|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online October 27, 2004
doi: 10.1242/10.1242/dev.01417

1 Vertebrate Development Laboratory, Cancer Research UK London Research
Institute, 44 Lincoln's Inn Fields, London WC2A 3PX, UK
2 Vertebrate Functional Proteomics Laboratory, Wellcome Trust Sanger Institute,
Cambridge CB10 1SA, UK
Author for correspondence (e-mail:
julian.lewis{at}cancer.org.uk)
Accepted 23 August 2004
| SUMMARY |
|---|
|
|
|---|
Key words: DeltaD, DeltaC, MAGI proteins, Notch, PDZ domains, Zebrafish, Morpholino, Rohon-Beard neurons
| Introduction |
|---|
|
|
|---|
From this perspective, it might seem that the only part of the ligand that really matters is the part that binds to Notch. There are, however, strong grounds for believing that the intracellular domains of Notch ligands are functionally important. The Delta subfamily has attracted most attention in this respect and is our concern in this paper. There are four main lines of evidence, to which the present study adds a fifth.
First, when the intracellular (C-terminal) domain of Delta is truncated,
the protein acquires a powerful dominant-negative effect, blocking Notch
signalling in cis (Chitnis et al.,
1995
; Haddon et al.,
1998
; Henrique et al.,
1997
; Sun and
Artavanis-Tsakonas, 1996
). The cell expressing the truncated Delta
protein is thereby made insensitive to Notch-activating signals from its
neighbours (Henrique et al.,
1997
; Sakamoto et al.,
2002
). It is not clear how the intracellular domain of Delta
influences this effect.
Second, the intracellular domain of Delta contains sites for
ubiquitination, and this is crucial for Delta function
(Itoh et al., 2003
;
Lai et al., 2001
;
Pavlopoulos et al., 2001
;
Yeh et al., 2000
). The
ubiquitination promotes internalization of Delta, targets Delta for
degradation in proteasomes, and, most importantly, is required in order to
enable Delta to activate Notch. The effect operates in trans, affecting the
ability of the cell to deliver a signal to its neighbours, and it is distinct
from the dominant-negative cis effect described above, which is independent of
ubiquitination (Itoh et al.,
2003
).
Third, recent work has shown that the Notch ligands, like Notch itself, are
cleaved, releasing an intracellular fragment. This may have a function in the
nucleus as a transcriptional regulator
(Ikeuchi and Sisodia, 2003
;
LaVoie and Selkoe, 2003
;
Six et al., 2003
).
The fourth line of evidence for importance of the intracellular domain of
Delta comes from sequence comparisons among the vertebrates: within this
group, it is highly conserved (although it shows no detectable conservation
between vertebrates and insects). For example, the Delta1 (DLL1) protein of
humans has an intracellular domain that is 67% identical to that of chick
Delta1, 61% identical to that of Xenopus X-Delta1 and 56% identical
to that of zebrafish DeltaD. In all vertebrates, and in at least one
echinoderm (Sweet et al.,
2002
), we find a subset of Delta proteins that share a conserved
motif ATEV* at their C terminus. This motif fits
the consensus for a PDZ-domain-binding protein (Nourry et al., 2003;
Songyang et al., 1997
). The
ATEV subset of Delta proteins includes Delta1 and Delta4 in mammals and birds,
Delta1 and Delta2 in Xenopus, and DeltaC and DeltaD in zebrafish.
From their expression patterns, it seems that the ATEV Deltas have some
functions in common that set them apart from other vertebrate Deltas that lack
this motif. They are expressed in endothelial cells of blood vessels
(Beckers et al., 1999
;
Mailhos et al., 2001
;
Shutter et al., 2000
;
Smithers et al., 2000
), in the
gut epithelium (Schroder and Gossler,
2002
) (M. Skipper, G.J.W., L.A.-M. and C. Crosnier, unpublished),
and in the presomitic mesoderm, where they play an essential part in the
oscillator mechanism that controls somite segmentation
(Davis et al., 2001
;
Holley et al., 2002
;
Hrabé de Angelis et al.,
1997
; Jen et al.,
1997
; Jiang et al.,
2000
).
On the other hand, the ATEV motif is not required for the core function of
Delta proteins in the central nervous system (CNS) as mediators of lateral
inhibition during neurogenesis: all members of the vertebrate Delta family
seem to share this activity (e.g. Haddon
et al., 1998
), regardless of whether or not they possess a
terminal ATEV. Moreover, removal of the ATEV is not sufficient to confer
dominant-negative activity: in the chick retina, a version of Delta1 with a
mild C-terminal truncation, removing the ATEV motif along with 96 adjacent
amino acids, still showed normal function, activating Notch and delivering
lateral inhibition; only with a more severe truncation, eliminating all but 13
amino acids of the intracellular domain, was a dominant-negative effect seen
(Henrique et al., 1997
).
What then is the function of the ATEV motif? In this paper we show that it
mediates binding to MAGI proteins (MAGUK proteins with inverted domain
arrangement) a subset of the MAGUK (membrane-associated guanylate
kinase homolog) protein family through a specific one of the six PDZ
domains that these contain. A similar conclusion has recently been reached
independently by another group (Pfister et
al., 2003
), who have shown that the mouse Delta1 protein binds
through its C terminus to Acvrinp-1, also known as MAGI2. Our data demonstrate
that in fact all three members of the MAGI protein family can bind ATEV Delta
proteins in this way. We show that MAGI1 is widely expressed in the developing
zebrafish embryo, and that it co-localizes with DeltaD at a subcellular level
if and only if the ATEV motif is intact. We find, furthermore, that disruption
of the DeltaD-MAGI interaction leaves Delta-Notch signalling practically
unaffected; but it appears to alter the migratory behaviour of some neurons in
the embryonic neural tube.
| Materials and methods |
|---|
|
|
|---|
Isolation of binding partners of Delta proteins
We used a modification of the protocol of Hutchings et al.
