis, found that Hhex is required for
differentiation of the hemangioblast to definitive embryonic hematopoietic
progenitors and, to a lesser extent, endothelial cells
(Guo et al., 2003
). Previous
reports of Hhex mutant mice do not include any mention of
cardiovascular abnormalities. In this report, we show that a null mutation of
Hhex leads to profound abnormalities in vasculogenesis and cardiac
morphogenesis. In addition, we show that a null mutation in Hhex
results in elevated cardiac vascular endothelial growth factor A (Vegfa)
levels that are responsible, in part, for the phenotype that we observe.
| Materials and methods |
|---|
|
|
|---|
PCR genotyping
Newborn mice and embryos were genotyped by multiplex polymerase chain
reaction (PCR) or Southern blot of DNA samples prepared from tails or yolk
sacs using primers specific for the wild-type and targeted alleles
(Hogan et al., 1994
). Primer
sequences are as follows: 5' wild-type primer
agacgcaccaccatcaattt; 5' targeted primer ccacacgcgtcaccttaata;
3' common primer ccctgtagcggtgagaagag (all primer sequences are
5'-3'). Samples were amplified for 30 cycles (94°C for 30
seconds, 58°C for 30 seconds, and 72°C for 1 minute). PCR
amplification of the Hhex wild-type allele gave a product 323 bp in
size, and amplification of the targeted allele produced a band of 409 bp in
size.
Morphological and histological analysis
Whole-mount embryos were photographed on a Nikon stereomicroscope. For
histology, embryos were fixed overnight at 4°C in 4% paraformaldehyde,
cryoprotected by incubation in 30% sucrose overnight, then frozen in
Tissue-Tek in liquid nitrogen and sectioned (10 µm). Sections were stained
with Hematoxylin and Eosin. For all analyses, at least 3-5 wildtype
(littermates of Hhex/ embryos) and
Hhex/ embryos were examined.
Immunohistochemistry
Immunohistochemistry of whole embryos and sections was performed using
standard procedures (Hogan et al.,
1994
; Urness et al.,
2000
). Primary antibodies were used as follows: anti-
SM
actin (
-SMA) (Sigma) at 1:500 dilution, anti-CD31 [platelet endothelial
cell adhesion molecule (PECAM)] (Pinter et
al., 1999
) at 1:500 dilution, anti-Vegf (A-20, sc-152 goat, Santa
Cruz) at 1:500 dilution, and anti-cytokeratin (Dako) at 1:500 dilution.
Cell proliferation assay and apoptosis (TUNEL) assays
10 µm frozen sections were prepared as described above. Adjacent
sections of each specimen were collected and used for assays of cell
proliferation and apoptosis. Cell proliferation was assessed by performing
immunohistochemistry with anti-phospho-histone H3 (Ser28) (Upstate
Biotechnology) and apoptosis was assessed using the TUNEL technique (ApopTag,
Molecular Probes). Serial sections through the entire AV cushion were examined
and the section with the most positive cells was used for quantitation. The
number of phosho-histone H3- or TUNEL-positive cells/AV cushion/section was
counted from three Hhex/ and three Hhex+/+
hearts. The data were analyzed statistically using the Student's
t-test and significance was set at P=0.05.
Vegfa ELISA assay
Whole hearts were isolated from E9.5-E13.5 Hhex+/+ and
Hhex/ embryos, sonicated in PBS and Vegfa
levels were assayed using the mouse Vegfa ELISA detection kit QuantikineM
(R&D Systems, Minneapolis, MN, USA). Results are expressed as (pg
Vegfa)/(µg protein), n=5 hearts for each age. Each value was
determined in duplicate. Means were compared using Student's
t-test.
Atrio-ventricular canal endocardial cushion explant culture
Atrio-ventricular (AV) explant cultures were performed as described
(Enciso et al., 2003
).
Briefly, the AV canal and ventricle (AV explant) from E10.5 mice with >28
somites were placed on rat tail type I collagen (Fisher, Collaborative
Biomedical) gels which were hydrated for a minimum of 1 hour with 100 µl of
Medium 199 supplemented with 1% FBS, 100 u/ml penicillin, 100 µg/ml
streptomycin, and 0.1% each of insulin, transferrin, and selenium (GIBCO BRL).
The AV explants were incubated at 37°C in 5% CO2, and allowed
to adhere for 6-8 hours; 100 µl of Medium 199 was then added to the AV
explants and changed once daily. After 72 hours, the cultures were stopped and
the explants were fixed with 4% paraformaldehyde, permeabilized with 0.5%
Triton X-100, 10 mM PIPES (pH 6.8), 50 mM NaCl, 300 mM sucrose and 3 mM
MgCl2, and blocked overnight at 4°C in 3% BSA and 0.05% Tween
20 in PBS. They were then incubated overnight with a 1:400 dilution of
anti-
-SMA and a 1:500 dilution of anti-CD31. Explants were washed ten
times with 0.2% BSA and 0.05% Tween 20 in PBS, then incubated with Alexa Fluor
488 goat anti-mouse IgG and Alexa Fluor 594 goat anti-rabbit IgG (Molecular
Probes), and then washes were repeated as above. Images were acquired using an
Olympus confocal microscope.
To assess the effect of blocking Vegfa signaling on epithelial-mesenchymal
transformation (EMT) in AV cushion explants, 25 µg/ml of the soluble murine
recombinant Vegf receptor 1/IgG-Fc chimeric protein sFlt-1 [mFlt-(1-3)-IgG, a
truncated Flt 1-3 Fc fusion protein (gift from Dr N. Ferrara, Genentech, San
Francisco, CA) (van Bruggen et al.,
1999
)] was added to the culture medium of both
Hhex+/+ and Hhex/ AV
explants. The explants were cultured as noted above for up to 72 hours and
then photographed. Immunohistochemistry using
-SMA and Pecam was
performed as described above and images were acquired using an Olympus
confocal microscope as described (Enciso
et al., 2003
).
For analysis of the effects of the addition of exogenous Vegf on EMT, AV cushion explants from wild-type mice with >28 somites were cultured in the presence or absence of either 10 pg/ml or 10 ng/ml recombinant mouse Vegf-A165 (CHEMICON International) for 72 hours (n=3 for each condition).
