|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 3 November 2004
doi: 10.1242/dev.01458
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Max-Planck Institute of Immunobiology, Stuebeweg 51, 79108 Freiburg,
Germany
2 Department of Pharmacology, Kyoto University Graduate School of Medicine,
Yoshida-Konoé-cho, Sakyo-ku, Kyoto, 606-8501, Japan
3 The Jackson Laboratory, Bar Harbor, ME 04609-1500, USA
* Author for correspondence (e-mail: kemler{at}immunbio.mpg.de)
Accepted 22 September 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Epithelial-mesenchymal transition, Mouse pre-implantation embryo, Wnt/ß-Catenin, Gastrulation
| Introduction |
|---|
|
|
|---|
- and ß-catenin are present in the unfertilized
mouse egg, as proteins assembled into an adhesion complex, and as maternal
mRNA (Ohsugi et al., 1996
-catenin are characterized by defective trophectoderm
(Larue et al., 1994
-catenin, which anchors the adhesion
complex to the actin-based cytoskeletal network
(Aberle et al., 1996
), and axin, which prepares the protein for ubiquitination and
proteasome degradation (Huelsken and
Behrens, 2000
Interestingly, when levels of the cadherin-catenin adhesion complex
components in the cleavage-stage embryos were compared, a surplus of
uncomplexed cytoplasmic ß-catenin was found, reminiscent of the
stabilization of ß-catenin upon Wnt signaling
(Ohsugi et al., 1996
).
Although expression of several components of the pathway as well as of those
of the ß-catenin degradation machinery has been described in
cleavage-stage embryos (Knowles et al.,
2003
; Lloyd et al.,
2003
; Wang et al.,
2004
), involvement of the Wnt/ß-catenin signaling pathway
during pre-implantation development has not yet been shown.
To query whether the Wnt/ß-catenin pathway could be involved in
regulating cell fate in pre-implantation development, we performed a series of
genetic experiments. We anticipated that an inactivation of the maternal and
zygotic ß-catenin gene cannot lead to informative results about the Wnt
pathway because of the requirement of ß-catenin for E-cadherin-mediated
cell adhesion and compaction. Therefore, we chose to generate a stabilized
form of ß-catenin in the unfertilized egg using a cre-loxP
strategy. Mice carrying a ß-catenin exon 3 floxed allele were crossed to
a transgenic line containing the cre-recombinase gene under control
of the Zona pellucida 3 promoter (de Vries
et al., 2000
; Harada et al.,
1999
), resulting in females from this cross expressing an exon
3-deleted ß-catenin allele in their oocytes. As exon 3 harbors the
GSK3ß phosphorylation motifs (Aberle
et al., 1997
), the protein will therefore not be subject to
degradation by the standard ubiquitination pathway. Furthermore, the embryos
arising from crossing these females and wild-type males express both the
stabilized and wild-type form of ß-catenin in all their cells. Our
results based on analysis of these embryos indicate that the
Wnt/ß-catenin pathway is not required for mouse pre-implantation
development, and the first detectable changes are in the embryonic ectoderm of
early post-implantation embryos.
| Materials and methods |
|---|
|
|
|---|
Morula aggregation experiments were performed between
129-Gt(ROSA)26Sor/J (ROSA26
(Soriano, 1999
)) and
ß-cat
Ex3/+ embryos, and, after overnight culture,
blastocysts were transferred into pseudopregnant females.
To produce teratomas, genotyped E6.5 embryos were transferred under the kidney capsule of F1 (C57BL/6x129) mice and the resultant teratomas were processed for histological examination 6 weeks later.