(Hutchings et al., 2003
). A
peptide corresponding to the C-terminal 27 residues of human Delta1 was
chemically synthesized containing an N-terminal biotin and aliphatic spacer.
Peptide-saturated streptavidin-coated paramagnetic beads (Dynabeads®
M-280, DYNAL®) were added to an adult mouse brain lysate [0.1 g wet weight
per ml of WOP-40 buffer (Wright et al.,
2000
)]. The brains were crudely chopped in buffer and solubilized
using a dounce homogenizer at 4°C. Insoluble material was removed by
centrifugation at 400 g and the supernatant filtered. The
beads were recovered with a magnet after an overnight rotating incubation at
4°C, and washed; associated proteins were eluted by boiling in SDS loading
buffer.
Mass spectrometry
Samples were resolved on 4-12% Bis-Tris NuPAGETM precast gels and
stained using SYPRO Orange dye (BIO-RAD) and scanned on a STORM 860
phosphoimager (Molecular Dynamics). Gels were then Coomassie stained and bands
excised with a scalpel. Gel slices were destained and digested with 100-200 ng
of trypsin for 4 hours at 37°C. Peptides were extracted and analysed by
MALDI on a Tof Spec 2E (Micromass).
Morpholino and mRNA injections
Injected reagents were diluted in Danieau buffer
(Nasevicius and Ekker, 2000
)
containing 0.2% phenol red and 2-4 nl were injected into the yolk of 1- to
4-cell stage embryos. Morpholino sequences (GeneTools) are: for Delta splicing
(MO[dlD-V]): GGTTTTGGACTTACCTCGGTTGCAA, with mismatch control
GcTTTTcGACTTAgCTCGcTTcCAA; and for MAGI1 translation blocking (MO[MAGI1]):
CACAGAAACAGGTGGCTCCGCTGAC (FITC-labelled). The MAGI-GFP fusion was made in
pEGFP-N1 (Clontech) with the introduction of a linker (the protein product
contains the sequences VFTP-GGVPRARDPPVAT-MVSK, where the first four and last
four amino acids correspond to the C terminus of MAGI1 and N-terminus of EGFP
respectively). The coding regions were then subcloned into the pCS2+ vector
and mRNA was made using the mMessage mMachine kit (Ambion). For
immunohistochemistry, embryos were dechorionated, fixed and stained with zdd2
anti-DeltaD monoclonal antibody and Alexa594-conjugated secondary antibody
(Molecular Probes) as previously described
(Itoh et al., 2003
).
MAGI1-EGFP was detected with Alexa488-conjugated rabbit anti-GFP antibody
(Molecular Probes). Stained embryos were flat-mounted on slides in Citifluor
mounting medium (Citifluor) and examined with a Zeiss LSM510 confocal
microscope.
For analysis of phenotypes in the living state, embryos were anaesthetized, mounted in 3% methyl cellulose, and photographed on a Leitz Diaplan microscope.
PDZ domain binding biochemistry
Sequences (available on request) corresponding to the six individual PDZ
domains of zebrafish MAGI1 were amplified and cloned in-frame with a
C-terminal 6 histidine tag in pET-23b and expressed in the E. coli
strain BL21(DE3)pLysS. Proteins were purified using Nickel-NTA Agarose
(Qiagen) using minor modifications to the manufacturer's protocols and stored
at 70°C.
Biotinylated peptides corresponding to the C-terminal 27 or 26 amino acids of zebrafish DeltaC and D were synthesized as above, both with, and without, the C-terminal valine residue. 200 µl of streptavidin-coated Sepharose (Amersham Biosciences) was saturated with peptides corresponding to zebrafish DeltaC or D and divided equally into six aliquots; 12 µg of purified zfMAGI1 PDZ domains were added per tube and incubated with rotation at 4°C for 2 hours, washed and eluted by adding SDS-PAGE loading buffer and heating to 50°C for 10 minutes. Eluates were resolved by SDS-PAGE on 4-12% NuPAGE gels using MES running buffer. Gels were stained with SYPRO orange as above.
In situ hybridization
Wholemount in situ hybridization followed the protocol of Thisse
(Westerfield, 2000
) or of
Ariza-McNaughton and Krumlauf
(Ariza-McNaughton and Krumlauf,
2002
). DIG-labelled antisense probes for zebrafish MAGI
corresponded to nucleotides 3018 to 3530 of the magi1 cDNA sequence.
Probes for islet1 (Inoue et al.,
1994
), col2a1 (Yan et
al., 1995
) and myoD
(Weinberg et al., 1996
) were
as previously described.
PCR and cloning procedures
Total RNA was extracted from embryos using Trizol (GIBCO-BRL) according to
the manufacturer's instructions and cDNA made according to Wright et al.
(Wright et al., 2000
). The
primers used to detect the splicing forms of zebrafish deltaD were
AGCTGAAGCAGGAGGACTTG (sense) and CTTCAGTTGAGAACCAGCTCATT (antisense), usually
for 30 PCR cycles. The altered splice forms were characterized by cloning and
sequencing.
The full-length zebrafish magi1 cDNA was cloned by both 5' and 3' RACE using SMART RACE kit (Clontech) following the manufacturer's protocols using 24 hour zebrafish cDNA and oligonucleotides based on the zebrafish EST sequence number AW078333. The full-length zebrafish magi1 cDNA has been submitted to GenBank (Accession number AY465352).
Cell culture, transfection, and immunocytochemistry
HEK293T cells grown on coverslips were transiently transfected with 1 µg
of plasmid DNA per well in a 24-well plate using Superfect Transfection
Reagent (Qiagen). Twenty-four hours after transfection, cells were rinsed in
PBS and fixed in 4% formaldehyde in PBS for 15 minutes at room temperature.