In order to quantify the extent of EMT in the explants, the ratio of the
number of mesenchymal versus epithelioid-like cells was determined in four
separate high-power fields/explant, as previously described
(Enciso et al., 2003
) and the
mean values were compared using the Student's t-test with
significance set at P<0.05.
| Results |
|---|
|
|
|---|
The cardiovascular abnormalities, which have not been previously reported, are apparent after E9.5 and consist of defects in heart septation, myocardium formation, and vasculogenesis. In many embryos, it appears that the defects in the cardiovascular system are the cause of death many embryos have significant edema of the body as well as expanded, fluid-filled pericardial sacs. At E13.5, Hhex/ embryos are edematous and contain markedly dilated blood vessels (Fig. 1). Compared to the Hhex+/+ and Hhex+/ mice, Hhex/ mice have marked hypoplasia of the right ventricle (RV), with a normally sized left ventricle (Fig. 1C,D). Transverse sections of Hhex/ embryos confirmed the presence of a hypoplastic RV (Fig. 1F). In addition, there were several defects present that are associated with abnormalities of endocardial cushion formation and remodeling. First, there was a dramatic overabundance of endocardial cushion cells (ECCs) and cardiac jelly in both the AV cushion (AVC) and the endocardial cushion that forms the RV outflow tract (Fig. 1F,I). In some embryos, the excessive accumulation of ECC resulted in severe narrowing of the RV outflow tract (Fig. 1I). Abnormalities of the remodeling of the outflow tract endocardial cushion were evidenced by the invariable presence of a double outlet right ventricle (DORV) (Fig. 1I,J). However, we never observed the presence of a persistent truncus arteriosus, indicating that septation of the aorta and pulmonary artery is not affected. The abnormally large AVCs failed to condense and thin normally, resulting in dysplastic mitral and tricuspid valves (Fig. 1L). In some severely affected embryos, there was no evidence of atrioventricular valve formation at all (data not shown). Ventricular septal defects were seen in all embryos, which is further evidence that the AVC is not developing normally (Fig. 1O). A high-power view of the AVC in Hhex/ embryos shows that the cells are mesenchymal in appearance, suggesting that they have undergone epithelial-mesenchymal transformation (EMT) (Fig. 1G).
|
|
-SMA and assessed the relative rates
of both proliferation and apoptosis. In the endocardial cushions, there was no
difference in the expression of either PECAM or
-SMA in the absence of
Hhex (data not shown). The phenotype of the cells in the
Hhex/ AVC does not appear to be different
from wild-type in that the cells are spindle-shaped and no longer express
PECAM (Fig. 1Q and data not
shown), indicating they have undergone EMT. Interestingly, neither the
Hhex+/+ nor Hhex/ ECCs
continue to express
-SMA at E12.5 (data not shown). Thus, the abnormal
accumulation of ECCs in Hhex/ embryos is not
due to an alteration in the temporal-spatial pattern of expression of either
PECAM or
-SMA.
When assessed by phospho-histone H3 expression, the relative rate of cell
proliferation in the Hhex/ AV cushion cells
at E13.5 was no different than in Hhex+/+ embryos
(Fig. 3C,D). In wild-type mice
at E13.5, apoptosis occurs in AVCs as a part of the normal process of
remodeling the AVC (Abdelwahid et al.,
2002
; Lakkis and Epstein,
1998
). Using the TUNEL assay, we detected a 75% decrease in the
number of apoptotic cells/cushion/section in
Hhex/ mice compared to wildtype
(Fig. 3A,B). Thus, the large
accumulation of ECC in Hhex/ mice is
accompanied by a marked decreased in the number of cells undergoing apoptosis
while proliferation is unaffected.
|
The next stage of vasculogenesis involves extensive interaction of
endothelial cells with themselves along with the recruitment and
differentiation of mesenchymal cells into vascular smooth muscle cells (VSMCs)
and pericytes (Conway et al.,
2001
; Risau,
1997
). At E9.5-E10.0, abnormalities of vascular development are
first apparent in Hhex/ mice and are
manifested as disorganization of the developing cranial vasculature (data not
shown). At this age, the abnormalities are subtle. By E11.5, abnormalities of
vasculogenesis are quite dramatic (Fig.
4). The vessels of Hhex/ mice
appear larger, are disorganized, and there is a profusion of small finely
branched vessels. This appears to be a generalized phenomenon and is not
limited to any specific region of the embryo. By E13.5, the abnormal vascular
phenotype is quite dramatic and is characterized by vascular structures with
markedly dilated lumens. Examples include massive enlargement of the internal
jugular vein (Fig. 5B),
intercostal vessels (Fig. 5D),
and vessels in the septum transversum mesenchyme, which normally form the
hepatic and portal vessels and sinusoids
(Fig. 5F). All of the enlarged
vessels were lined with a layer of endothelial cells as assessed by histology
and confirmed by staining with PECAM antibody (data not shown). This further
demonstrates that Hhex is not required for differentiation of
endothelial cells, as was previously demonstrated
(Martinez Barbera et al.,
2000
), but is necessary for vessel remodeling and
stabilization.
|
|
-SMA. At E9.5 and E10.5, there were subtle abnormalities in the
appearance of the vasculature characterized by decreased staining of the
vasculature, especially the cranial vasculature, in
Hhex/ compared to controls (data not shown).
However, by E11.5 there were striking differences in VSMC development in
Hhex/ embryos. In
Hhex+/+ embryos, VSMCs were present in the dorsal aorta,
in intersomitic vessels, in branchial vessels and extending rostrally into the
carotid vessels and smaller vessels of the head
(Fig. 6A,D,G). In contrast,
there was poor VSMC formation in Hhex/
embryos at E11.5 (Fig.
6B,C,E,F,H,I). All Hhex/ embryos
showed decreased or delayed VSMC formation in the cranial vasculature, dorsal
aorta, intersomitic and branchial vessels, although there was variability in
the severity of the VSMC defects. In some embryos,
-SMA staining was
present but decreased, and the pattern of expression was more irregular and
punctate than in wild-type embryos. The investiture of cranial vessels with
VSMC in some Hhex/ embryos was markedly
abnormal and correlated with the severity of the forebrain defects. In fact,
embryos with the most severe forebrain phenotype had complete absence of VSMCs
in the cranial vessels at E11.5 (Fig.
