|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 6 October 2004
doi: 10.1242/dev.01434
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Section of Molecular Cell and Developmental Biology, Institute for Cellular and Molecular Biology, The University of Texas at Austin, Moffett Molecular Biology Building, 2500 Speedway, Austin, TX 78712, USA
* Author for correspondence (e-mail: jaf{at}mail.utexas.edu)
Accepted 8 September 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Eye, Drosophila, Notch, Delta, fat facets, liquid facets, Epsin, Endocytosis, Deubiquitinating enzyme, Ubiquitin
| Introduction |
|---|
|
|
|---|
Two proteins required for pattern formation in the Drosophila eye,
the deubiquitinating enzyme Fat facets (Faf) and its substrate Liquid facets
(Lqf), are linked to both cell signaling and clathrin-mediated endocytosis
(Fischer-Vize et al., 1992
;
Huang et al., 1995
;
Cadavid et al., 2000
;
Chen et al., 2002
;
Overstreet et al., 2003
). Lqf
protein levels in the Drosophila eye are controlled by the balance
between ubiquitination, which targets the protein for proteasomal degradation,
and deubiquitination by Faf, which prevents Lqf degradation
(Huang et al., 1995
;
Wu et al., 1999
;
Chen et al., 2002
). Faf and
Lqf mediate a cell communication event that prevents overneuralization of the
compound eye. Accordingly, faf or lqf mutant eyes contain
more than the normal complement of eight photoreceptors in each facet (or
ommatidium) of the eye. As mosaic experiments demonstrate that
faf+ and lqf+ function outside of the
ectopic photoreceptors, the extra photoreceptors must result from a failure of
cell signaling (Fischer-Vize et al.,
1992
; Cadavid et al.,
2000
). Several observations suggest that Faf and Lqf facilitate
endocytosis. First, Lqf is the Drosophila homolog of epsin, a
multi-modular protein that binds phosphoinisitol lipids at the cell membrane,
the adapter complex AP2, clathrin, ubiquitin and other endocytic accessory
factors (Kay et al., 1998
;
De Camilli et al., 2001
;
Wendland, 2002
). Epsin is
required for endocytosis in yeast and in mammalian cells
(Wendland et al., 1999
;
Itoh et al., 2001
;
Shih et al., 2002
). In
addition, faf and lqf mutations show dramatic genetic
interactions with mutations in the clathrin heavy chain gene, which
indicate that all three genes function in the same direction in a pathway
(Cadavid et al., 2000
).
Finally, the Notch ligand Delta fails to be internalized normally in
lqf mutant eye discs (Overstreet
et al., 2003
).
The overneuralization phenotype in faf and lqf mutants,
and the altered Delta localization in lqf mutants suggest a role for
Faf and Lqf in Notch/Delta signaling. The Notch pathway is highly conserved in
metazoans and participates in a wide range of cell communication events that
determine cell fate. Mutants in the Notch receptor and in other genes in the
signaling pathway (`neurogenic' genes) were first isolated on the basis of
their role in inhibiting neural cell fate determination in Drosophila
embryos (Lehmann et al.,
1981
). It is now apparent that Notch receptor activation, in
different cellular contexts, can result in either inhibition or promotion of a
variety of cell fates (Artavanis-Tsakonas
et al., 1999
). The mechanism of Notch signaling is unusual in that
upon ligand binding, a fragment of the Notch intracellular domain is cleaved,
travels into the nucleus, and acts a transcriptional regulator
(Artavanis-Tsakonas et al.,
1999
). Although details of the events that lead to nuclear
translocation of the Notch intracellular domain are contentious, there is a
consensus model where binding of ligand to the Notch extracellular domain
induces two cleavages of Notch. The first cleavage (called S2) detaches the
extracellular domain from the remainder of the Notch protein, and is
prerequisite for the second cleavage (S3) that releases the transcription
factor domain (Baron,
2003
).
Endocytosis controls Notch signaling in both the signaling and receiving
cells. The first evidence for this idea came from analysis of Drosophila
shibire mutants. shibire encodes the Drosophila homolog
of dynamin, a GTPase required for scission of endocytic vesicles
(Chen et al., 1991
).
shibire mutant phenotypes resemble Notch loss-of-function
phenotypes, and the results of mosaic experiments suggest that
shibire is required in both the signaling and receiving cells
(Poodry, 1990
;
Seugnet et al., 1997
). A model
for the dual function of shibire was formulated for Notch signaling
during lateral inhibition, where both the signalers and receivers express both
Notch and Delta. In this case, selective internalization of either Notch or
Delta could bias cells to become either the signaler or the receiver. Recent
experiments with Drosophila sensory organ precursors support the idea
that Notch internalization may bias a cell to become the signaler. The Numb
protein, which binds Notch and the endocytic protein
-adaptin, is
asymmetrically distributed between two daughter cells and the Numb-containing
cell becomes the signaler (Rhyu et al.,
1994
; Lu et al.,
1998
; Santolini et al.,
2000
; Berdnik et al.,
2002
; Le Borgne and
Schweisguth, 2003
). Thus, by stimulating Notch internalization,
Numb may bias one sensory organ precursor cells to become the signaler.
In addition to preventing a cell from displaying either Notch or Delta at
the cell membrane, endocytosis has also been proposed to play a positive role
in Notch receptor activation (Parks et
al., 2000
). The idea is that the Notch extracellular domain, bound
to Delta, is trans-endocytosed into the Delta-expressing (signaling) cell.
This trans-endocytosis event is prerequisite for S2 cleavage, and therefore
for S3 cleavage and activation of Notch in the receiving cell. Evidence for
this model comes from experiments in the developing Drosophila eye
using two non-neural cell types: cone cells and pigment cells
(Parks et al., 1995
;
Parks et al., 2000
).
Delta is transcribed in cone cells, and Notch is transcribed
in pigment cells. Yet, the extracellular domain of Notch (NECD) is
detected with Delta in endosomes inside the cone cells. Moreover, in
shibire mutants, Notch and Delta both accumulate at cone cell plasma
membranes. In addition, in Delta mutants, there are significantly
fewer NECD-containing vesicles in cone cells. In addition, in
temperature-sensitive Delta loss-of-function mutants, Delta
accumulates on cone cell membranes. Finally, in cell culture, cells expressing
Delta alleles that encode endocytosis-defective ligands do not
trans-endocytose NECD.