Fixed cells were permeabilized in 0.2% Triton X-100 in PBS for 15 minutes at
room temperature, rinsed in PBS, and incubated in blocking solution (1% BSA in
PBS) for 30 minutes at room temperature. Cells were then stained with zdd2
antibody, essentially as in Itoh et al.
(Itoh et al., 2003
).
Coverslips were mounted on slides in Citifluor (Citifluor) and examined with a
Zeiss LSM510 confocal microscope.
| Results |
|---|
|
|
|---|
|
Regarding the other Delta-binding proteins we identified, MUPP1, like the MAGI proteins, is a membrane-associated scaffold protein, containing no less than 13 PDZ domains; it too may recognize the C-terminal ATEV of Delta1. Meprin A is more puzzling: meprins are transmembrane or secreted proteins that normally act extracellularly as metallopeptidases. In our assay, they may have been detected because they bound to the Delta1 C-terminal peptide as a (non-physiological) substrate, or because they were attached to it indirectly via some scaffold protein such as MAGI1/2/3 or MUPP1. The zinc finger protein we detected is one for which no function is yet known.
The MAGI protein family is highly conserved between fish and mammals
For further analysis of the interactions of Delta proteins with MAGI
proteins, we have used the zebrafish. A BLAST search for counterparts of human
MAGI1, -2 and -3 in the Ensembl zebrafish cDNA database
reveals one MAGI1 ortholog, two MAGI2 orthologs, and one
MAGI3 ortholog. We shall call the corresponding four zebrafish genes
magi1, magi2a, magi2b, and magi3. The orthology
relationships can be inferred from the percent amino-acid identity when
corresponding domains are compared; Table
1 shows values based on PDZ domain 4 (PDZ4). From the sequence
comparisons, it seems that the ancestral MAGI1, -2 and -3
genes must have diverged from one another before the divergence of the fish
and tetrapod lineages, while divergence of the zebrafish magi2a and
magi2b genes may have occurred after this.
|
magi1 is widely expressed in the developing zebrafish, becoming most plentiful in the CNS
As a first step towards analysis of the Delta-MAGI interaction in vivo, we
examined the expression of magi1, to see whether it overlaps with
that of deltaC and deltaD. We used RT-PCR to assess the time
course of early expression of magi1
(Fig. 2A). The message is
present already in the egg at 0 hours post-fertilization (hpf), has largely
disappeared by 3 hpf, but is plentiful again by 6 hpf. This presumably
reflects degradation of maternal message followed by a delay of a few hours
before zygotic transcripts accumulate. Since the primary transcript is very
long (>160 kb), there will presumably be an interval of 2 hours or more
(assuming transcription at 1.2 kb/minute) from the initiation of zygotic
transcription at 2.5-3 hpf until mature mRNA reaches the cytoplasm.
Transcription of deltaC and deltaD begins to be seen by in
situ hybridization at 5-6 hpf (Haddon et
al., 1998
; Smithers et al.,
2000
). Thus MAGI1 becomes available to interact with the Delta
proteins at about the time of their first appearance.
|
The C termini of DeltaC and DeltaD bind directly and specifically to PDZ4 of MAGI1
Previous studies (see Data S1 in supplementary material) have shown that
the different PDZ (and other) domains in MAGI proteins selectively bind
different partners. To understand the place that DeltaC and DeltaD might have
in protein complexes held together by MAGI1, and to test whether the Delta
proteins indeed bind to MAGI1 directly, we examined the binding of
artificially synthesized fragments of the proteins in vitro. Peptides
corresponding to the C-terminal 26 or 27 amino acids of DeltaC and DeltaD were
synthesized chemically. We prepared two variants of each one with and
the other, as a control, without the terminal valine. We also prepared
individual His-tagged proteins corresponding to each of the six PDZ domains
(
100 amino acids) of zebrafish MAGI1. The Delta peptides, as before, were
prepared with an N-terminal biotin to allow coupling to streptavidin-coated
beads, and the individual PDZ domains were then assayed for their ability to
bind to these. As shown in Fig.
3A, the C termini of DeltaC and DeltaD both bind selectively to
PDZ4, with only a faint trace of binding to other PDZ domains. No binding is
seen when the Delta peptides lack their terminal valine. We conclude that PDZ4
selectively and directly binds the Delta proteins through a typical PDZ-domain
interaction that depends on the terminal valines of these proteins. Since PDZ4
is conserved and distinctive in all members of the MAGI protein family, it is
likely that in all of them it is responsible for binding the ATEV Deltas in
the same valine-dependent way.
|
To see whether DeltaD and MAGI1 proteins interact in the living embryo, we
injected mRNA coding for MAGI1-EGFP into 2- to 4-cell-stage zebrafish embryos
and compared the subcellular localization of the tagged MAGI1 to that of
endogenous DeltaD at the 10-14 somite stage. DeltaD protein in uninjected
embryos has a different intracellular distribution in different cell types: in
nascent neurons, cell surface concentrations are below the threshold of
detection with our zdd2 antibody, and the protein is seen only in
intracellular granules (Itoh et al.,
2003
); in cells in the anterior parts of somites, DeltaD is
detected in a spotty distribution at or near the cell surface (L.A.-M. and
François Giudicelli, unpublished). This DeltaD pattern was maintained
in embryos injected with the MAGI1-EGFP construct. Although, in these injected
embryos, there was no detectable co-localization of MAGI1-EGFP with the
intracellular DeltaD granules of the nascent neurons, the MAGI1-EGFP was
frequently co-localized with the cell-surface DeltaD of the somite cells
(Fig. 3D), suggesting that
MAGI1 and DeltaD interact at the cell surface in the intact zebrafish embryo
just as they do in cultured HEK293T cells
(Fig. 3B). It should be noted
that spots of DeltaD without MAGI1 and of MAGI1 without DeltaD were also seen,
presumably reflecting the fact that DeltaD is only one of many MAGI1-binding
partners (Fig. 1, see Data S1
in supplementary material) and that the levels of MAGI1 protein generated upon
mRNA injection may be much higher than endogenous levels.
