|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 29 September 2004
doi: 10.1242/dev.01419
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Division of Developmental Neurobiology, National Institute for Medical
Research, The Ridgeway, Mill Hill, London NW7 1AA, UK
2 Division of Biology, California Institute of Technology, Pasadena, CA 91125,
USA
Author for correspondence (e-mail:
dwilkin{at}nimr.mrc.ac.uk)
Accepted 24 August 2004
| SUMMARY |
|---|
|
|
|---|
Key words: BMP activity, Neural crest, Cell migration, Chick, Xenopus
| Introduction |
|---|
|
|
|---|
The control of bone morphogenetic protein (BMP) ligand action is an
excellent example of the modulation of cell-cell signalling. BMPs bind to and
activate serine/threonine kinase receptors, leading to phosphorylation of SMAD
transcription factors (Moustakas et al.,
2001
). They are important regulators of cell differentiation in
many tissues and play a key role during early embryogenesis as revealed by
studies in Xenopus showing that localised inhibition of BMP4 activity
is required for the formation of neural ectoderm and dorsal mesoderm
(De Robertis et al., 2000
).
This inhibition is mediated by multiple polypeptide antagonists secreted by
the Spemann organiser, including follistatin, noggin and chordin, that bind to
BMP4 and prevent its interaction with BMP receptor
(Balemans and Van Hul, 2002
).
Further aspects of the control of BMP activity have been revealed by detailed
studies of Xenopus chordin and its Drosophila homologue,
short gastrulation. Formation of a complex between chordin and BMP4
blocks interaction of ligand with BMP receptor; however, following cleavage of
chordin by the protease Xolloid, BMP4 is released and can bind to receptor
(Piccolo et al., 1997
).
Another protein, twisted gastrulation, has a dual role in enhancing
antagonism by stabilising chordin-BMP4 binding, and in promoting BMP4 activity
by destabilising the binding of chordin cleavage fragments to BMP4
(Chang et al., 2001
;
Larrain et al., 2001
;
Oelgeschlager et al., 2000
;
Ross et al., 2001
;
Scott et al., 2001
).
Following neural induction, BMP4 has a number of important functions in the
formation and differentiation of the neural crest. This migratory population
of cells contributes to many tissues in the vertebrate embryo, including
melanocytes, peripheral nervous system and the head skeleton. The neural crest
is induced at the interface between neural epithelium and surface ectoderm.
They subsequently leave the neuroepithelium by undergoing an
epithelial-mesenchymal transition and migrating away from the neural tube,
initially in the anterior and then in progressively more posterior parts of
the embryo (Kalcheim, 2000
;
Knecht and Bronner-Fraser,
2002
). BMP4 has been implicated in multiple steps of neural crest
development: as a component of the signalling that induces neural crest
(Knecht and Bronner-Fraser,
2002
), in control of the onset of neural crest migration
(Sela-Donenfeld and Kalcheim,
1999
), in apoptosis of cranial neural crest
(Graham et al., 1994
) and
later in the differentiation of neural crest to sympathetic neurons
(Anderson et al., 1997
).
Modulation of the level of BMP4 activity appears to be important for the onset
of trunk neural crest migration in the chick embryo. Following closure of the
chick neural tube, BMP4 expression occurs in premigratory neural crest at
similar levels along the anteroposterior (AP) axis, whereas the BMP4
antagonist noggin is expressed in a graded fashion high posterior and
low anterior. The onset of neural crest cell migration requires a threshold
level of BMP4 activity, such that the progressive decrease of noggin
expression underlies the anterior to posterior wave of migration
(Sela-Donenfeld and Kalcheim,
1999
).
