DEV01405 Supplementary Material

Files in this Data Supplement:

• Supplemental Figure 1 -

  Fig. S1. Backcross mapping of rs. (A) Haplotype data from 461 backcross animals segregating for rs. All animals are genotyped for D6Mit374 and D6Mit339, and phenotyped for rs. Recombinants between D6Mit374 and D6Mit339 are further genotyped for internal markers Lrp6 and D6Mit301. Genotyping for Lrp6 was carried out based on the C to T transition at nucleotide 2741 (see Fig, 4). (B) A graphical map of distal mouse chromosome 6 (the centromere towards the top and the telomere towards the bottom) shows the relative locations of the markers mapped in this study. The genetic distances are given in centi-Morgan (cM). Primer sets for microsatellite loci were purchased from Research Genetics. PCR amplification for microsatellite markers was carried out as previously described (Imai et al., 1993). Haplotype data were analyzed by using MapManager (Manly and Olson, 1999).

• Supplemental Figure 2 -

  Fig. S2. Co-expression of Lrp5 and Lrp6 in mouse embryonic fibroblasts. Total RNA was extracted from primary mouse embryonic fibroblasts established from wild-type (+/+), heterozygous (+/–) and homozygous (–/–) embryos. RT-PCR for detecting spliced transcripts of Lrp5 and Lrp6 were carried out with the primers as follows: L5F1, CTGTGGCTGTGCTTCACACT; L5R1, ATGAGGCCTGTGGTGAAGAG (for exon 19-22 of Lrp5); L6F1, ACAGAGCCCTGACATCATCC; L6R1, AGTCAGCCCAGAAGAGCTTG (for exon 13-15 of Lrp6); beta-actinF, TGGGAATGGGTCAGAAGGACTC; beta-actinR, AGAGGCATACAGGGACAGCACA (for exon 3-4 of beta-actin).