Genotyping was done by PCR analysis of tail tips, single oocytes, pre-implantation embryos, or material scraped from paraffin sections following lysis in buffer containing proteinase K. DNA was precipitated with isopropanol and resuspended in Tris-EDTA buffer. The cre transgene was detected using as primers: CreS: 5'CAAGTTGAATAACCGGAAATG3' and CreAS: 5'GCCAGGTATCTCTGACCAGA3'. The ß-catenin exon 3 floxed allele was detected using primers Ex2S: 5'GACACCGCTGCGTGGACAATG3' and Ex3AS: 5'GTGGCTGACAGCAGCTTTTCT3'. Recombination to give the exon3-less allele in isolated oocytes and embryos was detected using primers: C-F: 5'GCTGCGTGGACAATGGCTAC3' and C-R: 5'TGAGCCCTAGTCATTGCATAC3'.
lacZ staining and in situ hybridization
Embryos were fixed in 1% formaldehyde, 0.2% glutaraldehyde, 2 mM
MgCl2, 5 mM EGTA, 0.02% NP-40 for 5 min (blastocysts) to 15 min
(E5.5 to E7.5 embryos) at room temperature. After two washes in PBS, they were
transferred into freshly prepared X-Gal staining solution
(Maretto et al., 2003
), and
stained for 4-6 hours at 37°C in the dark. After rinsing with PBS, embryos
were post-fixed in 2% paraformaldehyde and examined under an Axiovert 200
microscope (Zeiss) for photography with an Axiocam digital camera (Zeiss).
Whole-mount in situ hybridization using digoxigenin-labeled riboprobes for
Nanog, Otx2, Hex and Bmp4 genes was performed as described
(Knecht et al., 1995
;
Parr et al., 1993
). In situ
hybridization for Snai1 mRNA on sections was done as described
(Lescher et al., 1998
).
Antibodies and immunoblotting
Antibodies used were: E-cadherin polyclonal affinity-purified rabbit
antibody, anti-gp84 (Vestweber and Kemler,
1984
); ß-catenin mouse monoclonal antibody (C19220,
Transduction Laboratories); and Oct4 mouse monoclonal antibody (sc-5279, Santa
Cruz Biotechnology). Secondary tagged antibodies to detect the primary
antibody complexes were an Alexa Fluor 488 goat anti-rabbit (A-21045,
Molecular Probes) and an Alexa Fluor 633 goat anti-mouse (A-21052, Molecular
Probes).
R1 ES cells and mutant ES-cell lines were homogenized in lysis buffer, and
cell lysates were probed with ß-catenin mouse monoclonal antibody at a
1:3000 dilution as described (Boussadia et
al., 2002
).
Histology and immunohistochemistry
Blastocysts were incubated in acid Tyrode's solution (T-1788, Sigma) to
remove the zona pellucida. After two washes in M2 medium (M-7167, Sigma),
embryos were fixed in 2% paraformaldehyde in PBS at room temperature for 10
min, followed by 0.25% Triton X-100/PBS treatment for 8 min. After
pretreatment with 1% heat-inactivated sheep serum in PBS (antibody incubation
buffer) for 30 min, embryos were incubated with the primary antibody for 30
min at 37°C, then washed twice in incubation buffer for 30 min. Embryos
were next incubated for 30 min at 37°C with the fluorescent-tagged
secondary antibodies, washed in incubation buffer and mounted in a drop of
Prolong Antifade reagent (P-7481, Molecular Probes). A Leica SP2 UV confocal
microscope (Leica Microsystems) equipped with a HCX PLAPO CS 63?/1.2 water
immersion lens was used to visualize the antibody complexes. Image acquisition
parameter settings were kept constant for different samples to enable signal
intensity comparison.
For immunohistological analysis, embryos were fixed in 4% paraformaldehyde/PBS, dehydrated, embedded in paraffin and sectioned at 7 µm. Sections were dewaxed, rehydrated and stained with E-cadherin antibody (1:50 dilution), ß-catenin antibody (1:50), Oct4 antibody (1:50), anti-Lef1 (a gift from R. Grosschedl, 1:50) and T-Brachyury antibody (a gift from B. Herrmann, 1:50). The EnVision Plus System (Dako, Germany) with DAB peroxidase substrate (Sigma, Germany) was used to detect and amplify the signals.
| Results |
|---|
|
|
|---|
Ex3/+) inherited a wild-type ß-catenin
allele.
In accordance with our previous results
(Ohsugi et al., 1996
) a faint
but clear cytoplasmic distribution of ß-catenin was observed in oocytes
of wild-type ovaries (Fig. 1A).