Although many modulators of BMP activity have been identified, the function of only a subset has been established in the early vertebrate embryo. Furthermore, these factors appear to function by blocking BMP activity by interfering with binding to the receptor. Here, we identify a chick homologue of the Drosophila gene crossveinless 2 (cv-2) and analyse whether it modulates BMP activity. cv-2 encodes a protein with five cysteine-rich (CR) repeats found in BMP-binding proteins and is expressed in a number of sites of BMP4 action, including premigratory neural crest. In assays in Xenopus embryos, Cv-2 can inhibit BMP4 activity, consistent with previous work, suggesting that CR repeat proteins act as BMP antagonists. However, in other assays in Xenopus embryos, Cv-2 increases BMP4 activity. Furthermore, elevated Cv-2 expression leads to premature migration of trunk neural crest in the chick embryo, indicative of increased BMP activity. We discuss the implications of these findings for roles of Cv-2 in the modulation of BMP activity and neural crest cell migration.
| Materials and methods |
|---|
|
|
|---|
Whole-mount in situ hybridisation
Linearised cDNAs were used to synthesise digoxigenin labelled antisense RNA
probes and in situ hybridisations performed using `Protocol Four' as
previously described (Xu and Wilkinson,
1998
). In Xenopus blastomere injection experiments, Xbra
transcripts were detected by in situ hybridisation and NBT/BCIP substrate,
then alkaline phosphatase was acid-inactivated
(Jowett, 1998
) and fluorescein
dextran lineage tracer detected using alkaline phosphatase-conjugated
anti-fluorescein antibody and Fast Red substrate.
Generation of recombinant protein and immunoprecipitation analysis
The production of recombinant protein was carried out using the
Drosophila Expression System (DES; Invitrogen). Cv-2-and
chordin-coding regions were isolated by PCR and each inserted into the
pMT/BIP/V5-HisA expression vector. Expression constructs were (co-)transfected
into Schneider 2 insect cells (S2) using the calcium chloride technique
(Invitrogen). Cell lysis, immunoprecipitation and western blotting were
performed as described (Henkemeyer et al.,
1994
; Larrain et al.,
2000a
). Briefly, expressing cells were lysed with 2 ml PLC buffer,
and cell debris removed by centrifugation. Protein G-Sepharose beads,
pre-incubated with mouse anti-Myc antibody (Santa Cruz Biotechnology), were
added to the samples and incubated overnight at 4°C. The beads were
pelleted, washed, boiled in 20 µl loading buffer and then electrophoresed
through 10% SDS polyacrylamide gels under reducing conditions. The proteins
were electroblotted onto PDVF membranes and probed using the anti-V5 HRP
conjugated antibody (1:5000).
Xenopus embryo manipulation
Synthesis of capped mRNA from cDNAs in pCS2 vector for in vivo injection
was carried out as previously described
(Moon and Christian, 1989
). In
some experiments, RNA was co-injected with lysinated fluorescein dextran
lineage tracer. Embryos staged according to Nieuwkoop and Faber
(Nieuwkoop and Faber, 1967
)
were used either for animal cap explant experiments or fixed for in situ
hybridisation.
Animal cap explants were excised from stage 8-9 embryos that had been
injected with the appropriate RNA(s) and allowed to develop to the desired
stage. Total RNA was isolated using Trizol reagent (Gibco BRL) and was treated
with RQ1 DNase (Promega) to remove genomic DNA contaminants according to
supplier's specifications. cDNA was synthesised using MMLV RTase (Gibco BRL)
and random primers (Promega). The PCR reaction mix contained 100 µM of each
dNTP, 1xAmpliTaq buffer (Perkin Elmer), 1.5 mM MgCl2, 0.1
µg of each primer, 1 µC 32P dCTP and 1.25 units AmpliTaq DNA
Polymerase (Perkin Elmer). PCR conditions of 25 cycles: 93°C for 30
seconds; 55°C for 1 minute; 72°C for 30 seconds. The PCR products were
detected by electrophoresis on polyacrylamide gels followed by autoradiography
or using a phosphoimager for quantitative analysis. Primer sequences used are
as previously described (Domingos et al.,
2001
; Hemmati-Brivanlou et
al., 1994
; Ruiz i Altaba and
Melton, 1989
):
NCAM, CACAGTTCCACCAAATGC, GGAATCAAGCGGTACAGA; BF-1, CCTCAACAAGTGCTTCGTCA,
TAAAGGTGAGTCCGGTGGAG; muscle actin, GCTGACAGAATGCAGAAG, TTGCTTGGAGGAGTGTGT;
EF-1
, CAGATTGGTGCTGGATATGC and ACTGCCTTGATGACTCCTAG; Xbra,
CACCGAGAAGGAGCTGAAGGTTAG and TGCCACAAAGTCCAGCAGAACC.