6F). The finding of variability in the severity of the forebrain
defect is consistent with a previous report of a null mutation of
Hhex (Martinez Barbera et al.,
2000
|
|
|
|
As further confirmation that elevated Vegf levels can increase EMT in AV explants from mice with >28 somites, we treated Hhex+/+ explants with two doses of recombinant Vegf 10 pg/ml and 10 ng/ml. At both doses, we observed a 16% increase in the ratio of mesenchymal:epithelioid cells in the treated explants compared to untreated explants (P<0.05 for both doses). While the magnitude of the effect on EMT of adding exogenous Vegf to wild-type AVexplants is much smaller than that seen in the Hhex/ AV explants, this finding does support the conclusion that elevated Vegfa levels play an important role in the pathogenesis of the endocardial cushion defects present in Hhex/ mice.
| Discussion |
|---|
|
|
|---|
Abnormal heart development in Hhex/ embryos highlights the importance of the endoderm and/or endocardium in cardiac morphogenesis
Since Hhex is not expressed in the myocardium at any stage of
cardiac development, the cardiac morphogenetic abnormalities seen in
Hhex/ mice are likely to be due to the
absence of Hhex in the endoderm (definitive endoderm at E7.0. or the
foregut endoderm at E8.0-8.5), the endocardium at E8.0-8.5, or both. It has
long been appreciated that interaction of the cardiac mesoderm with adjacent
endoderm is necessary for the normal development of the heart. Over the last
10 years, with the developmental of cardiac-specific molecular markers, much
more specific information has been obtained regarding the role of the endoderm
and the factors that mediate the interaction (reviewed by
Fishman and Chien, 1997
;
Lough and Sugi, 2000
;
Nascone and Mercola, 1996
).
Exactly what stage of heart development is endoderm dependent is debated.
However, an early inductive influence of endoderm is consistent with explant
studies in both the frog (Nascone and
Mercola, 1995
) and chick
(Schultheiss et al., 1995
)
which demonstrate the ability of anterior endoderm to induce cardiac-specific
gene expression in cells fated normally to form other tissues. A number of
molecules expressed and/or secreted by the endoderm that affect cardiac
myogenesis have recently been identified, including BMPs (signaling via SMAD
proteins) (Galvin et al.,
2000
; Ladd et al.,
1998
; Lough et al.,
1996
), FGFs (especially FGF-2, 4)
(Barron et al., 2000
;
Ladd et al., 1998
;
Lough et al., 1996
;
Zhu et al., 1999
;
Zhu et al., 1996
) and Wnt
proteins (Marvin et al.,
2001
). Most of these studies examined the role of endoderm or
endoderm-derived molecules on cardiac mesoderm specification or cardiac
myocyte development. Relatively little information is available on the role of
the endoderm on cardiac morphogenesis. However, a recent study using vitamin
A-deficient quail embryos suggests a role for anterior foregut endoderm in the
regulation of heart tube morphogenesis
(Ghatpande et al., 2000
).
These authors speculate that genes such as Gata4 and Hnf3b,
which are involved in foregut development may regulate other genes expressed
in the foregut that are necessary for normal cardiac development.
Interestingly, we have previously shown that Hhex is regulated, in
vitro, by both Gata4 and Hnf3b
(Denson et al., 2000b
).
In addition to affecting cardiac morphogenesis, the endoderm also appears
to play an important role in directing endocardial development
(Sugi and Markwald, 1996
)
(reviewed by Fishman and Chien,
1997
; Lough and Sugi,
2000
). One molecule that has been suggested as an endoderm-derived
signal affecting endocardial development is Vegfa
(Fishman and Chien, 1997
;
Lough and Sugi, 2000
). Vegfa
is highly expressed at E8.0-8.5 in the definitive gut endoderm in addition to
being expressed in both the myocardium and endocardium of the developing heart
(Miquerol et al., 1999
). By
E9.5, Vegfa expression in endocardial cells is restricted to the outflow tract
and atrioventricular canal cells that undergo EMT to form the
endocardial cushions and are subsequently involved in the formation of cardiac
cushions and valves. Thus deletion of Hhex expression in either the
foregut endoderm or the endocardium (in particular the endocardium that gives
rise to ECCs) could result in alterations of AV cushion development as well as
abnormalities in ventricular myocardial development by altering Vegfa
levels.
Excessive EMT in the endocardial cushions of Hhex/ mice is associated with elevated cardiac Vegfa levels in the heart and is ameliorated by blocking Vegfa signaling in vitro
There is a growing body of evidence that Vegfa signaling plays an important
role in cardiac morphogenesis in addition to its central role in vascular
development. It is also now clear that Vegfa expression in vivo must be
tightly regulated and perturbations of either Vegfa levels or the
temporal-spatial pattern of Vegfa expression have profound effects on cardiac
development. Haplo-insufficiency in mice carrying one functional
Vegfa allele results in early embryonic lethality from abnormal
cardiovascular development (Carmeliet et
al., 1996
; Ferrara et al.,
1996
) as does a mouse strain with a hypomorphic allele of
Vegfa (Damert et al.,
2002
). In addition, even modest increases in Vegfa levels during
early embryogenesis result in striking abnormalities of cardiac morphogenesis,
including abnormal ventricular trabeculation, VSD, enlarged coronary and
epicardial vessels, defective outflow tract remodeling and marked reduction in
the compact layers of both ventricles
(Miquerol et al., 2000
).
Exposure of developing embryos to hyperglycemia, which is associated with
endocardial cushion defects in humans, has recently been shown to inhibit EMT
in mouse embryos in culture, and this inhibition is mediated by a
hyperglycemia-induced decrease in Vegfa
(Enciso et al., 2003
).
Interestingly, there is a report in which premature induction of myocardial
Vegfa expression in E9.5 embryos inhibited endocardial cushion formation and
treatment of E9.5 AV explants with hVegf165 (100 ng/ml) inhibited
EMT in vitro (Dor et al.,
2001
). Here we show that treatment of E10.5 AV explants with doses
of Vegf in the 10 pg/ml-10ng/ml range results in a small but significant
increase in EMT in vitro, consistent with our findings in vivo in
Hhex/ mice. Thus, during heart development,
alterations in embryonic Vegfa levels appear to have pronounced effects on the
endocardial cushions, and those effects critically depend on the timing, level
and location of altered Vegfa expression. Our data indicate that cardiac Vegfa
levels are elevated in the absence of Hhex and that the excessive EMT
present is mediated by increased Vegfa signaling. Recently it has been shown
that Hhex interacts with GATA transcription factors in endothelial cells,
inhibiting signaling via the Vegf pathway by decreasing the expression of the
Vegf receptor Flk1/KDR. This results in the attenuation of Vegf-mediated tube
formation in primary endothelial cell cultures
(Minami et al., 2004
). Future
experiments will focus on whether the effect on EMT we are seeing is solely
due to elevated Vegfa levels or is also due to alterations in either the
response to Vegf signaling (i.e. altered response by Vegf receptors), or in
alterations in the levels of other Vegf isoforms.