A splice-blocking morpholino can be used to deprive DeltaD of its terminal valine in vivo
We have shown that the terminal valine of DeltaC and DeltaD is required for
binding to MAGI1. Removal of this valine should therefore provide a way to
test the functional importance of the Delta-MAGI interaction while causing
minimal disruption of other processes. By good fortune, the terminal valine of
the ATEV Delta proteins is encoded on a separate exon. We were thus able to
remove it in vivo by blocking the splicing reaction that links this exon to
the rest. For this, we used a morpholino, which we shall call MO[dlD-V],
complementary to the exon/intron junction on the 5' side of the intron
preceding the exon that encodes the terminal valine
(Fig. 4A). A BLAST search of
the zebrafish genome database indicated that this was the only target site for
the morpholino. We injected varying doses of MO[dlD-V] into fertilized eggs at
the one-cell stage, left them to develop as far as 6, 24, 48 or 72 hpf, and
used RTPCR to discover what splice variants of deltaD mRNA were
present. As shown in Fig. 4B, 0.5 ng of MO[dlD-V] was sufficient to give a marked reduction in the amount of
the normally spliced mRNA, and with 5 ng or more, this form was undetectable,
implying that no DeltaD was being produced with a terminal valine. The block
was still fully effective as late as 72 hpf
(Fig. 4C). The predominant mRNA
instead was a mis-spliced variant with the subterminal intron retained, so as
to code for a protein whose terminal valine was replaced by a sequence of 34
amino acids ending in LVLN*.
|
Specific and non-specific effects of the DeltaD splice-blocking morpholino can be distinguished by analysis of aei/deltaD mutants
To test the functional significance of the DeltaD-MAGI1 interaction, we
examined the phenotype of the embryos that developed from eggs injected with 5
ng of MO[dlD-V], so that the only forms of DeltaD produced would be lacking
their terminal valine.
At a gross anatomical level, the injected embryos showed clear and
reproducible abnormalities in the hindbrain and midbrain, such that at 24 hpf,
the width of the roofplate and the lumen of the third and fourth ventricles of
the neural tube were markedly reduced (Fig.
5A,B, Table 2). A
similar narrowed-ventricle effect was seen when we injected a morpholino
(MO[MAGI1]) targeted against the translational start of MAGI1
(Fig. 5C), whereas injection of
other morpholinos, including a five base-pair mismatch control for MO[dlD-V],
did not produce this phenotype (data not shown,
Table 2). These findings
strongly suggested that the anatomical abnormality was a specific effect of
disrupting the DeltaDMAGI1 interaction. Similar structural abnormalities have,
however, been seen as an effect of morpholino mistargeting
(Ekker and Larson, 2001
), and
they are not easily explainable in terms of known functions of DeltaD or
MAGI1. Spurred on by the doubts of a referee, we therefore performed a
further, and more decisive, control experiment.
|
|
Disruption of the DeltaD-MAGI interaction does not significanly affect the known functions of DeltaD as a Notch ligand
The aeiAR33 mutant is useful not only as a negative but
also as a positive control, displaying defects that result from loss of
DeltaD: somite segmentation is disrupted
(Holley et al., 2002
;
Jiang et al., 2000
;
van Eeden et al., 1996
);
primary neurons are produced in excessive numbers in the embryonic CNS
(Holley et al., 2000
); and the
numbers of hypochord (ventral midline) cells are reduced
(Latimer et al., 2002
). These
abnormalities have been well documented and reflect the functions of DeltaD as
a Notch ligand. To see whether the DeltaD-MAGI interaction is important for
these functions, we compared wild-type and aeiAR33 mutant
embryos with genetically normal embryos that were injected with MO[dlD-V].
First of all, somite patterning appeared normal in the MO[dlD-V] injected
embryos, with no sign of the disruption of somite segmentation that is seen in
aei and in other Notch pathway loss-of-function mutants
(Fig. 5F-H)
(Holley et al., 2002
;
Jiang et al., 2000
;
van Eeden et al., 1996
).
Our findings with regard to hypochord formation were similar. Defects in
hypochord formation are readily observed in aei/deltaD mutants as
well as deltaA loss-of-function mutants and morpholino-induced DeltaC
knock-down embryos (Appel et al.,
1999
; Latimer et al.,
2002
); the phenotype can be seen by in situ hybridization with a
probe for alpha-1 collagen type II (col2a1) which labels the
floor plate and hypocord (Yan et al.,
1995
). Using this method, we saw a reduction in hypochord cell
number in aeiAR33 embryos, as expected. However, we
detected only a slight increase in hypochord defects in wild-type embryos
treated with MO[dlDV] (Fig.
5I-K). Moreover, we observed no effect of MO[dlDV] treatment on
expression of her4 or ntl (data not shown); these genes are
both regulated her4 positively and ntl negatively
by Delta-Notch signalling during normal hypochord development
(Latimer et al., 2002
). These
findings indicate that the DeltaD-MAGI1 interaction is not important for the
function of DeltaD as a Notch ligand in specification of the hypochord.