Consistent with the trans-endocytosis model, the ubiquitin-ligases
Neuralized (in Drosophila and Xenopus) and Mindbomb (in
zebrafish) modulate Delta endocytosis and Delta signaling. Neuralized (Neur)
and Mindbomb ubiquitinate Delta thereby stimulating Delta internalization
(Itoh et al., 2003
;
Yeh et al., 2001
;
Deblandre et al., 2001
;
Lai et al., 2001
;
Pavlopoulos et al., 2001
). The
results of several studies suggest that Neur and Mindbomb are required in the
Delta signaling cells to promote Notch activation in the receiving cells
(Pavlopoulos et al., 2001
;
Itoh et al., 2003
;
Le Borgne and Schweisguth,
2003
; Li and Baker,
2004
). However, the role of Neur is unclear, as other reports
suggest that Neur is required for Delta internalization in the receiving
cells, perhaps to bias those cells to become the receivers
(Yeh et al., 2000
;
Lai et al., 2001
;
Lai and Rubin, 2001a
;
Lai and Rubin, 2001b
).
Here, we report a unique mechanism for regulating Notch/Delta signaling. We show that the deubiquitinating enzyme Faf, through its substrate Lqf, promotes Delta internalization and Delta signaling by the signaling cells. The signaling cells, photoreceptor precursors R2/3/4/5, thus activate Notch in surrounding undifferentiated cells, preventing recruitment of ectopic photoreceptors (R-cells). We call this event R-cell restriction. In addition, we show that while Faf is required only for R-cell restriction, Lqf is needed also for two earlier events in the eye that require Notch/Delta signaling: proneural enhancement and lateral inhibition. We also provide evidence that Neur functions with Faf and Lqf in R-cell restriction. There are three main conclusions of this work. First, the results provide strong support for the model where Delta internalization by the signaling cell is required for Notch activation in the receiving cell. Second, the results support a model where Neur stimulates Delta internalization in the signaling cells rather than in the receiving cells. Finally, we demonstrate that deubiquitination by Faf of the endocytic factor Lqf is a novel mechanism for regulating Delta signaling. We propose that by elevating Lqf activity, Faf enhances the efficiency of Delta endocytosis and promotes Delta signaling.
| Materials and methods |
|---|
|
|
|---|
Although neur1 and neur11 are reported to be null alleles, several results presented here suggest that neur11 retains some neur+ activity. As described below, neur1 enhances the lqfFDD9 phenotypes much more strongly than does neur11, and the eye disc patterning defects in neur1 are more severe than in neur11.
Eye disc clones
lqfARI eye disc clones were generated in larvae of the
following genotypes: ey-FLP; lqfARI FRT80B/Ub-GFP FRT80B.
Dlrev10 eye disc clones were generated in larvae of the
following genotype: ey-FLP; FRT82B Dlrev10/FRT82B Ub-GFP.
neur1 eye disc clones were generated in larvae of the
following genotype: ey-FLP; FRT82B neur/FRT82B Ub-GFP.
neur11 eye discs were generated in larvae of the following
genotype: EGUF/RO-GFP; FRT82B neur11/FRT82B GMR-hid
l(3)CL-R.
Analysis of adult eyes
Sectioning, light microscopy and photography of adult eyes was as described
(Huang et al., 1995
). Flies
with neur11 eyes were: EGUF/+; FRT82B
neur11/FRT82B GMR-hid l(3)CL-R. The
fafFO8/faf+ mosaic ommatidia are those
described (Fischer-Vize et al.,
1992
) and they were reanalyzed here using different criteria. The
fafBX4/faf+ mosaic ommatidia were generated and
prepared for microscopy exactly as described
(Fischer-Vize et al.,
1992
).
Immunocytochemistry of eye discs
Primary antibodies used were rabbit polyclonal anti-Ato at 1:2000
(Jarman et al., 1994
) from Y.
N. Jan; anti-Boss mouse ascites at 1:2000
(Kramer et al., 1991
) from H.
Kramer; anti-E(spl) mAb323 supernatant at 1:2
(Jennings et al., 1994
) from
S. Bray; anti-Dl mAb202 supernatant at 1:10
(Parks et al., 1995
) from H.
Kramer; and rat monoclonal anti-Elav supernatant at 1:9
(O'Neill et al., 1994
) from
the Developmental Studies Hybridoma Bank. Secondary antibodies (Molecular
Probes) were Alexa633-anti-mouse, Alexa568-anti-mouse,
Alexa633-anti-rat and Alexa633-anti-rabbit, all used at
1:500. In addition, Alexa568- and Alexa633-phalloidin
were used as described (Chen et al.,
2002
). Eye discs immunostaining and confocal microscopy were as
described (Chen et al.,
2002
).
P element constructs and transformation
RO-GFP
A DNA fragment containing GFP flanked by AscI sites was
generated by PCR, using a GFP-containing plasmid
(Siemering et al., 1996
) as a
template and the following primers:
5'GGCGCGCCATGAGTAAAGGAGAAGAAC3' and
5'GGCGCGCCTTATTTGTATAGTTCATCCC3'. The PCR product was ligated into
pGEM-T-Easy (Promega) to generate pGEM-GFP. The GFP DNA sequence in
pGEM-GFP was determined, and the AscI fragment containing
GFP was isolated and ligated into the AscI site of pRO
(Huang and Fischer-Vize,
1996
). A plasmid, pRO-GFP, with the AscI fragment in the
appropriate orientation was isolated.