Defective vasculogenesis in Hhex/ mice
The development of the vertebrate vascular system involves a highly ordered
series of molecular events that can be divided into two distinct processes:
vasculogenesis and angiogenesis (reviewed in
Carmeliet, 2000
;
Risau, 1997
). Vasculogenesis
is a process that involves the in situ differentiation of primitive precursor
cells called angioblasts into endothelial cells that then assemble into the
primitive primary capillary network. After this, the primitive capillary
network grows and remodels into a complex network of mature blood vessels by
the differential growth and sprouting of endothelial tubes and recruitment and
differentiation of mesenchymal cells into VSMCs and pericytes. Communication
between the endothelium and mesenchyme is critical for normal vasculogenesis
and it has been shown that endothelial cells induce the differentiation of
pericytes and VSMCs (Hellstrom et al.,
1999
; Hellstrom et al.,
2001
; Hirschi et al.,
1999
; Li et al.,
1999
). In fact, a recent study indicates that a common vascular
progenitor cell can differentiate into both endothelial and smooth muscle
progenitors when treated with Vegfa or Pdgf-BB, respectively
(Yamashita et al., 2000
).
It has been previously suggested by several groups that Hhex plays
an important role in vascular development. This is based on several findings.
First, Hhex mRNA and protein are transiently expressed in the
developing blood islands of the mouse at E7.5 (where both vascular and
hematopoietic precursors are found) (Ghosh
et al., 2000
; Thomas et al.,
1998
), and in the early vasculature of both mice and frogs
(Newman et al., 1997
;
Thomas et al., 1998
). In mice,
Hhex expression in the developing vasculature is seen only in
endothelial cells between E8.5 and E9.5 Second, in Xenopus, Xhex is
transiently expressed in endothelial cells during vasculogenesis and
overexpression of XHex sequences in the frog embryo causes disruption
to developing vascular structures and an increase in the number of vascular
endothelial cells (Newman et al.,
1997
). Third, in zebrafish, hhex was shown to act
downstream of cloche, to induce premature and ectopic expression of
endothelial and blood differentiation genes such as fli1, flk1 and
gata1 when ectopically expressed, and to interact with the gene
scl in a manner suggesting that hhex and scl can
cross-regulate each other (Liao et al.,
2000
). However, analysis of a hhex-deficiency allele
showed that hhex is not essential for early endothelial and blood
differentiation. Fourth, Sekiguchi et al., made the interesting observation
that Hhex is expressed in neointimal VSMCs of the rat aorta after balloon
injury and in cultured VSMCs, whereas there is no Hhex expression in
normal aorta or in mature endothelial cells, fibroblasts or cardiac myocytes
(Sekiguchi et al., 2001
). In
that study, the authors showed that Hhex transactivated the promoter of
SMemb/NHMC-B, a nonmuscle isoform of myosin heavy chain that has been shown to
be a molecular marker of dedifferentiated VSMCs. The authors speculated that
Hhex might play a role in the phenotypic modulation of VSMCs and in the
response of the vasculature to balloon injury. Finally, when Hhex was
overexpressed in endothelial cells in culture, the proliferation, migration,
invasion and ability to form a vascular networks was completely abolished
(Nakagawa et al., 2003
). In
addition, the overexpression of Hhex led to decreased expression of a
number of vasculogenesis-related genes, including Vegfr1, Vegfr2,
neuropilin1, tie1 and tie2. This report suggests that Hhex acts
as a negative regulator of vasculogenesis. However, in two separate
Hhex-null mutations, abnormalities of vascular development are not
reported (Keng et al., 2000
;
Martinez Barbera et al.,
2000
). Martinez Barbera reported that early vascular development
(i.e. vasculogenesis), as assessed by flk1 expression at E9.5, was
normal (Martinez Barbera et al.,
2000
) while Keng did not examine vascular development in their
targeted mutation of Hhex (Keng
et al., 2000
).
The findings presented here are the first to demonstrate that Hhex
is necessary for normal vascular development in vivo. Interestingly, Pecam
staining of our E9.5 Hhex/ embryos shows
that angioblasts coalesced into early vascular structures in a pattern similar
to wild-type embryos (data not shown). Thus, our findings are consistent with
those of Martinez-Barbera and show that vasculogenesis in
Hhex/ mice is not grossly disturbed.
However, we found that at E11.5 the vasculature is disorganized with a
profusion of small ectopic branches originating from dilated large vessels,
and by E13.5 many vessels have large lumens and in some regions of the embryo,
large sinusoidal structures form. The vascular defect in
Hhex/ embryos is also characterized by
delayed or absent VSMC development suggesting that, in the absence of
Hhex, there appears to be a defect in vasculogenesis. Additionally,
these data are consistent with recently reported data suggesting that
Hhex acts as a negative regulator of vasculogenesis and
vasculogenesis-related genes (Nakagawa et
al., 2003
), and microarray data that show a three-fold increase in
vegf RNA levels in Hhex/ embryoid
bodies (Guo et al., 2003
). It
is possible that the vascular phenotype we have observed is secondary to
cardiac failure or AV valve insufficiency and is not primarily due to the
absence of Hhex expression in the developing endothelium. However, we
think this is unlikely given the fact that other groups have reported that
both over-and under-expression of Hhex have effects on the expression
of vasculogenesis-related genes and on vasculogenesis in vitro
(Guo et al., 2003
;
Nakagawa et al., 2003
).
Of perhaps even greater interest, relative to Hhex function, is
the important role that the Vegf plays in vascular development.
Overexpression of Vegfa is also pathologic and the link between overexpression
of Vegfa and vascular malformations is well established. Exogenous
administration of Vegfa during vasculogenesis in quail embryos results in
severe perturbations of vascular patterning which includes abnormal vascular
fusion and formation of vessels with abnormally large lumens
(Drake and Little, 1995
;
Feucht et al., 1997
;
Flamme et al., 1995
), and
dysregulated expression of Vegfa in mice results in formation of abnormal
vascular trees and irregularly shaped sac-like vessels
(Benjamin and Keshet, 1997
;
Dor et al., 2002
;
Wong et al., 2001
). In
addition, recent evidence indicates that a common vascular precursor cell can
develop into endothelial progenitors and smooth muscle progenitors, and that
both Vegfa and Pdgf-BB affect to which lineage the cell will commit
(Yamashita et al., 2000
). In
these cells, treatment with Vegfa in vitro promotes endothelial cell
differentiation, resulting in decreased differentiation of the vascular
progenitor cells into smooth muscle progenitors. The abnormalities of
vasculogenesis in Hhex/ mice are quite
similar to the vascular abnormalities due to elevated Vegfa levels suggesting
that the vascular defects in Hhex/ mice may
be due to Vegfa overexpression.