Lastly, Delta-Notch signalling, mediating lateral inhibition, is well known
to regulate the proportion of cells committed to differentiate as neurons
(Appel and Eisen, 1998
;
Chitnis et al., 1995
;
Haddon et al., 1998
), and this
is reflected in the phenotype of aei/deltaD mutants, which produce
neurons in excess (Holley et al.,
2000
). If interaction with MAGI1 is important for DeltaD's
function in lateral inhibition, we would expect to see alterations in
neurogenesis when the interaction is blocked. We therefore counted neurons, at
the 12-16 somite stage, in genetically wild-type embryos injected with
MO[dlDV] and in uninjected controls, using in situ hybridization for
islet1 as a neuronal marker
(Haddon et al., 1998
;
Korzh et al., 1993
). We found
that the MO[dlD-V] injection produced little or no change in the number of
islet1-positive cells. In contrast, aeiAR33
mutants showed a 1.6-fold increase (Fig.
6A-E). Specifically, in the dorsal neural tube, in the region
corresponding to the middle five somites, we counted 28.3±0.6
(mean±s.e.m., n=10) islet1-positive neurons per
wild-type embryo, 32.8±1.3 (n=13) per MO[dlD-V]-injected
wild-type embryo, 45.3±1.7 (n=10) per
aeiAR33 embryo, and 46.2±1.1 (n=13) per
aeiAR33 embryo injected with MO[dlD-V]. We conclude that
the DeltaD-MAGI interaction has very little influence on the function of
DeltaD in the regulation of neuronal commitment.
|
| Discussion |
|---|
|
|
|---|
Morpholino experiments require stringent controls
To discover what the function of the interaction might be, we exploited a
morpholino, MO[dlD-V], which, when injected into the early zebrafish embryo,
specifically blocks the interaction by interfering with the splicing of the
deltaD message so as to alter the C terminus of the DeltaD protein.
In any morpholino experiment, however, there is a possibility that
non-specific side-effects may also be produced. In our system, we were indeed
initially misled. We saw a marked narrowing of the third and fourth ventricles
of the neural tube in embryos injected with MO[dlD-V], performed several
controls of the sort that are conventionally done to check specificity of
morpholino action, and concluded that the ventricle abnormality was a specific
effect of disruption of the DeltaDMAGI interaction. Fortunately, a
deltaD loss-of-function mutant, aei, was available and
allowed us to perform a more stringent control experiment. This showed
convincingly that the ventricle abnormality was after all a non-specific
side-effect of the morpholino. We offer this cautionary tale as a footnote to
our other findings: it may serve as a warning of the risks of misinterpreting
morpholino experiments, where often there is no mutant available to provide a
stringent test for non-specific side-effects.
Delta-Notch signalling appears to be independent of the Delta-MAGI interaction
DeltaD has several well-characterized roles in Notch signaling, clearly
revealed in the deltaD loss-of-function mutant aei, where
disorders are seen in somitogenesis, hypochord formation, and neurogenesis
(Holley et al., 2000
;
Jiang et al., 2000
;
Latimer et al., 2002
;
van Eeden et al., 1996
). Upon
disruption of the DeltaD-MAGI interaction, however, these processes are
largely unaffected. The fact that this treatment does not phenocopy
aei indicates that the interaction of DeltaD with MAGI proteins is
not important for the function of DeltaD as an activating ligand for Notch, at
least in these processes. This finding is perhaps not surprising given that,
as explained in the Introduction, several forms of Delta protein lacking the
MAGI-binding motif are already known to be effective Notch ligands.
The Delta-MAGI interaction may be important in the control of neuron migration
In assaying neurogenesis in embryos injected with MO[dlDV] to block
DeltaD-MAGI interaction, we observed a mis-localization of Rohon-Beard sensory
neurons, which frequently strayed into the dorsal midline of the neural tube
a phenomenon rarely seen in wild-type or aei embryos. This
effect needs further investigation, but it suggests that the DeltaD-MAGI
interaction is important in some way either in determining the site of
production of the neurons, or in governing their migratory behaviour as they
move away from their birthplace.
We are attracted by the latter possibility, since other studies have
reported effects of Delta protein on cell motility: in particular, De
Joussineau et al. (De Joussineau et al.,
2003
) found that Delta in Drosophila sense-organ
precursor cells promoted extension of filopodia, while Lowell and Watt
(Lowell and Watt, 2001
) found
that mammalian keratinocytes showed enhanced motility when they expressed a
truncated form of Delta1 lacking most of the intracellular domain (including
the ATEV motif), but showed reduced motility when they expressed full-length
Delta1. This latter pair of observations is consistent with what we saw in the
zebrafish embryo: the mis-localization of the Rohon-Beard neurons suggests
that they became abnormally motile when their DeltaD protein was deprived of
the C-terminal motif that mediates binding to MAGI proteins. If this
interpretation is correct, the implication would be that free Delta protein
favours motility, and that this action of Delta is inhibited by the binding of
Delta to MAGI.
The above account supposes that Delta and MAGI influence motility directly
(cell-autonomously) in the cells that express them. An alternative possibility
is that these proteins influence the ability of cells to serve as a substratum
for the movement of other cells: it could be that cells expressing DeltaD that
is not bound to MAGI encourage the Rohon-Beard neurons to move over them,
while cells expressing DeltaD that binds to MAGI protein do not. This
suggestion has an echo in the nagie oko (nok) zebrafish,
where there is a mutation in a MAGUK scaffolding protein that is, a
protein related to the MAGI family. In this mutant, the polarity of the
retinal epithelium is disrupted and the migrations of neurons within it are
disordered, apparently in consequence of the neuroepithelial polarity defect
(Wei and Malicki, 2002
). Gray
et al. (Gray et al., 2001
)
have also reported similar phenomena: they find that mutation of
des/notch1a alters the migration of neural crest cells and has a
non-cell-autonomous effect on axon outgrowth.
Whichever of these interpretations is correct, there are many possibilities
for the detailed molecular mechanism. Delta and Delta-MAGI complexes could
have direct effects on the adhesive or locomotor properties of the cell
surface or actin cortex (Lowell and Watt,
2001
); they could influence motility by binding (or failing to
bind) to Notch on neighbouring cells
(Franklin et al., 1999
); or
they could regulate gene expression cell-autonomously to exert their effects.