RO-GFP-lqf
An AscI-NdeI DNA fragment containing GFP was
generated by PCR using a GFP-containing plasmid
(Siemering et al., 1996
) as a
template and the following primers:
5'CAGATGGGCGCGCCATGAGTAAAGGAGAAC3',
5'CATATGTTTGTATAGTTCATCC3'. The PCR product was ligated into
pGEM-T-Easy to generate pGEM-GFP-AN. The GFP DNA sequence in
pGEM-GFP-AN was determined and the
700 bp AscI-NdeI
GFP fragment was isolated and ligated into a plasmid containing the
lqf cDNA called pMoPac-lqf-cDNA3. pMoPac-lqf-cDNA3 was constructed as
follows: the lqf cDNA was generated in two parts by PCR using as a
template a plasmid containing lqf cDNA-3
(Cadavid et al., 2000
). The
5' part of lqf was generated as an NdeI-HpaI
fragment using the primers 5'ATGCAGGTCAATGTCGCTGG3' and
5'CGGTTTGATCAGATTGTCTAGG. The PCR product was ligated into pGEM-T-Easy
to generate pGEM-Lqf5' and the lqf DNA sequence in the plasmid
was determined. The 3' part of lqf was generated as an
HpaI-AscI fragment using the primers
5'TTTCCTCGGCGAGAACTC3' and
5'TTACGACAAAAACGGATTTGTTG3'. The PCR product was ligated into
pGEM-T-Easy to generate pGEM-cDNA3-3' and the lqf DNA sequence
in the plasmid was determined. A
1650 bp NdeI-HpaI
fragment of pGEM-Lqf5' and
800 bp NdeI-AscI
fragment of pGEM-cDNA3-3' were isolated and ligated into pMoPac
(Hayhurst et al., 2003
)
restricted with NdeI and AscI.
RO-shiDN
An SpeI-SalI fragment of pTM1 containing
shiK44A (Moline et
al., 1999
) (obtained from A. Bejsovec) was ligated into pBSKII
(Stratagene) restricted with SpeI and SalI to generate
pBSK-shiDN. AscI sites flanking the
shiK44A gene were added as follows: pBSK-shiDN
was restricted with SpeI, treated with Klenow fragment, and an
AscI linker ligated in. A second AscI linker was ligated
similarly into the SalI site. The resulting AscI fragment of
shiK44A was purified and ligated into pRO. A plasmid,
pRO-shiDN, with the AscI fragment in the appropriate
orientation, was isolated.
RO-DlDN
A DNA fragment of Delta lacking the cytoplasmic domain and flanked
by AscI sites was generated by PCR, using as a template pG1C
(Fehon et al., 1990
) (obtained
from M. Muskavitch), which contains a complete Delta cDNA and the
following primers and also inserted a stop codon:
5'GGCGCGCCCACACACACACACAGCCCTG3' and
5'GGCGCGCCTTACACCGCATTCTGTTC3'. The PCR product was ligated into
pGEM-T-Easy to generate pGEM-DlDN. An AscI fragment
containing the truncated Delta gene was purified from
pGEM-DlDN and ligated into pRO. A plasmid, pRO-DlDN,
with the AscI fragment in the appropriate orientation was
isolated.
P-element transformants were generated by injection of w1118 embryos using standard techniques.
| Results |
|---|
|
|
|---|
|
In lqfFDD9 eye discs, which produce low levels of
wild-type Lqf protein, Delta accumulates on cell membranes in columns 0-3
posterior to the furrow (Fig.
1F) (Overstreet et al.,
2003
). Like lqfFDD9, faf mutant discs have
decreased levels of Lqf protein (Chen et
al., 2002
). In order to determine if Delta internalization is
defective in faf mutant discs and in which cells, we double-labeled
fafFO8 third instar larval eye discs
[fafFO8 is a strong mutant allele
(Fischer-Vize et al., 1992
;
Chen and Fischer, 2000
)] with
antibodies to the Delta extracellular domain and with phalloidin to outline
the apical membranes of the ommatidial cluster cells. We find that Delta is
present on the membranes of R2/3/4/5 and the ectopic R-cells in columns 0-3 of
fafFO8 discs (Fig.
1E,H-H''). Some vesicular Delta is also observed
(Fig. 1H''). We conclude
that both faf+ and lqf+ are required
for Delta endocytosis in R-cell clusters in columns 0-3.
The observation that similar Delta internalization defects occur in faf and lqf mutant discs supports the idea that the faf mutant phenotype results from a decrease in the level of Lqf protein. However, more Delta-expressing cells emerge posterior to the furrow in lqfFDD9 discs than in wild-type or faf discs. The difference in Delta expression between faf and lqfFDD9 discs reflects a broader requirement for lqf+ in early developmental decisions (see below).
faf+ and lqf+ function in R2/3/4/5 precursors
In faf mutants, the R2/3/4/5 precursors display Delta endocytosis
defects. In order to determine whether faf+ and
lqf+ function in these cells, we investigated the
expression pattern of the vector pRO
(Huang and Fischer-Vize,
1996
). pRO transgenes that drive expression of a faf cDNA
(RO-faf) can substitute for the endogenous faf gene
(Huang and Fischer-Vize,
1996
). Likewise, a RO-lqf transgene rescues to wild type
the mutant eye phenotype of lqfFDD9 or faf
(Cadavid et al., 2000
). We
generated a RO-GFP transgene and observed the pattern of GFP
expression in eye discs from three independent transformant lines. We find
that GFP is expressed in R2/3/4/5 beginning in column1
(Fig. 2A,B). The same results
were obtained with a RO-GFP-lqf transgene which also complements the
faf and lqfFDD9 mutant phenotypes (data not
shown). We conclude that expression of faf+ or
lqf+ in R2/3/4/5 is sufficient to substitute for the
endogenous faf gene or to compensate for the lower levels of Lqf
protein in lqfFDD9.
|
10% of the facets are phenotypically wild type. These
results show that as more of the R-cells in the R2/3/4/5 group are
faf+, there is an increasing tendency for the ectopic
R-cells to be excluded.