Chick electroporations
Electroporation was carried out as previously described
(Itasaki et al., 1999
) using
Cv-2-coding region cloned into pCS2 vector, and pCIG to express GFP. Briefly,
after co-injection of pCS2Cv-2 and pCIG (3:1) into the neural tube lumen one
25 msecond square wave pulse of 25 mV was applied to the embryo using a pulse
generator, the embryo allowed to recover for 1 minute before being sealed with
parafilm, and re-incubated. The right side of the neural tube of stage
10/11 embryos was electroporated and embryos dissected out 15
hours later at stage 16. The embryos were fixed in 4% PFA for 1 hour at room
temperature and whole-mount in situ hybridisation carried out.
| Results |
|---|
|
|
|---|
|
|
Binding and modulation of BMP4 activity by Cv-2
To test whether Cv-2 protein can bind to BMP4, we used an expression system
in Drosophila S2 cells to express V5 epitope-tagged Cv-2 protein or,
as a positive control, V5-tagged chordin. S2 cell lysates were mixed with BMP4
protein, immunoprecipitated with anti-BMP4 antibody and a western blot probed
with anti-V5 antibody. We found that Cv-2 protein co-immunoprecipitated with
BMP4 protein (Fig. 3A).
|
To further investigate an antagonist activity, we microinjected Cv-2 RNA into the one-cell stage embryo followed by the detection of neural gene expression in isolated animal caps. Animal caps excised from stage 8 Xenopus embryos and cultured in isolation form non-neural ectoderm. Expression of BMP antagonists such as noggin in the animal caps leads to formation of neural ectoderm, as revealed by expression of the general neural marker NCAM and anterior neural marker BF-1. Induction of NCAM and BF-1 in animal caps does not occur following injection of increasing doses up to 4 ng of Cv-2 RNA, whereas injection of 0.1 ng of noggin RNA induces neural gene expression (Fig. 3F). However, co-injection of 2 ng Cv-2 RNA was found to increase the induction of neural marker expression following injection of 0.1 ng noggin RNA (Fig. 4G). Thus, in these assays Cv-2 does not antagonise BMP4 activity sufficiently for neural induction to occur, but can synergise with a strong BMP antagonist.
|
Based upon these results with expression in whole embryos, we then tested
whether Cv-2 modulates the ability of BMP4 to induce Xbra expression in
isolated animal caps (Ohkawara et al.,
2002
). Co-injection of 200 pg BMP4 RNA plus 200 pg Cv-2 was found
to induce a fourfold higher level of Xbra expression compared with injection
of 200 pg BMP4 RNA alone (Fig.
4F). Taken together, these results suggest that Cv-2 potentiates
the effects of BMP signalling under these assay conditions.
Modulation of BMP activity in chick neural crest
The results of ectopic expression assays in Xenopus embryos raises
the important issue of whether Cv-2 acts to inhibit or enhance BMP activity at
endogenous sites of expression. One such site is in the dorsal neural tube
from which neural crest cells migrate. In this location, threshold levels of
BMP signalling are required for neural crest cell emigration, as inhibition of
BMP4 activity delays migration, thus causing an anterior shift of the AP
location at which migration is initiated
(Sela-Donenfeld and Kalcheim,
1999
). We therefore tested whether the onset of trunk neural crest
migration could be altered by increasing the protein levels of Cv-2 via
electroporation of an expression construct. Using Sox10 and HNK1 as neural
crest markers, we found that increased expression of Cv-2 led to premature
migration of neural crest, at a location two to three somites more posterior
than on the control non-electroporated side of the neural tube (9/16 embryos;
Fig. 5C-E), whereas
electroporation of empty vector had no effect
(Fig. 5A,B). This finding
suggests that increased expression of Cv-2 increases the effective level of
BMP activity.