Enhanced cytoplasmic localization of ß-catenin was found in
ß-cat
Ex3 (mutant) oocytes
(Fig. 1B), but no nuclear
localization of ß-catenin was detected in either wild-type or mutant
oocytes. When single unfertilized eggs from heterozygous females were
genotyped, 50% exhibited the deleted exon 3 allele
(ß-cat
Ex3), confirming the high efficiency of the
Zp3-cre transgene for recombining floxed sequences during oocyte
maturation (Fig. 1C).
|
Ex3/+ blastocysts ß-catenin was only found
associated with the cell membrane, and no cytoplasmic or nuclear localization
was detected (Fig. 1F, wild
type in E). However, since the staining procedure involved permeabilization of
the embryos, a possible nuclear localization of the stabilized ß-catenin
may be below detection level. The ß-catenin
Ex3 allele is
expressed during pre-implantation development as monitored by RT-PCR analysis
from mutant blastocysts (not shown). Further support that the stabilized form
of ß-catenin is probably synthesized during pre-implantation development
comes from immunoblot experiments of extracts of ES cells isolated from mutant
blastocysts (Fig. 1D). Mutant
and wild-type blastocysts were also indistinguishable when stained for
E-cadherin and Oct4 in double immunofluorescence experiments
(Fig. 1G,H). From these results
it is concluded that the presence of the dominant ß-catenin
Ex3 allele had no obvious effect on pre-implantation
development. In contrast, when post-implantation stages at E6.5 were examined, mutant embryos exhibited a morphologically distinct phenotype (Fig. 1J,K); the embryonic portion was less expanded and structured and often appeared as a disorganized mass of cells (Fig. 1K). But we found no difference in the extra-embryonic region and in the ectoplacental cone of wild-type and mutant embryos. These results suggest that the expression of the stabilized form of ß-catenin from the beginning of embryonic development specifically affects the embryonic portion at early gastrulation.
Stabilized ß-catenin affects the embryonic ectoderm
To determine the portion of the embryo affected by stabilized
ß-catenin, E6.5 embryos within their decidua were sectioned and examined
histologically (Fig. 2A,B).
Compared to wild-type embryos the mutant embryos showed specific alterations
in the embryonic ectoderm, where the cell layers appeared disorganized and
cells were loosely attached (Fig.
2B). In serial sections through to E6.5 mutant embryos, condensed
cell clusters of presumably intact embryonic ectoderm were surrounded by
scattered cells, suggesting that not all cells of the embryonic ectoderm cell
layer were equally affected. Indeed the extra-embryonic ectoderm, the
ectoplacental cone and the visceral endoderm (VE) appeared normal, although
the embryonic VE did appear thicker (Fig.
2B, arrow), a likely consequence of the morphological changes in
the epiblast. Immunostaining of ß-catenin in E5.5 and E6.5 embryos
revealed that in both wild-type and mutant embryos the protein was localized
largely to cell membranes (Fig.
2C-F). Interestingly, only the embryonic portion of the mutant
embryos showed enhanced cytoplasmic staining for ß-catenin; and no
clear-cut nuclear localization was found here
(Fig. 2D,F).
|
Interestingly, in post-implantation development, already at E5.5 mutant
embryos exhibited clusters of ß-gal-positive cells in the epiblast
(Fig. 3B), which also showed
accumulated ß-catenin in the cytoplasm (compare
Fig. 2D and
Fig. 3B). In contrast, we never
observed ß-gal-positive cells in wild-type E5.5 embryos
(Fig. 3A). Wnt/ß-catenin
signaling in wild-type embryos can first be seen at E6.5, and, in agreement
with a previous report (Maretto et al.,
2003
), ß-gal-positive cells became apparent in the posterior
side of the proximal epiblast (arrow in
Fig. 3C) at the junction
between embryonic and extra-embryonic ectoderm. In E7.5 wild-type embryos,
probably due to Wnt3 signaling (Liu et
al., 1999
), the ß-gal expression domain became extended in
the posterior part of the embryo (Fig.