Endocytosis is required in R2/3/4/5 precursors to prevent ectopic R-cell recruitment
faf+ and lqf+ activities are linked
to endocytosis and Delta endocytosis fails in precluster cells with decreased
lqf+ activity (fafFO8 or
lqfFDD9). Is a failure of endocytosis the cause of the
faf and lqfFDD9 mutant eye phenotypes? If so,
then disrupting endocytosis in R2/3/4/5 through a mechanism other than
blocking faf+ or lqf+ gene activity
should result in an eye phenotype similar to that of faf or
lqfFDD9. We interfered with endocytosis in R2/3/4/5 by
expressing a dominant-negative form of Shibire
(Moline et al., 1999
) using
the pRO vector (RO-shiDN). We find that otherwise
wild-type flies expressing RO-shiDN display adult retinal
defects similar to those in faf or lqfFDD9
mutants (Fig. 3A, Fig. 1A-C). The ectopic R-cells
in RO-shiDN join the clusters in columns 0-3 as in
faf or lqfFDD9 discs
(Fig. 3B-D). Moreover, Delta
internalization defects similar to those in faf or
lqfFDD9 are observed in RO-shiDN eye
discs (Fig. 3B-D,
Fig. 1E,F). We conclude that
R2/3/4/5 precursors require endocytosis to prevent inappropriate recruitment
of neighboring precluster cells as R-cells.
|
lqf+ is required in the signaling cells for two faf+-independent Delta signaling events at the morphogenetic furrow
We have shown that in order to prevent recruitment of ectopic R-cells into
the ommatidia, faf+ and lqf+ are
required for Delta signaling by R-cell precursors just posterior to the
furrow. faf+ appears to be essential only for this one
Delta signaling event: in fafFO8 (strong) mutants, Delta
is on the membrane in R-cell preclusters, ectopic R-cells are recruited just
posterior to the furrow and the adult eye phenotype (ectopic R-cells) reflects
these events. By contrast, lqf+ appears to be necessary
also for earlier patterning processes. In lqf mutant eye discs
[lqfFDD9 or discs with small lqfARI
(null) clones], all cells emerging from the furrow express Delta
(Fig. 1F)
(Overstreet et al., 2003
)
(also see below), whereas in wild-type discs Delta is expressed in distinct
clusters (Fig. 1D)
(Parks et al., 1995
). In
addition, in the adult eye, the phenotype of lqfARI clones
is much more severe than that of faf mutants
(Fischer et al., 1997
).
Prior to the faf+-dependent signaling event, two
discrete Notch/Delta signaling processes are required for the evolution of
expression of the proneural protein Atonal
(Baker and Yu, 1996
;
Baker et al., 1996
;
Baker, 2002
). First, Notch
activation in groups of cells anterior to the furrow upregulates Atonal
expression; this event is referred to as proneural enhancement. Elevated
Atonal levels are necessary for neural determination of these cells. Second,
Notch/Delta signaling is essential for lateral inhibitory interactions that
resolve Atonal expression to one cell by column 0. The one Atonal-expressing
cell becomes R8, the founder R-cell of each ommatidium
(Baker and Yu, 1998
).
In order to determine whether lqf+ is required for
Delta signaling during proneural enhancement and/or lateral inhibition, we
analyzed the phenotypes of large lqfARI (null) clones
using a number of different antibodies and compared them with the phenotypes
of large Dlrev10 (null) clones. We find that the
lqfARI clone phenotypes closely resemble those of
Dlrev10 clones described earlier
(Baker and Yu, 1996
).
Upregulation of atonal (proneural enhancement) does not occur in the
Dlrev10 or lqfARI clone centers
(Fig. 4); although the cells in
the middle of the clone are Notch+, there are no
Delta+ cells adjacent to them to activate Notch. As would
be expected, Dlrev10 or lqfARI mutant
cells at the clone borders adjacent to Delta+ cells do
upregulate atonal (Fig.
4). In the absence of proneural enhancement, no R-cells are
expected to be determined posterior to the furrow. Consistent with this,
R-cells are absent from the centers of Dlrev10 or
lqfARI clones (Fig.
5A,A',C,C'). By contrast, at the clone borders where
mutant cells undergo proneural enhancement, R-cells are present
(Fig. 5A,A',C,C').
Lateral inhibition also fails in Dlrev10 and
lqfARI clones. The R-cells at the
Dlrev10 or lqfARI clone borders are
not organized into discrete ommatidia; instead, it appears that all of the
mutant border cells are R-cells (Fig.
5A,A',C,C'). As these cells cannot send Delta signals,
lateral inhibition fails. Consistent with this idea, there are clusters of R8s
at the borders of the clones (Fig.
5B,B',D,D'). We conclude that lqf+
is required in the Delta signaling cells for proneural enhancement and lateral
inhibition.
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
|
Whatever the precise mechanism, given that both Faf and Lqf are expressed
ubiquitously in the eye (Fischer-Vize et
al., 1992
; Chen et al.,
2002
), two related questions arise. First, why is Lqf
ubiquitinated at all if Faf simply deubiquitinates it everywhere? One
possibility is that Faf is one of many deubiquitinating enzymes that regulate
Lqf, and expression of the others is restricted spatially. This could also
explain why Faf is required only for R-cell restriction (see below). Another
possibility is that Faf activity is itself regulated in a spatial-specific
manner in the eye disc. Alternatively, Lqf ubiquitination may be so efficient
that Faf is needed to provide a pool of non-ubiquitinated, active Lqf.
Similarly, Faf could be part of a subtle mechanism for timing Lqf activation.
Second, why is Faf essential only for R-cell restriction? One possibility is
that there is a graded requirement for Lqf in the eye disc, such that
proneural enhancement requires the least Lqf, lateral inhibition somewhat more
and neural inhibitory signaling by R2/3/4/5 the most. The mutant phenotype of
homozygotes for the weak allele lqfFDD9 supports this
idea, as R-cell restriction is most severely affected. Alternatively, Lqf may
be expressed or ubiquitinated with dissimilar efficiencies in different
regions of the eye disc. More experiments are needed to understand the precise
mechanism by which the Faf/Lqf interaction enhances Delta signaling.