|
| Discussion |
|---|
|
|
|---|
Antagonism and promotion of BMP4 activity
The Xenopus embryo is an important assay system for the study of
BMP antagonists, in which inhibition of endogenous BMP activity leads to
ectopic axis formation in whole embryos, dorsalisation of mesoderm or neural
induction in animal caps. Such assays have revealed that a number of proteins
containing CR repeats such as chordin, procollagen IIA and kielin can bind to
and antagonise BMP4, suggesting a general role of CR domain proteins in
decreasing BMP activity in vivo (Garcia
Abreu et al., 2002
; Larrain et
al., 2000b
). Chordin is a strong antagonist that when ectopically
expressed dorsalises mesoderm and induces neural ectoderm
(Piccolo et al., 1996
),
consistent with its role as a component of the BMP antagonist activity of the
Spemann organiser. Procollagen IIA has also been proposed to act an antagonist
of BMP activity, as ventral expression induces a secondary axis and dorsalises
explanted mesoderm (Larrain et al.,
2000b
). Similarly, ectopic expression of kielin expands neural
ectoderm in the embryo and dorsalises mesoderm
(Matsui et al., 2000
).
However, kielin does not induce neural tissue in isolated animal caps, and it
was therefore proposed that the expansion of neural ectoderm in the intact
embryo could occur via the dorsalisation of mesoderm that in turn expresses
neural inducing signals (Matsui et al.,
2000
). These findings are potentially relevant to Cv-2, as kielin
protein has a related structure of CR repeats and a C-terminal VWD domain, and
because, similar to kielin, we find that overexpression of Cv-2 induces
ectopic neural tissue in the whole embryo, but not in animal caps. A
difference is that kielin does not induce a secondary axis, whereas Cv-2 can
do so. By analogy with the results of assays using individual CR domains
(Larrain et al., 2000b
), this
may reflect that secondary axis formation requires a greater inhibition of BMP
activity than does dorsalisation without secondary axis formation. A key
question is why does Cv-2 inhibit BMP activity in these assays, whereas in
other assays Cv-2 can increase BMP activity?
Our findings suggest that, when overexpressed, Cv-2 acts as a weak antagonist that cannot decrease BMP activity sufficiently to induce neural ectoderm in animal caps. The antagonistic effects of Cv-2 are detected in experiments in which overexpression of Cv-2 inhibits endogenous BMPs, whereas we find that Cv-2 can promote BMP activity when co-expressed with BMP4. Our findings are consistent with a model in which there is competition between binding of BMP4 to unoccupied Cv-2 (not already bound to BMP4) or to BMP receptor. When Cv-2 and BMP4 are present at similar levels, there is a low amount of unoccupied Cv-2, and thus BMP4 released from Cv-2 will frequently bind to BMP receptor. However, when Cv-2 is present in great excess over BMP4, the equilibrium shifts such that BMP4 will more frequently bind to unoccupied Cv-2 rather than to BMP4 receptor. One interpretation of our findings is that Cv-2 could have a dual role by decreasing the activity of low levels of BMP4, but increasing the activity of higher levels of BMP4. Alternatively, antagonism of BMP4 may be an effect of high levels of Cv-2 compared with BMP4 expression that do not occur in vivo.
There are similarities and differences between our results on chick Cv-2
and a recent study of a mouse Cv-2 homologue
(Moser et al., 2003
).
Consistent with our results, expression of mouse Cv-2 was found to bind BMPs,
to dorsalise mesoderm in activin-induced animal caps, and to induce secondary
axis formation following ventral overexpression in Xenopus embryos.
In addition, mouse Cv-2 antagonised the response to recombinant BMP4 in cell
culture assays. However, these authors did not analyse neural induction in
animal caps or carry out assays that detected cooperation with co-expressed
BMP4, and consequently concluded that Cv-2 normally acts as an antagonist.