This last possibility is suggested by recent studies
(Ikeuchi and Sisodia, 2003
;
LaVoie and Selkoe, 2003
;
Six et al., 2003
) showing
that, like Notch, Delta itself can be cleaved to release an intracellular
fragment that can enter the nucleus and act as a gene-regulatory protein. MAGI
proteins could influence such a reverse signalling activity of ATEV Deltas by
regulating their cleavage or their translocation to the nucleus.
Conclusion
As Notch ligands, the Delta proteins play a central part in the development
and maintenance of a great variety of tissues in the vertebrate body. We have
established that a conserved subset of the Delta family the ATEV
Deltas interact through their intracellular tails with the MAGI family
of scaffolding proteins, not only in vitro but also in the living embryo. The
interaction does not appear to be critical for Delta-Notch signalling, and yet
its evolutionary conservation implies that it must have an important
physiological function. The challenge is to discover what that function is.
The MAGI proteins, with their multiple PDZ and other protein-recognition
domains, have an extraordinary variety of binding partners, as listed in Data
S1 (see supplementary material), and could mediate cross-talk between the
Delta-Notch pathway and many other pieces of intracellular or extracellular
machinery. MAGI may exert important effects on cell behaviour by influencing
the location of Delta, or Delta may do so by influencing the location of MAGI.
In this paper we have excluded some possible roles of the Delta-MAGI
interaction and found preliminary evidence for an effect on cell positioning;
further experiments will be needed to explore its functional significance
fully.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/131/22/5659/DC1
* These authors contributed equally to this work ![]()
| REFERENCES |
|---|
|
|
|---|
Appel, B. and Eisen, J. S. (1998). Regulation
of neuronal specification in the zebrafish spinal cord by Delta function.
Development 125,371
-380.[Abstract]
Appel, B., Fritz, A., Westerfield, M., Grunwald, D. J., Eisen,
J. S. and Riley, B. B. (1999). Delta-mediated
specification of midline cell fates in zebrafish embryos. Curr.
Biol. 9,247
-256.[CrossRef][Medline]
Ariza-McNaughton, L. and Krumlauf, R. (2002).
Non-radioactive in situ hybridization: simplified procedures for use in
whole-mounts of mouse and chick embryos. Int. Rev.
Neurobiol. 47,239
-250.[Medline]
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J.
(1999). Notch signaling: cell fate control and signal integration
in development. Science
284,770
-776.
Beckers, J., Clark, A., Wunsch, K., Hrabe De Angelis, M. and
Gossler, A. (1999). Expression of the mouse Delta1 gene
during organogenesis and fetal development. Mech. Dev.
84,165
-168.[CrossRef][Medline]
Chitnis, A., Henrique, D., Lewis, J., Ish-Horowicz, D. and
Kintner, C. (1995). Primary neurogenesis in Xenopus
embryos regulated by a homologue of the Drosophila neurogenic gene Delta [see
comments]. Nature 375,761
-766.[CrossRef][Medline]
Davis, R. L., Turner, D. L., Evans, L. M. and Kirschner, M.
W. (2001). Molecular targets of vertebrate segmentation: two
mechanisms control segmental expression of Xenopus hairy2 during somite
formation. Dev. Cell 1,553
-565.[CrossRef][Medline]
De Joussineau, C., Soule, J., Martin, M., Anguille, C.,
Montcourrier, P. and Alexandre, D. (2003). Delta-promoted
filopodia mediate long-range lateral inhibition in Drosophila.
Nature 426,555
-559.[CrossRef][Medline]
Ekker, S. C. and Larson, J. D. (2001). Morphant
technology in model developmental systems. Genesis
30, 89-93.[CrossRef][Medline]
Franklin, J. L., Berechid, B. E., Cutting, F. B., Presente, A.,
Chambers, C. B., Foltz, D. R., Ferreira, A. and Nye, J. S.
(1999). Autonomous and non-autonomous regulation of mammalian
neurite development by Notch1 and Delta1. Curr. Biol.
9,1448
-1457.[CrossRef][Medline]
Gray, M., Moens, C. B., Amacher, S. L., Eisen, J. S. and
Beattie, C. E. (2001). Zebrafish deadly seven functions in
neurogenesis. Dev. Biol.
237,306
-323.[CrossRef][Medline]
Haddon, C., Smithers, L., Schneider-Maunoury, S., Coche, T.,
Henrique, D. and Lewis, J. (1998). Multiple
delta genes and lateral inhibition in zebrafish primary neurogenesis.
Development 125,359
-370.[Abstract]
Henrique, D., Hirsinger, E., Adam, J., Le Roux, I.,
Pourquié, O., Ish-Horowicz, D. and Lewis, J. (1997).
Maintenance of neuroepithelial progenitor cells by Delta-Notch signaling in
the embryonic chick retina. Curr. Biol.
7, 661-670.[CrossRef][Medline]
Holley, S. A., Geisler, R. and Nusslein-Volhard, C.
(2000). Control of her1 expression during zebrafish somitogenesis
by a delta-dependent oscillator and an independent wave-front activity.
Genes Dev. 14,1678
-1690.
Holley, S. A., Julich, D., Rauch, G. J., Geisler, R. and
Nusslein-Volhard, C. (2002). her1 and the notch
pathway function within the oscillator mechanism that regulates zebrafish
somitogenesis. Development
129,1175
-1183.
Hrabé de Angelis, M., McIntyre, J. and Gossler, A.
(1997). Maintenance of somite borders in mice requires the
Delta homologue DII1. Nature
386,717
-721.[CrossRef][Medline]
Hruska-Hageman, A. M., Benson, C. J., Leonard, A. S., Price, M.