Neur stimulates Delta internalization in the signaling cells
In neur mutants, Delta accumulates on the membranes of signaling
cells and Notch activation in neighboring cells is reduced. These results
support a role for Neur in endocytosis of Delta in the signaling cells to
achieve Notch activation in the neighboring receiving cells, rather than in
downregulation of Delta in the receiving cells. Because neur shows
strong genetic interactions with lqf and both function in R-cells,
Neur and Lqf might work together to stimulate Delta endocytosis. Lqf has
ubiquitin interaction motifs (UIMs) that bind ubiquitin
(Polo et al., 2002
;
Oldham et al., 2002
). One
explanation for how Neur and Faf/Lqf could function together is that Lqf
facilitates Delta endocytosis by binding to Delta after its ubiquitination by
Neur (Fig. 9B). This is an
attractive model that will stimulate further experiments.
Specificity of Lqf for Delta endocytosis
One exciting observation is that the endocytic adapter Lqf may be essential
specifically for Delta internalization. Although we have not examined these
signaling pathways directly, hedgehog, decapentaplegic and
wingless signaling appear to be functioning in the absence of Lqf.
These three signaling pathways regulate movement of the morphogenetic furrow
(Lee and Treisman, 2002
) and
are thought to require endocytosis (Seto
et al., 2002
). The furrow moves through lqf-null clones
and at the same pace as the surrounding wild-type cells
(Fig. 7)
(Overstreet et al., 2003
).
Moreover, all mutant phenotypes of lqf-null clones can be accounted
for by loss of Delta function. Further experiments will clarify
whether this apparent specificity means that Lqf functions only in
internalization of Delta, or if the process of Delta endocytosis is
particularly sensitive to the levels of Lqf.
Endocytic proteins as targets for regulation of signaling
Lqf expands the small repertoire of endocytic proteins that are known
targets for regulation of cell signaling. In addition to Lqf, the endocytic
proteins Numb and Eps15 (EGFR phosphorylated
substrate 15) are objects of regulation. In vertebrates,
asymmetrical distribution into daughter cells of the
-adaptin binding
protein Numb may be achieved through ubiquitination of Numb by the
ubiquitin-ligase LNX (Ligand of Numb-protein X) and subsequent Numb
degradation (Nie et al.,
2002
). In addition, in vertebrate cells, Eps15 is phosphorylated
and recruited to the membrane in response to EGFR activation and is required
for ligand-induced EGFR internalization
(Confalonieri et al., 2000
).
Given that endocytosis is so widely used in cell signaling, endocytic proteins
are likely to provide an abundance of targets for its regulation.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J.
(1999). Notch signaling: cell fate control and signal integration
in development. Science
284,770
-776.
Baker, N. E. (2002). Notch and the patterning of ommatidial founder cells in the developing Drosophila eye. In Drosophila Eye Development (ed. K. Moses), pp.35 -58. Berlin, Germany: Springer-Verlag.
Baker, N. E. and Yu, S.-Y. (1996). Proneural function of neurogenic genes in the developing Drosophila eye. Curr. Biol. 7,122 -132.[CrossRef]
Baker, N. E. and Yu, S.-Y. (1998). The R8-photoreceptor equivalence group in Drosophila: fate choice precedes regulated Delta transcription and is independent of Notch gene dose. Mech. Dev. 74, 3-14.[CrossRef][Medline]
Baker, N. E., Yu, S. and Han, D. (1996). Evolution of proneural Atonal expression during distinct regulatory phases in the developing Drosophila eye. Curr. Biol. 6,1290 -1301.[CrossRef][Medline]
Baron, M. (2003). An overview of the Notch signaling pathway. Sem. Cell Dev. Biol. 14,113 -119.[CrossRef][Medline]
Berdnik, D., Torok, T., Gonzalez-Gaitan, M. and Knoblich, J.
A. (2002). The endocytic protein
-Adaptin is required
for Numb-mediated asymmetric cell division in Drosophila. Dev.
Cell 3,221
-231.[CrossRef][Medline]
Cadavid, A. L. M., Ginzel, A. and Fischer, J. A. (2000). The function of the Drosophila Fat facets deubiquitinating enzyme in limiting phtoreceptor cell number is intimately associated with endocytosis. Development 127,1727 -1736.[Abstract]
Chen, M. S., Obar, R. A., Schroeder, C. C., Austin, T. W., Poodry, C. A., Wadsworth, S. C. and Vallee, R. B. (1991). Multiple forms of dynamin are encoded by shibire, a Drosophila gene involved in endocytosis. Nature 351,583 -586.[CrossRef][Medline]
Chen, X. and Fischer, J. A. (2000). In
vivo structure/function analysis of the Drosophila fat facets
deubiquitinating enzyme gene. Genetics
156,1829
-1836.
Chen, X., Zhang, B. and Fischer, J. A. (2002).
A specific protein substrate for a deubiquitinating enzyme: liquid facets is
the substrate of Fat facets. Genes Dev.
16,289
-294.
Confalonieri, S., Salcini, A. E., Puri, C., Tacchetti, C. and di
Fiore, P. P. (2000). Tyrosine phosphorylation of Eps15 is
required for ligand-regulated, but not constitutive, endocytosis.
J. Cell Biol. 150,905
-912.
De Camilli, P., Chen, H., Hyman, J., Panepucci, E., Bateman, A. and Brunger, A. T. (2001). The ENTH domain. FEBS Lett. 25686,1 -8.
De Joussineau, C., Soule, J., Martin, M., Anguille, C., Montcourrier, P. and Alexandre, D. (2003). Delta-promoted filopodia mediate long-range lateral inhibition in Drosophila. Nature 426,503 -504.[CrossRef][Medline]
Deblandre, G. A., Lai, E. C. and Kintner, C. (2001). Xenopus Neuralized is a ubiquitin ligase that interacts with Xdelta1 and regulates Notch signaling. Dev. Cell 1,795 -806.[CrossRef][Medline]
Fehon, R. G., Kooh, P. J., Rebay, I., Regan, C. L., Xu, T., Muskavitch, M. A. T. and Artavanis-Tsakonas, S. (1990). Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF homologous genes in Drosophila.Cell 61,523 -534.[CrossRef][Medline]
Fischer, J. A., Leavell, S. and Li, Q. (1997). Mutagenesis screens for interacting genes reveal three roles for fat facets during Drosophila eye development. Dev. Gen. 21,167 -174.[CrossRef][Medline]
Fischer-Vize, J. A., Rubin, G. M. and Lehmann, R. (1992). The fat facets gene is required for Drosophila eye and embryo development. Development 116,985 -1000.[Abstract]
FlyBase (2003). The FlyBase database of the
Drosophila genome projects and community literature.