Although the results are consistent with our findings that we interpret as a
weak BMP antagonistic effect of overexpressed Cv-2, an apparent discrepancy is
that expression of an excess of Cv-2 blocked the ability of BMP4 to ventralise
the Xenopus embryo when expressed in dorsal tissue. By contrast, we
find that Cv-2 increases the activity of co-expressed BMP4. However, we also
find that overexpressed Cv-2 can cooperate with noggin, a strong BMP
antagonist, to further block BMP activity. This may be due to the high ratio
of unoccupied Cv-2 to BMPs in this situation, or alternatively it is possible
that Cv-2 increases the binding of noggin to BMP4 (but see below). The
inhibition by Cv-2 of BMP-induced ventralisation of dorsal tissues may
therefore be explained by cooperation between overexpressed Cv-2 and
endogenous BMP antagonists that are present in dorsal regions.
Roles of Cv-2 in premigratory neural crest
Previous work has shown that inhibition of BMP activity by a posterior to
anterior gradient of noggin controls the timing of neural crest cell
emigration in the trunk (Sela-Donenfeld
and Kalcheim, 1999
). Neural crest migration is initiated when
noggin expression in premigratory neural crest is downregulated by
somite-derived signals (Sela-Donenfeld and
Kalcheim, 2000
), such that a threshold level of BMP activity is
achieved. Expression of Cv-2 occurs in a broad domain in premigratory neural
crest that shifts in an anterior-to-posterior wave and precedes the initiation
of neural crest emigration. Thus, the onset of neural crest migration is
preceded by an upregulation of Cv-2 and downregulation of noggin expression.
Furthermore, elevated expression of Cv-2 leads to premature emigration of
neural crest, consistent with Cv-2 acting to enhance BMP activity. This result
argues that the increased antagonism of endogenous BMPs in the presence of
noggin plus Cv-2 in Xenopus assays is an effect of overexpression,
and that at physiological levels of expression, noggin and Cv-2 have opposite
effects on BMP activity. We therefore propose that the timing of neural crest
cell migration is regulated by the balance between the promotion of BMP
activity by Cv-2 and inhibition by noggin. This model raises the question of
how Cv-2 expression is controlled in trunk neural crest, and whether it is
downstream of the slug transcription factor that regulates neural crest cell
migration, or whether, like noggin, Cv-2 expression is controlled by signals
from the adjacent somites.
BMP4 appears to have a distinct role in branchial compared with trunk
neural crest in the chick embryo, in which it regulates the elevated apoptosis
of neural crest cells derived from rhombomeres r3 and r5
(Graham et al., 1994
), and is
antagonised by noggin expression in r4
(Smith and Graham, 2001
). The
expression of Cv-2 in premigratory branchial neural crest could underlie a
promotion of BMP4 activity in opposition to noggin, and intriguingly at late
stages of expression in the hindbrain, Cv-2 transcripts are restricted to
dorsal r3 and r5. Although we did not detect altered apoptosis following
ectopic expression of Cv-2, it is possible that this reflects a lack of
sensitivity of this response to any changes in BMP4 activity, in contrast to
the threshold levels required for trunk neural crest migration. Alternatively,
BMP4 may have an indirect role in the apoptosis of branchial neural crest
(Farlie et al., 1999
).