Our data demonstrate that Hhex is essential for normal cardiac
morphogenesis and vascular development and that elevated levels of Vegfa are
responsible, at least in part, for the developmental abnormalities seen in
Hhex/ mice. Hhex is one of the few
genes identified that is not expressed in the myocardium yet, when mutated,
has profound effects on cardiac morphogenesis. It is clear that both the
foregut endoderm and the endocardium play important, yet relatively undefined,
roles in heart development. Since Hhex is expressed in both of these
sites during cardiac morphogenesis, studies of its function during development
will yield important new mechanistic information on the roles of these two
tissues in cardiac development. Additionally, our studies indicate that one
function of Hhex is to control Vegfa levels in vivo. To our
knowledge, this is the first example of a mutation in a homeobox transcription
factor that results in elevated Vegfa levels. Relatively few genes have been
identified as repressors of Vegfa and most are tumor-suppressor genes (e.g.
Smad4/DPC4, p53, p16 and the von Hippel-Lindau gene)
(Haase et al., 2001
;
Harada et al., 1999
;
Schwarte-Waldhoff et al.,
2000
; Zhang et al.,
2000
). However, it is not yet clear how the absence of
Hhex leads to elevated embryonic Vegfa levels. Interestingly, the
mouse Vegfa promoter harbors a potential consensus Hhex-binding
sequence that may allow Hhex to control Vegfa at the transcriptional
level. However, indirect mechanisms are also certainly conceivable. Further
studies of the interaction between Hhex and Vegfa will provide
valuable insight into the control of cardiovascular development and is likely
to have important implications for controlling therapeutic vasculogenesis as
well.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abdelwahid, E., Pelliniemi, L. J. and Jokinen, E.
(2002). Cell death and differentiation in the development of the
endocardial cushion of the embryonic heart. Microsc. Res.
Tech. 58,395
-403.[CrossRef][Medline]
Barron, M., Gao, M. and Lough, J. (2000).
Requirement for BMP and FGF signaling during cardiogenic induction in
non-precardiac mesoderm is specific, transient, and cooperative.
Dev. Dyn. 218,383
-393.[CrossRef][Medline]
Bedford, F. K., Ashworth, A., Enver, T. and Wiedemann, L. M.
(1993). HEX: a novel homeobox gene expressed during
haematopoiesis and conserved between mouse and human. Nucleic Acids
Res. 21,1245
-1249.
Benjamin, L. E. and Keshet, E. (1997).
Conditional switching of vascular endothelial growth factor (Vegf) expression
in tumors: induction of endothelial cell shedding and regression of
hemangioblastoma-like vessels by Vegf withdrawal. Proc. Natl. Acad.
Sci. USA 94,8761
-8766.
Bogue, C. W., Ganea, G. R., Sturm, E., Ianucci, R. and Jacobs,
H. C. (2000). Hex expression suggests a role in the
development and function of organs derived from foregut endoderm.
Dev. Dyn. 219,84
-89.[CrossRef][Medline]
Bogue, C. W., Zhang, P. X., McGrath, J., Jacobs, H. C. and
Fuleihan, R. L. (2003). Impaired B cell development
and function in mice with a targeted disruption of the homeobox gene Hex.
Proc. Natl. Acad. Sci. USA
100,556
-561.
Bort, R., Martinez-Barbera, J. P., Beddington, R. S. and Zaret,
K. S. (2004). Hex homeobox gene-dependent tissue positioning
is required for organogenesis of the ventral pancreas.
Development 131,797
-806.
Brickman, J. M., Jones, C. M., Clements, M., Smith, J. C. and
Beddington, R. S. (2000). Hex is a transcriptional
repressor that contributes to anterior identity and suppresses Spemann
organiser function. Development
127,2303
-2315.[Abstract]
Brown, C. B., Boyer, A. S., Runyan, R. B. and Barnett, J. V.
(1999). Requirement of type III TGF-ß receptor for
endocardial cell transformation in the heart. Science
283,2080
-2082.
Camenisch, T. D., Molin, D. G., Person, A., Runyan, R. B.,
Gittenberger-de Groot, A. C., McDonald, J. A. and Klewer, S. E.
(2002). Temporal and distinct TGFß ligand requirements
during mouse and avian endocardial cushion morphogenesis. Dev.
Biol. 248,170
-181.[CrossRef][Medline]
Camenisch, T. D., Spicer, A. P., Brehm-Gibson, T., Biesterfeldt,
J., Augustine, M. L., Calabro, A., Jr, Kubalak, S., Klewer, S. E. and
McDonald, J. A. (2000). Disruption of hyaluronan synthase-2
abrogates normal cardiac morphogenesis and hyaluronan-mediated transformation
of epithelium to mesenchyme. J. Clin. Invest.
106,349
-360.[Medline]
Carmeliet, P. (2000). Mechanisms of
angiogenesis and arteriogenesis. Nat. Med.
6, 389-395.[CrossRef][Medline]
Carmeliet, P., Ferreira, V., Breier, G., Pollefeyt, S.,
Kieckens, L., Gertsenstein, M., Fahrig, M., Vandenhoeck, A., Harpal,
K., Eberhardt, C. et al. (1996). Abnormal blood vessel
development and lethality in embryos lacking a single VEGF allele.
Nature 380,435
-439.[CrossRef][Medline]
Choi, K., Kennedy, M., Kazarov, A., Papadimitriou, J. C. and
Keller, G. (1998). A common precursor for hematopoietic and
endothelial cells. Development
125,725
-732.[Abstract]
Coffin, J. D., Harrison, J., Schwartz, S. and Heimark, R.
(1991). Angioblast differentiation and morphogenesis of the
vascular endothelium in the mouse embryo. Dev. Biol.
148, 51-62.[CrossRef][Medline]
Coffin, J. D. and Poole, T. J. (1991).
Endothelial cell origin and migration in embryonic heart and cranial blood
vessel development. Anat. Rec.
231,383
-395.[CrossRef][Medline]
Conway, E. M., Collen, D. and Carmeliet, P.
(2001). Molecular mechanisms of blood vessel growth.
Cardiovasc. Res. 49,507
-521.
Crompton, M. R., Bartlett, T. J., MacGregor, A. D., Manfioletti,
G., Buratti, E., Giancotti, V. and Goodwin, G. H.
(1992). Identification of a novel vertebrate homeobox gene
expressed in haematopoietic cells. Nucleic Acids Res.