3E). In contrast to wild-type embryos, ß-gal-positive cells
were distributed over the entire E6.5 and E7.5 mutant embryos
(Fig. 3D,F). These results
clearly demonstrate the nuclear signaling function of ß-catenin in mutant
embryos as early as E5.5.
|
In both wild-type and mutant E5.5 embryos ß-catenin exhibited mostly membrane localization (Fig. 4A,B). However, the epiblast cells of mutant embryos also showed enhanced cytoplasmic localization (Fig. 4B). No differences were seen between wild-type and mutant embryos in expression of Oct4, a pluripotency marker; the nuclei and cytoplasm of epiblast cells were positive for Oct4 protein (Fig. 4C,D). Although T-Brachyury, a mesoderm-specific transcription factor, is not expressed in the epiblast of wild-type E5.5 embryos, we observed some cells containing nuclear T-Brachyury in mutant E5.5 embryos (Fig. 4E,F). Similarly, when in situ hybridization was performed to detect mRNA of another mesoderm-specific transcription factor, Snai1, it was found to be expressed in cells of the epiblast of E5.5 mutant embryos, but not in the epiblast of wild-type embryos (Fig. 4G,H). Taken together, these results clearly demonstrate that some cells in the mutant epiblast express mesoderm-specific genes by E5.5.
|
|
|
First, ROSA26 morulae were aggregated with either wild-type or mutant morulae, and resultant post-implantation chimeric embryos at E7.5 were sectioned after staining for ß-galactosidase to label the ROSA26 cells. Wild-type morulae intermixed well with the ROSA26 partner cells, and descendants of both parts contributed equally to derivatives of all three germ layers and to extra-embryonic tissues (not shown). In contrast, when mutant morulae were combined with ROSA26 morulae, an unequal distribution of cells was observed; mutant cells contributed little to the embryonic ectoderm and preferentially colonized the visceral endoderm, mesoderm, and extra-embryonic tissues. In some extreme cases the embryonic ectoderm cell layer was exclusively composed of ROSA26 cells, while mutant cells contributed to visceral endoderm, mesoderm and extra-embryonic tissues (Fig. 7A,B).
|
| Discussion |
|---|
|
|
|---|
We found no evidence for active Wnt/ß-catenin signaling during
pre-implantation development using the Wnt-reporter line BAT-gal
(Maretto et al., 2003
). We
then designed genetic experiments to study the nuclear signaling function of
ß-catenin in pre-implantation embryos. In ß-catEx3flox/+,
cre/+ females the stabilized form of ß-catenin is efficiently
generated in the growing oocyte. By several criteria, pre-implantation
development of mutant embryos derived from these oocytes proceeded normally.
More importantly, no nuclear signaling function of ß-catenin could be
detected in mutant embryos using the Wnt-reporter line BAT-gal. In accordance
with this, we observed no nuclear localization of ß-catenin in mutant
oocytes or embryos.
These results suggest mechanisms independent of GSK3ß-mediated
phosphorylation and ß-Trcp-mediated proteolysis must come into play to
prevent action of the stabilized form of ß-catenin in the blastomere
nuclei. One alternative pathway, able to degrade both wild-type and mutant
ß-catenin, has been described (Liu et
al., 2001
; Matsuzawa and Reed,
2001
). This pathway, activated by p53, involves the ubiquitin
ligase SIAH1, which, in collaboration with several interacting proteins, SIP,
APC, and Skp-Cullin-F-box complexes, leads to degradation of ß-catenin by
the proteasome. The presence of this pathway in pre-implantation embryos is
plausible, since APC is expressed in these developmental stages
(de Vries et al., 2004
), and
SIAH2, a protein closely resembling SIAH1, is also expressed (W.N.dV.,
unpublished). Furthermore, the other molecules of this pathway, as well as
those of the proteasome complex, are abundantly expressed in full-grown
oocytes and two-cell stage embryos (A. V. Evsikov, unpublished)
(Evsikov et al., 2004
).
However, mechanisms disrupting TCF/ß-catenin interaction may also be
involved in preventing the nuclear action of ß-catenin. Expression
sequence tags (ESTs) for ICAT, an 81-amino acid peptide that interferes with
Wnt signaling (Tago et al.,
2000
), have been found in a two-cell stage cDNA library
(Evsikov et al., 2004
;
Knowles et al., 2003
).