Potential mechanisms of Cv-2 action
Our findings provide the first evidence that vertebrate Cv-2 elevates BMP4
activity, similar to Drosophila cv-2, whereas other studies of
vertebrate Cv-2 and of related CR proteins had only detected an antagonistic
activity. Loss-of-function studies will be required to determine whether Cv-2
has a dual role in promoting and blocking BMP activity or normally acts only
to increase BMP activity. A key question is how Cv-2 promotes BMP activity. As
suggested for Drosophila cv-2 (Conley et
al., 2000
), the presence of a VWD domain implicated in
multimerisation of extracellular matrix proteins raises the possibility that
Cv-2 binds to matrix and locally elevates BMP4 levels by constraining free
diffusion into adjacent tissue; this requires that Cv-2 can release BMP4 to
BMP receptor and acts as a `sponge' rather than a `trap' for BMP4. This model
predicts that Cv-2 activity can only be detected in the context of spatially
restricted BMPs, and can explain why Cv-2 does not elevate BMP activity in
cell culture experiments (Moser et al.,
2003
). Furthermore, as BMP4 itself can bind to specific
extracellular matrix proteins (Ohkawara et
al., 2002
), the ability of Cv-2 to modulate BMP activity may
depend upon which matrix proteins are present within the tissue.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Anderson, D. J., Groves, A., Lo, L., Ma, Q., Rao, M., Shah, N. M. and Sommer, L. (1997). Cell lineage determination and the control of neuronal identity in the neural crest. Cold Spring Harb. Symp. Quant. Biol. 62,493 -504.[Medline]
Balemans, W. and van Hul, W. (2002). Extracellular regulation of BMP signaling in vertebrates: a cocktail of modulators. Dev. Biol. 250,231 -250.[CrossRef][Medline]
Chang, C., Holtzman, D. A., Chau, S., Chickering, T., Woolf, E. A., Holmgren, L. M., Bodorova, J., Gearing, D. P., Holmes, W. E. and Brivanlou, A. H. (2001). Twisted gastrulation can function as a BMP antagonist. Nature 410,483 -487.[CrossRef][Medline]
Christiansen, J. H., Coles, E. G., Robinson, V., Pasini, A. and Wilkinson, D. G. (2001). Screening from a subtracted embryonic chick hindbrain cDNA library: identification of genes expressed during hindbrain, midbrain and cranial neural crest development. Mech. Dev. 102,119 -133.[CrossRef][Medline]
Coffinier, C., Ketpura, N., Tran, U., Geissert, D. and de Robertis, E. M. (2002). Mouse Crossveinless-2 is the vertebrate homolog of a Drosophila extracellular regulator of BMP signaling. Mech. Dev. 1,S179 -S184.[CrossRef]
Conley, C. A., Silburn, R., Singer, M. A., Ralston, A., Rohwer-Nutter, D., Olson, D. J., Gelbart, W. and Blair, S. S. (2000). Crossveinless 2 contains cysteine-rich domains and is required for high levels of BMP-like activity during the formation of the cross veins in Drosophila. Development 127,3947 -3959.[Abstract]
Cui, Y., Hackenmiller, R., Berg, L., Jean, F., Nakayama, T.,
Thomas, G. and Christian, J. L. (2001). The activity and
signaling range of mature BMP-4 is regulated by sequential cleavage at two
sites within the prodomain of the precursor. Genes
Dev. 15,2797
-2802.
De Robertis, E. M., Larrain, J., Oelgeschlager, M. and Wessely, O. (2000). The establishment of Spemann's organizer and patterning of the vertebrate embryo. Nat. Rev. Genet. 1, 171-181.[CrossRef][Medline]
Delot, E. C., Bahamonde, M. E., Zhao, M. and Lyons, K. M.
(2003). BMP signaling is required for septation of the outflow
tract of the mammalian heart. Development
130,209
-220.
Domingos, P. M., Itasaki, N., Jones, C. M., Mercurio, S., Sargent, M. G., Smith, J. C. and Krumlauf, R. (2001). The Wnt/beta-catenin pathway posteriorizes neural tissue in Xenopus by an indirect mechanism requiring FGF signalling. Dev. Biol. 239,148 -160.[CrossRef][Medline]
Farlie, P. G., Kerr, R., Thomas, P., Symes, T., Minichiello, J., Hearn, C. J. and Newgreen, D. (1999). A paraxial exclusion zone creates patterned cranial neural crest cell outgrowth adjacent to rhombomeres 3 and 5. Dev. Biol. 213, 70-84.[CrossRef][Medline]
Garcia Abreu, J., Coffinier, C., Larrain, J., Oelgeschlager, M. and de Robertis, E. M. (2002). Chordin-like CR domains and the regulation of evolutionarily conserved extracellular signaling systems. Gene 287,39 -47.[Medline]
Graham, A., Francis-West, P., Brickell, P. and Lumsden, A. (1994). The signalling molecule BMP4 mediates apoptosis in the rhombencephalic neural crest. Nature 372,684 -686.[CrossRef][Medline]
Hemmati-Brivanlou, A., Kelly, O. G. and Melton, D. A. (1994). Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity. Cell 77,283 -295.[CrossRef][Medline]
Henkemeyer, M., Marengere, L. E., McGlade, J., Olivier, J. P., Conlon, R. A., Holmyard, D. P., Letwin, K. and Pawson, T. (1994). Immunolocalisation of the Nuk receptor tyrosine kinase suggests roles in segmental patterning of the brain and axonogenesis. Oncogene 9,1001 -1014.[Medline]
Itasaki, N., Bel-Vialar, S. and Krumlauf, R. (1999). `Shocking' developments in chick embryology: electroporation and in ovo gene expression. Nat. Cell Biol. 1,E203 -E207.[CrossRef][Medline]
Jowett, T. (1998). Two colour in situ hybridization. In In Situ Hybridisation: A Practical Approach (ed. D. Wilkinson), pp.107 -126. Oxford, UK: Oxford University Press.