Nucleic Acids Res. 31,172
-175.
Gonzalez-Gaitan, M. and Stenmark, H. (2003). Endocytosis and signaling: a relationship under development. Cell 115,513 -521.[CrossRef][Medline]
Hayhurst, A., Happe, S., Mabry, R., Koch, Z., Iverson, B. L. and Georgiou, G. (2003). Isolation and expression of recombinant antibody fragments to the biological warfare pathogen Brucella melitensis.J. Immunol. Methods 276,185 -196.[CrossRef][Medline]
Huang, Y. and Fischer-Vize, J. A. (1996). Undifferentiated cells in the developing Drosophila eye influence facet assembly and require the Fat facets ubiquitin-specific protease. Development 122,3207 -3216.[Abstract]
Huang, Y., Baker, R. T. and Fischer-Vize, J. A.
(1995). Control of cell fate by a deubiquitinating enzyme encoded
by the fat facets gene. Science
270,1828
-1831.
Itoh, M., Kim, C. H., Palardy, G., Oda, T., Jiang, Y. J., Maust, D., Yeo, S. Y., Lorick, K., Wright, G. J., Ariza-McNaughton, L. et al. (2003). Mind bomb is a ubiquitin ligase that is essential for efficient activation of Notch signaling by Delta. Dev. Cell 4,67 -82.[CrossRef][Medline]
Itoh, T., Koshiba, S., Kigawa, T., Kikuchi, A., Yokoyama, S. and
Takenawa, T. (2001). Role of the ENTH domain in
phosphatidyl-inositol-4,5-bisphosphate binding and endocytosis.
Science 291,1047
-1051.
Jarman, A. P., Grell, E. H., Ackerman, L., Jan, L. Y. and Jan, Y. N. (1994). atonal is the proneural gene for Drosophila photoreceptors. Nature 369,398 -400.[CrossRef][Medline]
Jennings, B., Preiss, A., Delidakis, C. and Bray, S. (1994). The Notch signaling pathway is required for Enhancer of split protein expression during neurogenesis in the Drosophila embryo. Development 120,3537 -3548.[Abstract]
Kay, B. K., Yamabhai, M., Wendland, B. and Emr, S. D. (1998). Identification of a novel domain shared by putative components of the endocytic and cytoskeletal machinery. Protein Sci. 8,435 -438.
Kramer, H., Cagan, R. L. and Zipursky, S. L. (1991). Interaction of Bride of Sevenless membrane-bound ligand and the Sevenless tyrosine kinase. Nature 352,207 -212.[CrossRef][Medline]
Lai, E. C. and Rubin, G. M. (2001a).
neuralized is essential for a subset of Notch pathway-dependent cell
fate decisions during Drosophila eye development. Proc.
Natl. Acad. Sci. USA 98,5637
-5642.
Lai, E. C. and Rubin, G. M. (2001b). neuralized functions cell-autonomously to regulate a subset of Notch-dependent processes during adult Drosophila development. Dev. Biol. 231,217 -233.[CrossRef][Medline]
Lai, E. C., Deblandre, G. A., Kintner, C. and Rubin, G. M. (2001). Drosophila Neuralized is a ubiquitin ligase that promotes the internalization and degradation of Delta. Dev. Cell 1,783 -794.[CrossRef][Medline]
Le Borgne, R. and Schweisguth, F. (2003). Unequal segregation of Neuralized biases Notch activation during asymmetric cell division. Dev. Cell 5, 139-148.[CrossRef][Medline]
Lee, J. D. and Treisman, J. E. (2002). Regulators of the morphogenetic furrow. In Drosophila Eye Development (ed. K. Moses), pp. 21-33. Berlin, Germany: Springer-Verlag.
Lehmann, R., Dietrich, U., Jimenez, F. and Campos-Ortega, J. A. (1981). Mutations of early neurogenesis in Drosophila.Rouxs Arch. Dev. Biol. 190,226 -229.[CrossRef]
Lehmann, R., Jimenez, F., Dietrich, U. and Campos-Ortega, J. A. (1983). On the phenotype and development of mutants of early neurogenesis in Drosophila melanogaster. Rouxs Arch. Dev. Biol. 192,62 -74.[CrossRef]
Li, Y. and Baker, N. E. (2001). Proneural enhancement by Notch overcomes Suppressor-of-hairless repressor function in the developing Drosophila eye. Curr. Biol. 11,330 -338.[CrossRef][Medline]
Li, Y. and Baker, N. E. (2004). The roles of cis-inactivation by Notch ligands and of neuralized during eye and bristle patterning in Drosophila. BMC Dev. Biol. 4,5 -15.[CrossRef][Medline]
Lu, B., Rothenberg, M., Jan, L. Y. and Jan, Y. N. (1998). Partner of Numb colocalizes with Numb during mitosis and directs Numb asymmetrical localization in Drosophila neural and muscle progenitors. Cell 95,225 -235.[CrossRef][Medline]
Mlodzik, M. (2002). Tissue polarity in the retina. In Drosophila Eye Development (ed. K. Moses), pp. 89-106. Berlin, Germany: Springer-Verlag.
Moline, M. M., Southern, C. and Bejsovec, A. (1999). Directionality of Wingless protein transport influences epidermal patterning in the Drosophila embryo. Development 126,4375 -4384.[Abstract]
Nagaraj, R., Canon, J. and Banerjee, U. (2002). Cell fate specification in the Drosophila eye. In Drosophila Eye Development (ed. K. Moses), pp.73 -88. Berlin, Germany: Springer-Verlag.
Newsome, T. P., Asling, B. and Dickson, B. J. (2000). Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics. Development 4, 851-860.