Secreted Frizzled-related proteins (SFRPs) can also attenuate Wnt signaling in
colorectal cancer cells, even in the presence of downstream stabilizing
mutations, such as those found in ß-catenin and APC
(Suzuki et al., 2004
). SFRPs
are expressed in cleavage-stage embryos, and a similar mechanism could
therefore silence the stabilized form of ß-catenin in our
experiments.
As ß-catenin is able to interact with a large variety of molecules
(Huelsken and Behrens, 2000
),
the nuclear activity of ß-catenin in pre-implantation embryos could be
regulated by the interplay of a relative excess of repressors that will
inhibit the transcriptional activity of ß-catenin and/or the
developmentally regulated expression of co-activators during early
cleavage-stages. Repressors interacting with ß-catenin may act in concert
with the protein degradation pathways to robustly control ß-catenin
nuclear activity during pre-implantation development. Finally, one has to
consider differences in the regulation of transcription of ß-catenin
during development. Although ß-catenin is rather ubiquitously expressed,
little is known about a fine-tuning of transcription that could result in
different amounts of protein being synthesized. A ß-catenin
dose-dependent differentiation of ES cells carrying mutations in APC has been
reported recently (Kielman et al.,
2002
). A certain threshold level of ß-catenin may be required
for its nuclear function, and reaching this might well depend on the
transcriptional activity of the gene.
Although pre-implantation development progressed normally, post-implantation mutant embryos exhibited a specific phenotype in the embryonic ectoderm, while the morphology of the extra-embryonic portion was normal. As our mating scheme ensured that every cell in the developing mutant embryo would express the stabilized form of ß-catenin, this suggests that cells of extra-embryonic tissues have mechanisms similar to those in pre-implantation embryos to control the nuclear activity of the stabilized form of ß-catenin.
Cells of the embryonic ectoderm prematurely expressed direct
Wnt/ß-catenin target genes such as T-Brachyury and
Lef1, a likely direct effect of the nuclear functioning of
ß-catenin. Indeed, T-Brachyury was detected as early as E5.5 in some
cells of the epiblast when most cells still express the pluripotency marker
Oct4. Mutant epiblast cells not only express the mesodermal-specific genes
T-Brachyury and Lef1, they also lose E-cadherin expression
and thus adopt a mesenchymal fate. Hence, besides acting positively on the
transcription of T-Brachyury and Lef1, mutant ß-catenin
signaling may also repress E-cadherin transcription, a mechanism proposed for
the normal epithelial-mesenchymal transition during streak formation
(Huber et al., 1996
) and
demonstrated for E-cadherin repression in hair follicles
(Jamora et al., 2003
).
Alternatively or in combination, Snai1 may also be involved in the
repression of E-cadherin transcription, as Snai1 mRNA can be detected
in E5.5 mutant embryos. This premature epithelial-mesenchymal transition leads
to disintegration of the embryonic ectoderm cell layer and is probably the
cause of inefficient embryonic patterning.
The fact that the embryonic ectoderm is largely devoid of mutant cells in morulae aggregation experiments suggests a cell-autonomous event induced by the mutant form of ß-catenin. Mutant cells probably segregate from the epiblast because of the downregulation of E-cadherin. However, it may well be that stabilized ß-catenin induces other adhesive mechanisms that act to separate wild-type and mutant cells in the epiblast of chimeric embryos.
Mutant embryos transplanted under the kidney capsule give rise to yolk sac
carcinomas, indicating that the embryonic ectoderm cells have lost their
growth and/or pluripotent capacity. Tumors derived from mutant embryos were
similar to those produced by transplanting the extra-embryonic part of the
egg-cylinder (Solter and Damjanov,
1973
), suggesting that embryonic endoderm, in the absence of
functional ectoderm, changes its differentiation pattern. This observation,
together with the absence of Hex expression in embryonic endoderm of
mutant embryos, indicates the importance of normal signaling from the epiblast
in regulating patterning and differentiation of embryonic visceral
endoderm.