20,5661
-5667.
Damert, A., Miquerol, L., Gertsenstein, M., Risau, W. and Nagy,
A. (2002). Insufficient VEGFA activity in yolk sac endoderm
compromises haematopoietic and endothelial differentiation.
Development 129,1881
-1892.
Denson, L. A., Karpen, S. J., Bogue, C. W. and Jacobs, H. C.
(2000a). Divergent homeobox gene hex regulates promoter of the
Na(+)-dependent bile acid cotransporter. Am. J. Physiol.
Gastrointest. Liver Physiol. 279,G347
-G355.
Denson, L. A., McClure, M. H., Bogue, C. W., Karpen, S. J. and
Jacobs, H. C. (2000b). HNF3beta and GATA-4
transactivate the liver-enriched homeobox gene, Hex.
Gene 246,311
-320.[CrossRef][Medline]
Dor, Y., Camenisch, T. D., Itin, A., Fishman, G. I., McDonald,
J. A., Carmeliet, P. and Keshet, E. (2001). A novel
role for VEGF in endocardial cushion formation and its potential contribution
to congenital heart defects. Development
128,1531
-1538.[Abstract]
Dor, Y., Djonov, V., Abramovitch, R., Itin, A., Fishman, G. I.,
Carmeliet, P., Goelman, G. and Keshet, E. (2002).
Conditional switching of VEGF provides new insights into adult
neovascularization and pro-angiogenic therapy. EMBO J.
21,1939
-1947.[CrossRef][Medline]
Drake, C. J. and Little, C. D. (1995).
Exogenous vascular endothelial growth factor induces malformed and hyperfused
vessels during embryonic neovascularization. Proc. Natl. Acad. Sci.
USA 92,7657
-7661.
Enciso, J. M., Gratzinger, D., Camenisch, T. D., Canosa, S.,
Pinter, E. and Madri, J. A. (2003). Elevated glucose
inhibits VEGF-A-mediated endocardial cushion formation: modulation by PECAM-1
and MMP-2. J. Cell. Biol.
160,605
-615.
Ferrara, N., Carver-Moore, K., Chen, H., Dowd, M., Lu, L.,
O'Shea, K. S., Powell-Braxton, L., Hillan, K. J. and Moore, M. W.
(1996). Heterozygous embryonic lethality induced by targeted
inactivation of the VEGF gene. Nature
380,439
-442.[CrossRef][Medline]
Ferrara, N., Chen, H., Davis-Smyth, T., Gerber, H. P., Nguyen,
T. N., Peers, D., Chisholm, V., Hillan, K. J. and Schwall, R. H.
(1998). Vascular endothelial growth factor is essential for
corpus luteum angiogenesis. Nat. Med.
4, 336-340.[CrossRef][Medline]
Feucht, M., Christ, B. and Wilting, J. (1997).
VEGF induces cardiovascular malformation and embryonic lethality.
Am. J. Pathol. 151,1407
-1416.[Abstract]
Fishman, M. C. and Chien, K. R. (1997).
Fashioning the vertebrate heart: earliest embryonic decisions.
Development 124,2099
-2117.[Abstract]
Flamme, I., von Reutern, M., Drexler, H. C., Syed-Ali, S. and
Risau, W. (1995). Overexpression of vascular endothelial
growth factor in the avian embryo induces hypervascularization and increased
vascular permeability without alterations of embryonic pattern formation.
Dev. Biol. 171,399
-414.[CrossRef][Medline]
Galvin, K. M., Donovan, M. J., Lynch, C. A., Meyer, R. I., Paul,
R. J., Lorenz, J. N., Fairchild-Huntress, V., Dixon, K. L., Dunmore, J.
H., Gimbrone, M. A., Jr et al. (2000). A role for smad6 in
development and homeostasis of the cardiovascular system. Nat.
Genet. 24,171
-174.[CrossRef][Medline]
Gerber, H. P., Hillan, K. J., Ryan, A. M., Kowalski, J., Keller,
G. A., Rangell, L., Wright, B. D., Radtke, F., Aguet, M. and Ferrara,
N. (1999). VEGF is required for growth and survival in
neonatal mice. Development
126,1149
-1159.[Abstract]
Ghatpande, S., Ghatpande, A., Zile, M. and Evans, T.
(2000). Anterior endoderm is sufficient to rescue foregut
apoptosis and heart tube morphogenesis in an embryo lacking retinoic acid.
Dev. Biol. 219,59
-70.[CrossRef][Medline]
Ghosh, B., Ganea, G. R., Denson, L. A., Iannucci, R., Jacobs, H.
C. and Bogue, C. W. (2000). Immunocytochemical
characterization of murine Hex, a homeobox-containing protein.
Pediatr. Res. 48,634
-638.[Medline]
Ghosh, B., Jacobs, H. C., Wiedemann, L. M., Brown, A., Bedford,
F. K., Nimmakayalu, M. A., Ward, D. C. and Bogue, C. W.
(1999). Genomic structure, cDNA mapping, and chromosomal
localization of the mouse homeobox gene, Hex. Mamm.
Genome 10,1023
-1025.[CrossRef][Medline]
Guiral, M., Bess, K., Goodwin, G. and Jayaraman, P. S.
(2000). PRH represses transcription in haematopoietic cells by at
least two independent mechanisms. J. Biol. Chem.
276,2961
-2970
Guo, Y., Chan, R., Ramsey, H., Li, W., Xie, X., Shelley, W. C.,
Martinez-Barbera, J. P., Bort, B., Zaret, K., Yoder, M. et al.
(2003). The homeoprotein Hex is required for hemangioblast
differentiation. Blood
102,2428
-2435.
Haase, V. H., Glickman, J. N., Socolovsky, M. and Jaenisch,
R. (2001). Vascular tumors in livers with targeted
inactivation of the von Hippel-Lindau tumor suppressor. Proc. Natl.
Acad. Sci. USA 98,1583
-1588.
Harada, H., Nakagawa, K., Iwata, S., Saito, M., Kumon, Y.,
Sakaki, S., Sato, K. and Hamada, K. (1999).
Restoration of wild-type p16 down-regulates vascular endothelial growth factor
expression and inhibits angiogenesis in human gliomas. Cancer
Res. 59,3783
-3789.
Hellstrom, M., Gerhardt, H., Kalen, M., Li, X., Eriksson, U.,
Wolburg, H. and Betsholtz, C. (2001). Lack of
pericytes leads to endothelial hyperplasia and abnormal vascular
morphogenesis. J. Cell Biol.