P. and Welsh, M. J. (2004). PSD-95 and Lin-7b interact
with ASIC3 and have opposite effects on H+-gated current. J. Biol.
Chem. (in press).
Hutchings, N. J., Clarkson, N., Chalkley, R., Barclay, A. N. and
Brown, M. H. (2003). Linking the T cell surface
protein CD2 to the actin-capping protein CAPZ via CMS and CIN85. J.
Biol. Chem. 278,22396
-22403.
Ikeuchi, T. and Sisodia, S. S. (2003). The
Notch ligands, Delta1 and Jagged2, are substrates for presenilin-dependent
"gamma-secretase" cleavage. J. Biol. Chem.
278,7751
-7754.
Inoue, A., Takahashi, M., Hatta, K., Hotta, Y. and Okamoto,
H. (1994). Developmental regulation of islet-1 mRNA
expression during neuronal differentiation in embryonic zebrafish.
Dev. Dyn. 199,1
-11.[Medline]
Itoh, M., Kim, C. H., Palardy, G., Oda, T., Jiang, Y. J., Maust,
D., Yeo, S. Y., Lorick, K., Wright, G. J., Ariza-McNaughton, L. et
al. (2003). Mind bomb Is a ubiquitin ligase that Is essential
for efficient activation of Notch signaling by Delta. Dev.
Cell 4,67
-82.[CrossRef][Medline]
Jen, W. C., Wettstein, D., Turner, D., Chitnis, A. and Kintner,
C. (1997). The Notch ligand, X-Delta-2, mediates segmentation
of the paraxial mesoderm in Xenopus embryos.
Development 124,1169
-1178.[Abstract]
Jiang, Y. J., Aerne, B. L., Smithers, L., Haddon, C.,
Ish-Horowicz, D. and Lewis, J. (2000). Notch
signalling and the synchronization of the somite segmentation clock.
Nature 408,475
-479.[CrossRef][Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and
Schilling, T. F. (1995). Stages of embryonic
development of the zebrafish. Dev. Dyn.
203,253
-310.[Medline]
Korzh, V., Edlund, T. and Thor, S. (1993).
Zebrafish primary neurons initiate expression of the LIM homeodomain protein
Isl-1 at the end of gastrulation. Development
118,417
-425.[Abstract]
Lai, E. C., Deblandre, G. A., Kintner, C. and Rubin, G. M.
(2001). Drosophila neuralized is a ubiquitin ligase that promotes
the internalization and degradation of delta. Dev.
Cell 1,783
-794.[CrossRef][Medline]
Latimer, A. J., Dong, X., Markov, Y. and Appel, B.
(2002). Delta-Notch signaling induces hypochord development in
zebrafish. Development
129,2555
-2563.
LaVoie, M. J. and Selkoe, D. J. (2003). The
Notch ligands, Jagged and Delta, are sequentially processed by alpha-secretase
and presenilin/gammasecretase and release signaling fragments. J.
Biol. Chem. 278,34427
-34437.
Lewis, J. (1998). Notch signalling and the
control of cell fate choices in vertebrates. Semin. Cell Dev.
Biol. 9,583
-589.[CrossRef][Medline]
Lowell, S. and Watt, F. M. (2001). Delta
regulates keratinocyte spreading and motility independently of
differentiation. Mech. Dev.
107,133
-140.[CrossRef][Medline]
Mailhos, C., Modlich, U., Lewis, J., Harris, A., Bicknell, R.
and Ish-Horowicz, D. (2001). Delta4, an endothelial specific
Notch ligand expressed at sites of physiological and tumor angiogenesis.
Differentiation 69,135
-144.[CrossRef][Medline]
Nasevicius, A. and Ekker, S. C. (2000).
Effective targeted gene `knockdown' in zebrafish. Nat.
Genet. 26,216
-220.[CrossRef][Medline]
Pavlopoulos, E., Pitsouli, C., Klueg, K. M., Muskavitch, M.
A., Moschonas, N. K. and Delidakis, C. (2001).
neuralized Encodes a peripheral membrane protein involved in delta signaling
and endocytosis. Dev. Cell
1, 807-816.[CrossRef][Medline]
Pfister, S., Przemeck, G. K., Gerber, J. K., Beckers, J.,
Adamski, J. and de Angelis, M. H. (2003). Interaction of the
MAGUK Family Member Acvrinp1 and the Cytoplasmic Domain of the Notch Ligand
Delta1. J. Mol. Biol.
333,229
-235.[CrossRef][Medline]
Sakamoto, K., Ohara, O., Takagi, M., Takeda, S. and Katsube,
K. (2002). Intracellular cell-autonomous association of Notch
and its ligands: a novel mechanism of Notch signal modification.
Dev. Biol. 241,313
-326.[CrossRef][Medline]
Schroder, N. and Gossler, A. (2002). Expression
of Notch pathway components in fetal and adult mouse small intestine.
Gene Expr. Patterns 2,247
-250.[CrossRef][Medline]
Selkoe, D. and Kopan, R. (2003). Notch and
Presenilin: regulated intramembrane proteolysis links development and
degeneration. Annu. Rev. Neurosci.
26,565
-599.[CrossRef][Medline]
Shiratsuchi, T., Futamura, M., Oda, K., Nishimori, H., Nakamura,
Y. and Tokino, T. (1998). Cloning and characterization
of BAI-associated protein 1: a PDZ domain-containing protein that interacts
with BAI1. Biochem. Biophys. Res. Commun.
247,597
-604.[CrossRef][Medline]
Shutter, J. R., Scully, S., Fan, W., Richards, W. G.,
Kitajewski, J., Deblandre, G. A., Kintner, C. R. and Stark, K. L.
(2000). Dll4, a novel Notch ligand expressed in arterial
endothelium. Genes Dev.
14,1313
-1318.