Kalcheim, C. (2000). Mechanisms of early neural crest development: from cell specification to migration. Int. Rev. Cytol. 200,143 -196.[CrossRef][Medline]
Knecht, A. K. and Bronner-Fraser, M. (2002). Induction of the neural crest: a multigene process. Nat. Rev. Genet. 3,453 -461.
Larrain, J., Bachiller, D., Lu, B., Agius, E., Piccolo, P. and de Robertis, E. M. (2000a). BMP-binding modules in chordin: a model for signalling regulation in the extracellular space. Development 127,821 -830.[Abstract]
Larrain, J., Bachiller, D., Lu, B., Agius, E., Piccolo, S. and de Robertis, E. M. (2000b). BMP-binding modules in chordin: a model for signalling regulation in the extracellular space. Development 127,821 -830.
Larrain, J., Oelgeschlager, M., Ketpura, N. I., Reversade, B., Zakin, L. and de Robertis, E. M. (2001). Proteolytic cleavage of Chordin as a switch for the dual activities of Twisted gastrulation in BMP signaling. Development 128,4439 -4447.
Matsui, M., Mizuseki, K., Nakatani, J., Nakanishi, S. and Sasai,
Y. (2000). Xenopus kielin: a dorsalizing factor containing
multiple chordin-type repeats secreted from the embryonic midline.
Proc. Natl. Acad. Sci. USA
97,5291
-5296.
Moghal, N. and Sternberg, P. W. (1999). Multiple positive and negative regulators of signaling by the EGF-receptor. Curr. Opin. Cell Biol. 11,190 -196.[CrossRef][Medline]
Moon, R. T. and Christian, J. L. (1989). Microinjection and expression of synthetic mRNAs in Xenopus embryos. Technique 1,76 -89.
Moser, M., Binder, O., Wu, Y., Aitsebaomo, J., Ren, R., Bode,
C., Bautch, V. L., Conlon, F. L. and Patterson, C. (2003).
BMPER, a novel endothelial cell precursor-derived protein, antagonizes bone
morphogenetic protein signaling and endothelial cell differentiation.
Mol. Cell. Biol. 23,5664
-5679.
Moustakas, A., Souchelnytskyi, S. and Heldin, C. H. (2001). Smad regulation in TGF-beta signal transduction. J. Cell Sci. 114,4359 -4369.
Nieuwkoop, P. and Faber, J. (1967). Normal table of Xenopus laevis (Daudin). London, UK: Elsevier.