153,543
-553.
Hellstrom, M., Kalen, M., Lindahl, P., Abramsson, A. and
Betsholtz, C. (1999). Role of PDGF-B and PDGFR-beta in
recruitment of vascular smooth muscle cells and pericytes during embryonic
blood vessel formation in the mouse. Development
126,3047
-3055.[Abstract]
Hirschi, K. K., Rohovsky, S. A., Beck, L. H., Smith, S. R. and
D'Amore, P. A. (1999). Endothelial cells modulate the
proliferation of mural cell precursors via platelet-derived growth factor-BB
and heterotypic cell contact. Circ. Res.
84,298
-305.
Ho, C. Y., Houart, C., Wilson, S. W. and Stainier, D. Y.
(1999). A role for the extraembryonic yolk syncytial layer in
patterning the zebrafish embryo suggested by properties of the hex gene.
Curr. Biol. 9,1131
-1134.[CrossRef][Medline]
Hogan, B., Beddington, R., Constantini, F. and Lacy, E.
(1994). Manipulating the Mouse Embryo.
Plainview, NY: Cold Spring Harbor Laboratory Press.
Hromas, R., Radich, J. and Collins, S. (1993).
PCR cloning of an orphan homeobox gene (PRH) preferentially expressed in
myeloid and liver cells. Biochem. Biophys. Res.
Commun. 195,976
-983.[CrossRef][Medline]
Keng, V. W., Yagi, H., Ikawa, M., Nagano, T., Myint, Z., Yamada,
K., Tanaka, T., Sato, A., Muramatsu, I., Okabe, M. et al.
(2000). Homeobox gene hex is essential for onset of mouse
embryonic liver development and differentiation of the monocyte lineage.
Biochem Biophys Res Commun
276,1155
-1161.[CrossRef][Medline]
Ladd, A. N., Yatskievych, T. A. and Antin, P. B.
(1998). Regulation of avian cardiac myogenesis by activin/TGFbeta
and bone morphogenetic proteins. Dev. Biol.
204,407
-419.[CrossRef][Medline]
Lakkis, M. M. and Epstein, J. A. (1998).
Neurofibromin modulation of ras activity is required for normal
endocardial-mesenchymal transformation in the developing heart.
Development 125,4359
-4367.[Abstract]
Li, D. Y., Sorensen, L. K., Brooke, B. S., Urness, L. D., Davis,
E. C., Taylor, D. G., Boak, B. B. and Wendel, D. P.
(1999). Defective angiogenesis in mice lacking endoglin.
Science 284,1534
-1537.
Liao, W., Ho, C., Yan, Y. L., Postlethwait, J. and Stainier, D.
Y. (2000). Hhex and Scl function in parallel to regulate
early endothelial and blood differentiation in zebrafish.
Development 127,4303
-4313.[Abstract]
Lough, J., Barron, M., Brogley, M., Sugi, Y., Bolender, D. L.
and Zhu, X. (1996). Combined BMP-2 and FGF-4, but neither
factor alone, induces cardiogenesis in non-precardiac embryonic mesoderm.
Dev. Biol. 178,198
-202.[CrossRef][Medline]
Lough, J. and Sugi, Y. (2000). Endoderm and
heart development. Dev. Dyn.
217,327
-342.[CrossRef][Medline]
Martinez Barbera, J. P., Clements, M., Thomas, P., Rodriguez,
T., Meloy, D., Kioussis, D. and Beddington, R. S.
(2000). The homeobox gene Hex is required in definitive
endodermal tissues for normal forebrain, liver and thyroid formation.
Development 127,2433
-2445.[Abstract]
Marvin, M. J., Di Rocco, G., Gardiner, A., Bush, S. M. and
Lassar, A. B. (2001). Inhibition of Wnt activity induces
heart formation from posterior mesoderm. Genes Dev.
15,316
-327.
Minami, T., Murakami, T., Horiuchi, K., Miura, M., Noguchi,
T., Miyazaki, J., Hamakubo, T., Aird, W. C. and Kodama, T.
(2004). Interaction between hex and GATA transcription factors in
vascular endothelial cells inhibits flk-1/KDR-mediated vascular endothelial
growth factor signaling. J. Biol. Chem.
279,20626
-20635.
Miquerol, L., Gertsenstein, M., Harpal, K., Rossant, J. and
Nagy, A. (1999). Multiple developmental roles of VEGF
suggested by a LacZ-tagged allele. Dev. Biol.
212,307
-322.[CrossRef][Medline]
Miquerol, L., Langille, B. L. and Nagy, A.
(2000). Embryonic development is disrupted by modest increases in
vascular endothelial growth factor gene expression.
Development 127,3941
-3946.[Abstract]
Nakagawa, T., Abe, M., Yamazaki, T., Miyashita, H., Niwa, H.,
Kokubun, S. and Sato, Y. (2003). HEX acts as a
negative regulator of angiogenesis by modulating the expression of
angiogenesis-related gene in endothelial cells in vitro.
Arterioscler. Thromb. Vasc. Biol.
23,231
-237.
Nascone, N. and Mercola, M. (1995). An
inductive role for the endoderm in Xenopus cardiogenesis.
Development 121,515
-523.[Abstract]
Nascone, N. and Mercola, M. (1996). Endoderm
and Cardiogenesis: New Insights. Trends Cardiovasc.
Med. 6,211
-216.
Newman, C. S., Chia, F. and Krieg, P. A.
(1997). The XHex homeobox gene is expressed during development of
the vascular endothelium: overexpression leads to an increase in vascular
endothelial cell number. Mech. Dev.
66, 83-93.[CrossRef][Medline]
Pellizzari, L., D'Elia, A., Rustighi, A., Manfioletti, G., Tell,
G. and Damante, G. (2000). Expression and function of
the homeodomain-containing protein Hex in thyroid cells. Nucleic
Acids Res. 28,2503
-2511.
Pinter, E., Mahooti, S., Wang, Y., Imhof, B. A. and Madri, J.
A. (1999). Hyperglycemia-induced vasculopathy in the murine
vitelline vasculature: correlation with PECAM-1/CD31 tyrosine phosphorylation
state. Am. J. Pathol.
154,1367
-1379.
Risau, W. (1997). Mechanisms of angiogenesis.
Nature 386,671
-674.[CrossRef][Medline]
Runyan, R. B. and Markwald, R. R. (1983).
Invasion of mesenchyme into three-dimensional collagen gels: a regional and
temporal analysis of interaction in embryonic heart tissue. Dev.