In conclusion, we found no evidence that Wnt/ß-catenin signaling plays a role in regulation of mouse pre-implantation development. The observed presence of components of the pathway in early cleavage-stages may simply indicate they are in place for use in primitive streak formation, or that they have an alternative function in the pre-implantation embryo. More importantly, pre-implantation embryos and some cells of post-implantation embryos apparently control intracellular ß-catenin levels by a mechanism independent of the GSK3ß-mediated ubiquitination and proteasome degradation pathway. In contrast, cells of the epiblast are unable to regulate the stabilized form of ß-catenin. In these cells ß-catenin is able to exert its nuclear function, and this results in a premature epithelial-mesenchymal transition. It will be of future interest to determine the molecular mechanisms responsible for this difference in control of the Wnt/ß-catenin pathway.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Aberle, H., Schwartz, H. and Kemler, R. (1996). Cadherin-catenin complex: protein interactions and their implications for cadherin function. J. Cell. Biochem. 61,514 -523.[CrossRef][Medline]
Aberle, H., Bauer, A., Stappert, J., Kispert, A. and Kemler, R. (1997). beta-catenin is a target for the ubiquitin-proteasome pathway. EMBO J. 16,3797 -3804.[CrossRef][Medline]
Ang, S. L., Conlon, R. A., Jin, O. and Rossant, J. (1994). Positive and negative signals from mesoderm regulate the expression of mouse Otx2 in ectoderm explants. Development 120,2979 -2989.[Abstract]
Boussadia, O., Kutsch, S., Hierholzer, A., Delmas, V. and Kemler, R. (2002). E-cadherin is a survival factor for the lactating mouse mammary gland. Mech. Dev. 115, 53-62.[CrossRef][Medline]
Damjanov, I. and Solter, D. (1973). Yolk sac carcinoma grown from mouse egg cylinder. Arch. Pathol. 95,182 -184.[Medline]
Damjanov, I., Solter, D., Belicza, M. and Skreb, N. (1971). Teratomas obtained through extrauterine growth of seven-day mouse embryos. J. Natl. Cancer Inst. 46,471 -480.
de Vries, W. N., Binns, L. T., Fancher, K. S., Dean, J., Moore, R., Kemler, R. and Knowles, B. B. (2000). Expression of Cre recombinase in mouse oocytes: a means to study maternal effect genes. Genesis 26,110 -112.[CrossRef][Medline]
de Vries, W. N., Evsikov, A. V., Fancher, K. S., Kemler, R.,
Solter, D. and Knowles, B. B. (2004). Maternal
ß-catenin and E-cadherin in mouse development.
Development 131,4435
-4445.
Evsikov, A. V., de Vries, W. N., Peaston, A., Fancher, K., Chen, F., Radford, E., Latham, K., Blake, J., Bult, C., Solter, D. et al. (2004). Systems biology of the 2-cell embryo. Cytogenet. Genome Res. 105,240 -250.[CrossRef][Medline]
Haegel, H., Larue, L., Ohsugi, M., Fedorov, L., Herrenknecht, K. and Kemler, R. (1995). Lack of beta-catenin affects mouse development at gastrulation. Development 121,3529 -3537.[Abstract]
Harada, N., Tamai, Y., Ishikawa, T., Sauer, B., Takaku, K., Oshima, M. and Taketo, M. M. (1999). Intestinal polyposis in mice with a dominant stable mutation of the beta-catenin gene. EMBO J. 18,5931 -5942.[CrossRef][Medline]
Huber, O., Bierkamp, C. and Kemler, R. (1996). Cadherins and catenins in development. Curr. Opin. Cell Biol. 8,685 -691.[CrossRef][Medline]
Huelsken, J. and Behrens, J. (2000). The Wnt signalling pathway. J. Cell Sci. 113, 3545.
Huelsken, J., Vogel, R., Brinkmann, V., Erdmann, B., Birchmeier,
C. and Birchmeier, W. (2000). Requirement for
beta-catenin in anterior-posterior axis formation in mice. J. Cell
Biol. 148,567
-578.