Obara-Ishihara, T., Kuhlman, J., Niswander, L. and Herzlinger, D. (1999). The surface ectoderm is essential for nephric duct formation in intermediate mesoderm. Development 126,1103 -1108.[Abstract]
Oelgeschlager, M., Larrain, J., Geissert, D. and de Robertis, E. M. (2000). The evolutionarily conserved BMP-binding protein Twisted gastrulation promotes BMP signalling. Nature 405,757 -763.[CrossRef][Medline]
Ohkawara, B., Iemura, S., ten Dijke, P. and Ueno, N. (2002). Action range of BMP is defined by its N-terminal basic amino acid core. Curr. Biol. 12,205 -209.[CrossRef][Medline]
Perrimon, N. and McMahon, A. P. (1999). Negative feedback mechanisms and their roles during pattern formation. Cell 97,13 -16.[CrossRef][Medline]
Piccolo, S., Sasai, Y., Lu, B. and de Robertis, E. M. (1996). Dorsoventral patterning in Xenopus: inhibition of ventral signals by direct binding of chordin to BMP-4. Cell 86,589 -598.[CrossRef][Medline]
Piccolo, S., Agius, E., Lu, B., Goodman, S., Dale, L. and de Robertis, E. M. (1997). Cleavage of Chordin by Xolloid metalloprotease suggests a role for proteolytic processing in the regulation of Spemann organizer activity. Cell 91,407 -416.[CrossRef][Medline]
Ross, J. J., Shimmi, O., Vilmos, P., Petryk, A., Kim, H., Gaudenz, K., Hermanson, S., Ekker, S. C., O'Connor, M. B. and Marsh, J. L. (2001). Twisted gastrulation is a conserved extracellular BMP antagonist. Nature 410,479 -483.[CrossRef][Medline]
Ruiz i Altaba, A. and Melton, D. A. (1989). Involvement of the Xenopus homeobox gene Xhox3 in patternformation along the anterior-posterior axis. Cell 57,317 -326.[CrossRef][Medline]
Schneider, C., Wicht, H., Enderich, J., Wegner, M. and Rohrer, H. (1999). Bone morphogenetic proteins are required in vivo for the generation of sympathetic neurons. Neuron 24,861 -870.[CrossRef][Medline]
Scott, I. C., Blitz, I. L., Pappano, W. N., Maas, S. A., Cho, K. W. and Greenspan, D. S. (2001). Homologues of Twisted gastrulation are extracellular cofactors in antagonism of BMP signalling. Nature 410,475 -478.[CrossRef][Medline]
Sela-Donenfeld, D. and Kalcheim, C. (1999). Regulation of the onset of neural crest migration by coordinated activity of BMP4 and Noggin in the dorsal neural tube. Development 126,4749 -4762.[Abstract]
Sela-Donenfeld, D. and Kalcheim, C. (2000). Inhibition of noggin expression in the dorsal neural tube by somitogenesis: a mechanism for coordinating the timing of neural crest emigration. Development 127,4845 -4854.[Abstract]
Smith, A. and Graham, A. (2001). Restricting Bmp-4 mediated apoptosis in hindbrain neural crest. Dev. Dyn. 220,276 -283.[CrossRef][Medline]
Streit, A. and Stern, C. D. (1999). Mesoderm patterning and somite formation during node regression: differential effects of chordin and noggin. Mech. Dev. 85, 85-96.[CrossRef][Medline]
Xu, Q. and Wilkinson, D. (1998). In situ hybridisation of mRNA with hapten labelled probes. In In Situ Hybridisation: A Practical Approach (ed. D. Wilkinson), pp.87 -106. Oxford, UK: Oxford University Press.
This article has been cited by other articles:
![]() |
F. Rentzsch, C. Guder, D. Vocke, B. Hobmayer, and T. W. Holstein An ancient chordin-like gene in organizer formation of Hydra PNAS, February 27, 2007; 104(9): 3249 - 3254. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Shoval, A. Ludwig, and C. Kalcheim Antagonistic roles of full-length N-cadherin and its soluble BMP cleavage product in neural crest delamination Development, February 1, 2007; 134(3): 491 - 501. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ikeya, M. Kawada, H. Kiyonari, N. Sasai, K. Nakao, Y. Furuta, and Y. Sasai Essential pro-Bmp roles of crossveinless 2 in mouse organogenesis Development, November 15, 2006; 133(22): 4463 - 4473. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Rentzsch, J. Zhang, C. Kramer, W. Sebald, and M. Hammerschmidt Crossveinless 2 is an essential positive feedback regulator of Bmp signaling during zebrafish gastrulation Development, March 1, 2006; 133(5): 801 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. O'Connor, D. Umulis, H. G. Othmer, and S. S. Blair Shaping BMP morphogen gradients in the Drosophila embryo and pupal wing Development, January 15, 2006; 133(2): 183 - 193. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||