Six, E., Ndiaye, D., Laabi, Y., Brou, C., Gupta-Rossi, N.,
Israel, A. and Logeat, F. (2003). The Notch ligand
Delta1 is sequentially cleaved by an ADAM protease and gamma-secretase.
Proc. Natl. Acad. Sci. USA
100,7638
-7643.
Smithers, L., Haddon, C., Jiang, Y. and Lewis, J.
(2000). Sequence and embryonic expression of deltaC in
the zebrafish. Mech. Dev.
90,119
-123.[CrossRef][Medline]
Songyang, Z., Fanning, A. S., Fu, C., Xu, J., Marfatia, S. M.,
Chishti, A. H., Crompton, A., Chan, A. C., Anderson, J. M. and Cantley,
L. C. (1997). Recognition of unique carboxyl-terminal motifs
by distinct PDZ domains. Science
275, 73-77.
Sun, X. and Artavanis-Tsakonas, S. (1996). The
intracellular deletions of Delta and Serrate define dominant negative forms of
the Drosophila Notch ligands. Development
122,2465
-2474.[Abstract]
Sweet, H. C., Gehring, M. and Ettensohn, C. A.
(2002). LvDelta is a mesoderm-inducing signal in the sea urchin
embryo and can endow blastomeres with organizer-like properties.
Development 129,1945
-1955.
van Eeden, F. J., Granato, M., Schach, U., Brand, M.,
Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P.,
Jiang, Y. J., Kane, D. A. et al. (1996). Mutations affecting
somite formation and patterning in the zebrafish, Danio rerio.
Development 123,153
-164.[Abstract]
Wei, X. and Malicki, J. (2002). nagie oko,
encoding a MAGUK-family protein, is essential for cellular patterning of the
retina. Nat. Genet. 31,150
-157.[CrossRef][Medline]
Weinberg, E. S., Allende, M. L., Kelly, C. S., Abdelhamid, A.,
Murakami, T., Andermann, P., Doerre, O. G., Grunwald, D. J. and
Riggleman, B. (1996). Developmental regulation of zebrafish
MyoD in wild-type, no tail and spadetail embryos.
Development 122,271
-280.[Abstract]
Westerfield, M. (2000). The
Zebrafish Book. Eugene: University of Oregon Press.
Wright, G. J., Puklavec, M. J., Willis, A. C., Hoek, R. M.,
Sedgwick, J. D., Brown, M. H. and Barclay, A. N.
(2000). Lymphoid/neuronal cell surface OX2 glycoprotein
recognizes a novel receptor on macrophages implicated in the control of their
function. Immunity 13,233
-242.[CrossRef][Medline]
Yan, Y. L., Hatta, K., Riggleman, B. and Postlethwait, J. H.
(1995). Expression of a type II collagen gene in the zebrafish
embryonic axis. Dev. Dyn.
203,363
-376.[Medline]
Yeh, E., Zhou, L., Rudzik, N. and Boulianne, G. L.
(2000). Neuralized functions cell autonomously to regulate
Drosophila sense organ development. EMBO J.
19,4827
-4837.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
K. Choi, Y.-H. Ahn, D. L. Gibbons, H. T. Tran, C. J. Creighton, L. Girard, J. D. Minna, F. X.-F. Qin, and J. M. Kurie Distinct Biological Roles for the Notch Ligands Jagged-1 and Jagged-2 J. Biol. Chem., June 26, 2009; 284(26): 17766 - 17774. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Xu, A. W. Peng, K. Oshima, and S. Heller MAGI-1, A Candidate Stereociliary Scaffolding Protein, Associates with the Tip-Link Component Cadherin 23 J. Neurosci., October 29, 2008; 28(44): 11269 - 11276. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Eisen and J. C. Smith Controlling morpholino experiments: don't stop making antisense Development, May 15, 2008; 135(10): 1735 - 1743. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Holderfield and C. C.W. Hughes Crosstalk Between Vascular Endothelial Growth Factor, Notch, and Transforming Growth Factor-{beta} in Vascular Morphogenesis Circ. Res., March 28, 2008; 102(6): 637 - 652. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Estrach, J. Legg, and F. M. Watt Syntenin mediates Delta1-induced cohesiveness of epidermal stem cells in culture J. Cell Sci., August 15, 2007; 120(16): 2944 - 2952. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Geffers, K. Serth, G. Chapman, R. Jaekel, K. Schuster-Gossler, R. Cordes, D. B. Sparrow, E. Kremmer, S. L. Dunwoodie, T. Klein, et al. Divergent functions and distinct localization of the Notch ligands DLL1 and DLL3 in vivo J. Cell Biol., July 24, 2007; 178(3): 465 - 476. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Williams, J.-L. Li, M. Murga, A. L. Harris, and G. Tosato Up-regulation of the Notch ligand Delta-like 4 inhibits VEGF-induced endothelial cell function Blood, February 1, 2006; 107(3): 931 - 939. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ladi, J. T. Nichols, W. Ge, A. Miyamoto, C. Yao, L.-T. Yang, J. Boulter, Y. E. Sun, C. Kintner, and G. Weinmaster The divergent DSL ligand Dll3 does not activate Notch signaling but cell autonomously attenuates signaling induced by other DSL ligands J. Cell Biol., September 12, 2005; 170(6): 983 - 992. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Major and K. D. Irvine Influence of Notch on dorsoventral compartmentalization and actin organization in the Drosophila wing Development, September 1, 2005; 132(17): 3823 - 3833. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Mizuhara, T. Nakatani, Y. Minaki, Y. Sakamoto, Y. Ono, and Y. Takai MAGI1 Recruits Dll1 to Cadherin-based Adherens Junctions and Stabilizes It on the Cell Surface J. Biol. Chem., July 15, 2005; 280(28): 26499 - 26507. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||