Nie, J., McGill, M., Dermer, M., Dho, S., Wolting, C. and McGlade, C. J. (2002). LNX functions as a RING type E3 ubiquitin ligase that targets the cell fate determinant Numb for ubiquitin dependent degradation. EMBO J. 21, 93-102.[CrossRef][Medline]
O'Neill, E. M., Rebay, I., Tjian, R. and Rubin, G. M. (1994). The activities of two Ets-related transcription factors required for Drosophila eye development are modulated by the Ras/MAPK pathway. Cell 78,137 -147.[CrossRef][Medline]
Oldham, C. E., Mohoney, R. P., Miller, S. L., Hanes, R. N. and O'Bryan, J. P. (2002). The ubiquitin-interacting motifs target the endocytic adaptor protein epsin for ubiquitination. Curr. Biol. 12,1112 -1116.[CrossRef][Medline]
Overstreet, E., Chen, X., Wendland, B. and Fischer, J. A. (2003). Either part of a Drosophila epsin protein, divided after the ENTH domain, functions in endocytosis of Delta in the developing eye. Curr. Biol. 13,854 -860.[CrossRef][Medline]
Parks, A. L., Turner, F. R. and Muskavitch, M. A. T. (1995). Relationships between complex Delta expression and the specification of retinal cell fates during Drosophila eye development. Mech. Dev. 50,201 -216.[CrossRef][Medline]
Parks, A. L., Klueg, K. M., Stout, J. R. and Muskavitch, M. A. T. (2000). Ligand endocytosis drives receptor dissociation and activation in the Notch pathway. Development 127,1373 -1385.[Abstract]
Pavlopoulos, E., Pitsouli, C., Klueg, K. M., Muskavitch, M. A. T., Moschonas, N. K. and Delidakis, C. (2001). neuralized encodes a peripheral membrane protein involved in Delta signaling and endocytosis. Dev. Cell 1, 807-816.[CrossRef][Medline]
Polo, S., Sigismund, S., Faretta, M., Guidi, M., Capua, M. R., Bossi, G., Chen, H., de Camilli, P. and di Fiore, P. P. (2002). A single motif responsible for ubiquitin recognition and monoubiquitination in endocytic proteins. Nature 416,381 -383.[CrossRef][Medline]
Poodry, C. A. (1990). shibire, a neurogenic mutant of Drosophila. Dev. Biol. 138,464 -472.[CrossRef][Medline]
Rhyu, M. S., Jan, L. Y. and Jan, Y. N. (1994). Asymmetric distribution of Numb protein during division of the sensory organ precursor cell confers distinct fates to daughter cells. Cell 76,477 -491.[CrossRef][Medline]
Santolini, E., Puri, C., Salcini, A. E., Gagliani, M. C.,
Pelicci, P. G., Tacchetti, C. and di Fiore, P. P. (2000).
Numb is an endocytic protein. J. Cell Biol.
151,1345
-1352.
Seto, E. S., Bellen, H. J. and Lloyd, T. E.
(2002). When cell biology meets development: endocytic regulation
of signaling pathways. Genes Dev.
16,1314
-1336.
Seugnet, L., Simpson, P. and Haenlin, M. (1997). Requirement for Dynamin during Notch signaling in Drosophila neurogenesis. Dev. Biol. 192,585 -598.[CrossRef][Medline]
Shih, S. C., Katzmann, D. J., Schnell, J. D., Sutanto, M., Emr, S. D. and Hicke, L. (2002). Epsins and Vps27p/Hrs contain ubiquitin-binding domains that function in receptor endocytosis. Nat. Cell Biol. 4,389 -393.[CrossRef][Medline]
Siemering, K. R., Golbik, R., Sever, R. and Haseloff, J. (1996). Mutations that suppress the thermosensitivity of green fluorescent protein. Curr. Biol. 6,1653 -1663.[CrossRef][Medline]
Stowers, R. S. and Schwarz, T. L. (1999).
Genetic method for generating Drosophila eye composed exclusively of
mitotic clones of a single genotype. Genetics
152,1631
-1639.
Sun, X. and Artavanis-Tsakonas, S. (1996). The intracellular deletion of Delta and Serrate define dominant negative forms of the Drosphila Notch ligands. Development 122,2465 -2474.[Abstract]
Wendland, B. (2002). Epsins: adaptors in endocytosis? Nat. Rev. Mol. Cell Biol. 3, 971-977.[CrossRef][Medline]
Wendland, B., Steece, K. E. and Emr, S. (1999). Yeast epsins contain an essential N-terminal ENTH domain, bind clathrin and are required for endocytosis. EMBO J. 18,4384 -4393.