Biol. 95,108
-114.[CrossRef][Medline]
Schultheiss, T. M., Xydas, S. and Lassar, A. B.
(1995). Induction of avian cardiac myogenesis by anterior
endoderm. Development
121,4203
-4214.[Abstract]
Schwarte-Waldhoff, I., Volpert, O. V., Bouck, N. P., Sipos, B.,
Hahn, S. A., Klein-Scory, S., Luttges, J., Kloppel, G., Graeven, U.,
Eilert-Micus, C. et al. (2000). Smad4/DPC4-mediated tumor
suppression through suppression of angiogenesis. Proc. Natl. Acad.
Sci. USA 97,9624
-9629.
Sekiguchi, K., Kurabayashi, M., Oyama, Y., Aihara, Y., Tanaka,
T., Sakamoto, H., Hoshino, Y., Kanda, T., Yokoyama, T., Shimomura, Y.
et al. (2001). Homeobox protein hex induces SMemb/Nonmuscle
myosin heavy chain-B gene expression through the cAMP-responsive element.
Circ. Res. 88,52
-58.
Sugi, Y. and Markwald, R. R. (1996). Formation
and early morphogenesis of endocardial endothelial precursor cells and the
role of endoderm. Dev. Biol.
175, 66-83.[CrossRef][Medline]
Tanaka, T., Inazu, T., Yamada, K., Myint, Z., Keng, V. W.,
Inoue, Y., Taniguchi, N. and Noguchi, T. (1999). cDNA
cloning and expression of rat homeobox gene, Hex, and functional
characterization of the protein. Biochem. J.
339,111
-117.
Thomas, P. Q., Brown, A. and Beddington, R. S.
(1998). Hex: a homeobox gene revealing peri-implantation
asymmetry in the mouse embryo and an early transient marker of endothelial
cell precursors. Development
125, 85-94.[Abstract]
Urness, L. D., Sorensen, L. K. and Li, D. Y.
(2000). Arteriovenous malformations in mice lacking activin
receptor-like kinase-1. Nat. Genet.
26,328
-331.[CrossRef][Medline]
van Bruggen, N., Thibodeaux, H., Palmer, J. T., Lee, W. P., Fu,
L., Cairns, B., Tumas, D., Gerlai, R., Williams, S. P., van Lookeren
Campagne, M. et al. (1999). VEGF antagonism reduces edema
formation and tissue damage after ischemia/reperfusion injury in the mouse
brain. J. Clin. Invest.
104,1613
-1620.[Medline]
Wong, A. K., Alfert, M., Castrillon, D. H., Shen, Q., Holash,
J., Yancopoulos, G. D. and Chin, L. (2001). Excessive
tumor-elaborated VEGF and its neutralization define a lethal paraneoplastic
syndrome. Proc. Natl. Acad. Sci. USA
98,7481
-7486.
Yamashita, J., Itoh, H., Hirashima, M., Ogawa, M., Nishikawa,
S., Yurugi, T., Naito, M. and Nakao, K. (2000).
Flk1-positive cells derived from embryonic stem cells serve as vascular
progenitors. Nature 408,92
-96.[CrossRef][Medline]
Yatskievych, T. A., Pascoe, S. and Antin, P. B.
(1999). Expression of the homeobox gene Hex during early
stages of chick embryo development. Mech. Dev.
80,107
-109.[CrossRef][Medline]
Zhang, L., Yu, D., Hu, M., Xiong, S., Lang, A., Ellis, L. M. and
Pollock, R. E. (2000). Wild-type p53 suppresses
angiogenesis in human leiomyosarcoma and synovial sarcoma by transcriptional
suppression of vascular endothelial growth factor expression.
Cancer Res. 60,3655
-3661.
Zhu, X., Sasse, J. and Lough, J. (1999).
Evidence that FGF receptor signaling is necessary for endoderm-regulated
development of precardiac mesoderm. Mech. Ageing Dev.
108, 77-85.[CrossRef][Medline]
Zhu, X., Sasse, J., McAllister, D. and Lough, J.
(1996). Evidence that fibroblast growth factors 1 and 4
participate in regulation of cardiogenesis. Dev. Dyn.
207,429
-438.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. D. Kumar, S.-K. Yong, S. T. Dheen, B.-H. Bay, and S. S.-W. Tay Cardiac Malformations Are Associated with Altered Expression of Vascular Endothelial Growth Factor and Endothelial Nitric Oxide Synthase Genes in Embryos of Diabetic Mice Experimental Biology and Medicine, November 1, 2008; 233(11): 1421 - 1432. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. He, R. J. Greenwell, D. M. Brooks, L. Calderon-Garciduenas, H. D. Beall, and J. D. Coffin Arsenic Exposure in Pregnant Mice Disrupts Placental Vasculogenesis and Causes Spontaneous Abortion Toxicol. Sci., September 1, 2007; 99(1): 244 - 253. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T Butcher and R. R Markwald Valvulogenesis: the moving target Phil Trans R Soc B, August 29, 2007; 362(1484): 1489 - 1503. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liu, M. Asakura, H. Inoue, T. Nakamura, M. Sano, Z. Niu, M. Chen, R. J. Schwartz, and M. D. Schneider Sox17 is essential for the specification of cardiac mesoderm in embryonic stem cells PNAS, March 6, 2007; 104(10): 3859 - 3864. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Paruchuri, J.-H. Yang, E. Aikawa, J. M. Melero-Martin, Z. A. Khan, S. Loukogeorgakis, F. J. Schoen, and J. Bischoff Human Pulmonary Valve Progenitor Cells Exhibit Endothelial/Mesenchymal Plasticity in Response to Vascular Endothelial Growth Factor-A and Transforming Growth Factor-{beta}2 Circ. Res., October 13, 2006; 99(8): 861 - 869. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, F. Cerrato, H. Xu, F. Vitelli, M. Morishima, J. Vincentz, Y. Furuta, L. Ma, J. F. Martin, A. Baldini, et al. Tbx1 expression in pharyngeal epithelia is necessary for pharyngeal arch artery development Development, December 1, 2005; 132(23): 5307 - 5315. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kubo, V. Chen, M. Kennedy, E. Zahradka, G. Q. Daley, and G. Keller The homeobox gene HEX regulates proliferation and differentiation of hemangioblasts and endothelial cells during ES cell differentiation Blood, June 15, 2005; 105(12): 4590 - 4597. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Foley and M. Mercola Heart induction by Wnt antagonists depends on the homeodomain transcription factor Hex Genes & Dev., February 1, 2005; 19(3): 387 - 396. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||