Wolff, T. and Ready, D. F. (1993). Pattern formation in the Drosophila retina. In The Development of Drosophila melanogaster, Vol. 2 (ed. M. Bate and A. Martinez Arias), pp. 1277-1325. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Wu, Z., Li, Q., Fortini, M. and Fischer, J. A. (1999). Genetic analysis of the role of the Drosophila fat facets gene in the ubiquitin pathway. Dev. Genet. 25,312 -320.[CrossRef][Medline]
Xu, T. and Rubin, G. M. (1993). Analysis of genetic mosaics in developing and adult Drosophila tissues. Development 117,1223 -1237.[Abstract]
Yeh, E., Zhou, L., Rudzik, N. and Boulianne, G. L. (2000). Neuralized functions cell autonomously to regulate Drosophila sense organ development. EMBO J. 19,4827 -4837.[CrossRef][Medline]
Yeh, E., Dermer, M., Commisso, C., Zhou, L., McGlade, C. J. and Boulianne, G. L. (2001). Neuralized functions as an E3 ubiquitin ligase during Drosophila development. Curr. Biol. 11,1675 -1679.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
L. A. Jolly, V. Taylor, and S. A. Wood USP9X Enhances the Polarity and Self-Renewal of Embryonic Stem Cell-derived Neural Progenitors Mol. Biol. Cell, April 1, 2009; 20(7): 2015 - 2029. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Butterworth, R. S. Edinger, R. A. Frizzell, and J. P. Johnson Regulation of the epithelial sodium channel by membrane trafficking Am J Physiol Renal Physiol, January 1, 2009; 296(1): F10 - F24. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Brady, Y. Wen, and T. J. O'Halloran The ENTH and C-terminal domains of Dictyostelium epsin cooperate to regulate the dynamic interaction with clathrin-coated pits J. Cell Sci., October 15, 2008; 121(20): 3433 - 3444. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. R. Gordon, K. L. Arnett, and S. C. Blacklow The molecular logic of Notch signaling - a structural and biochemical perspective J. Cell Sci., October 1, 2008; 121(19): 3109 - 3119. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Eun, S. M. L. Banks, and J. A. Fischer Auxilin is essential for Delta signaling Development, March 15, 2008; 135(6): 1089 - 1095. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Bajpe, J. A. van der Knaap, J. A. A. Demmers, K. Bezstarosti, A. Bassett, H. M. M. van Beusekom, A. A. Travers, and C. P. Verrijzer Deubiquitylating Enzyme UBP64 Controls Cell Fate through Stabilization of the Transcriptional Repressor Tramtrack Mol. Cell. Biol., March 1, 2008; 28(5): 1606 - 1615. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Koutelou, S. Sato, C. Tomomori-Sato, L. Florens, S. K. Swanson, M. P. Washburn, M. Kokkinaki, R. C. Conaway, J. W. Conaway, and N. K. Moschonas Neuralized-like 1 (Neurl1) Targeted to the Plasma Membrane by N-Myristoylation Regulates the Notch Ligand Jagged1 J. Biol. Chem., February 15, 2008; 283(7): 3846 - 3853. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Roca and R. H. Adams Regulation of vascular morphogenesis by Notch signaling Genes & Dev., October 15, 2007; 21(20): 2511 - 2524. [Abstract] [Full Text] [PDF] |
||||
![]() |
E.-A. Choe, L. Liao, J.-Y. Zhou, D. Cheng, D. M. Duong, P. Jin, L.-H. Tsai, and J. Peng Neuronal Morphogenesis Is Regulated by the Interplay between Cyclin-Dependent Kinase 5 and the Ubiquitin Ligase Mind Bomb 1 J. Neurosci., August 29, 2007; 27(35): 9503 - 9512. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Eun, K. Lea, E. Overstreet, S. Stevens, J.-H. Lee, and J. A. Fischer Identification of Genes That Interact With Drosophila liquid facets Genetics, March 1, 2007; 175(3): 1163 - 1174. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Traub and G. L. Lukacs Decoding ubiquitin sorting signals for clathrin-dependent endocytosis by CLASPs J. Cell Sci., February 15, 2007; 120(4): 543 - 553. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Commisso and G. L. Boulianne The NHR1 Domain of Neuralized Binds Delta and Mediates Delta Trafficking and Notch Signaling Mol. Biol. Cell, January 1, 2007; 18(1): 1 - 13. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mouchantaf, B. A. Azakir, P. S. McPherson, S. M. Millard, S. A. Wood, and A. Angers The Ubiquitin Ligase Itch Is Auto-ubiquitylated in Vivo and in Vitro but Is Protected from Degradation by Interacting with the Deubiquitylating Enzyme FAM/USP9X J. Biol. Chem., December 15, 2006; 281(50): 38738 - 38747. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Parks, J. R. Stout, S. B. Shepard, K. M. Klueg, A. A. Dos Santos, T. R. Parody, M. Vaskova, and M. A. T. Muskavitch Structure-Function Analysis of Delta Trafficking, Receptor Binding and Signaling in Drosophila Genetics, December 1, 2006; 174(4): 1947 - 1961. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Song, B.-K. Koo, K.-J. Yoon, M.-J. Yoon, K.-W. Yoo, H.-T. Kim, H.-J. Oh, Y.-Y. Kim, J.-K. Han, C.-H. Kim, et al. Neuralized-2 Regulates a Notch Ligand in Cooperation with Mind Bomb-1 J. Biol. Chem., November 24, 2006; 281(47): 36391 - 36400. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Millard and S. A. Wood Riding the DUBway: regulation of protein trafficking by deubiquitylating enzymes J. Cell Biol., May 22, 2006; 173(4): 463 - 468. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, L. M. Traub, K. M. Weixel, M. J. Hawryluk, N. Shah, R. S. Edinger, C. J. Perry, L. Kester, M. B. Butterworth, K. W. Peters, et al. Clathrin-mediated Endocytosis of the Epithelial Sodium Channel: ROLE OF EPSIN J. Biol. Chem., May 19, 2006; 281(20): 14129 - 14135. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Hagedorn, J. L. Bayraktar, V. R. Kandachar, T. Bai, D. M. Englert, and H. C. Chang Drosophila melanogaster auxilin regulates the internalization of Delta to control activity of the Notch signaling pathway J. Cell Biol., May 8, 2006; 173(3): 443 - 452. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Pitsouli and C. Delidakis The interplay between DSL proteins and ubiquitin ligases in Notch signaling Development, September 15, 2005; 132(18): 4041 - 4050. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Roegiers, L. Y. Jan, and Y. N. Jan Regulation of Membrane Localization of Sanpodo by lethal giant larvae and neuralized in Asymmetrically Dividing Cells of Drosophila Sensory Organs Mol. Biol. Cell, August 1, 2005; 16(8): 3480 - 3487. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wang and G. Struhl Distinct roles for Mind bomb, Neuralized and Epsin in mediating DSL endocytosis and signaling in Drosophila Development, June 15, 2005; 132(12): 2883 - 2894. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Lai, F. Roegiers, X. Qin, Y. N. Jan, and G. M. Rubin The ubiquitin ligase Drosophila Mind bomb promotes Notch signaling by regulating the localization and activity of Serrate and Delta Development, May 15, 2005; 132(10): 2319 - 2332. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Le Borgne, A. Bardin, and F. Schweisguth The roles of receptor and ligand endocytosis in regulating Notch signaling Development, April 15, 2005; 132(8): 1751 - 1762. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Chen and P. De Camilli From the Cover: The association of epsin with ubiquitinated cargo along the endocytic pathway is negatively regulated by its interaction with clathrin PNAS, February 22, 2005; 102(8): 2766 - 2771. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Tian, D. Hansen, T. Schedl, and J. B. Skeath Epsin potentiates Notch pathway activity in Drosophila and C. elegans Development, December 1, 2004; 131(23): 5807 - 5815. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||