Jamora, C., DasGupta, R., Kocieniewski, P. and Fuchs, E. (2003). Links between signal transduction, transcription and adhesion in epithelial bud development. Nature 422,317 -322.[CrossRef][Medline]
Kielman, M. F., Rindapaa, M., Gaspar, C., van Poppel, N., Breukel, C., van Leeuwen, S., Taketo, M. M., Roberts, S., Smits, R. and Fodde, R. (2002). Apc modulates embryonic stem-cell differentiation by controlling the dosage of beta-catenin signaling. Nat. Genet. 32,594 -605.[CrossRef][Medline]
Knecht, A. K., Good, P. J., Dawid, I. B. and Harland, R. M. (1995). Dorsal-ventral patterning and differentiation of noggin-induced neural tissue in the absence of mesoderm. Development 121,1927 -1935.[Abstract]
Knowles, B. B., Evsikov, A. V., de Vries, W. N., Peaston, A. E. and Solter, D. (2003). Molecular control of the oocyte to embryo transition. Philos. Trans. R. Soc. Lond., B, Biol. Sci. 358,1381 -1387.[CrossRef][Medline]
Larue, L., Ohsugi, M., Hirchenhain, J. and Kemler, R.
(1994). E-cadherin null mutant embryos fail to form a
trophectoderm epithelium. Proc. Natl. Acad. Sci. USA
91,8263
-8267.
Lescher, B., Haenig, B. and Kispert, A. (1998). sFRP-2 is a target of the Wnt-4 signaling pathway in the developing metanephric kidney. Dev. Dyn. 213,440 -451.[CrossRef][Medline]
Liu, P., Wakamiya, M., Shea, M. J., Albrecht, U., Behringer, R. R. and Bradley, A. (1999). Requirement for Wnt3 in vertebrate axis formation. Nat. Genet. 22,361 -365.[CrossRef][Medline]
Liu, J., Stevens, J., Rote, C. A., Yost, H. J., Hu, Y., Neufeld, K. L., White, R. L. and Matsunami, N. (2001). Siah-1 mediates a novel beta-catenin degradation pathway linking p53 to the adenomatous polyposis coli protein. Mol. Cell 7, 927-936.[CrossRef][Medline]
Lloyd, S., Fleming, T. P. and Collins, J. E. (2003). Expression of Wnt genes during mouse preimplantation development. Gene Expr. Patterns 3, 309-312.[CrossRef][Medline]
Maretto, S., Cordenonsi, M., Dupont, S., Braghetta, P.,
Broccoli, V., Hassan, A. B., Volpin, D., Bressan, G. M. and Piccolo,
S. (2003). Mapping Wnt/beta-catenin signaling during mouse
development and in colorectal tumors. Proc. Natl. Acad. Sci.
USA 100,3299
-3304.
Matsuzawa, S. I. and Reed, J. C. (2001). Siah-1, SIP, and Ebi collaborate in a novel pathway for beta-catenin degradation linked to p53 responses. Mol. Cell 7, 915-926.[CrossRef][Medline]
Ohsugi, M., Hwang, S. Y., Butz, S., Knowles, B. B., Solter, D. and Kemler, R. (1996). Expression and cell membrane localization of catenins during mouse preimplantation development. Dev. Dyn. 206,391 -402.[CrossRef][Medline]
Parr, B. A., Shea, M. J., Vassileva, G. and McMahon, A. P. (1993). Mouse Wnt genes exhibit discrete domains of expression in the early embryonic CNS and limb buds. Development 119,247 -261.[Abstract]
Riethmacher, D., Brinkmann, V. and Birchmeier, C.
(1995). A targeted mutation in the mouse E-cadherin gene results
in defective preimplantation development. Proc. Natl. Acad. Sci.
USA 92,855
-859.
Solter, D. and Damjanov, I. (1973). Explantation of extraembryonic parts of 7-day-old mouse egg cylinders. Experientia 29,701 -702.[CrossRef][Medline]
Solter, D., Skreb, N. and Damjanov, I. (1970). Extrauterine growth of mouse egg-cylinders results in malignant teratoma. Nature 227,503 -504.[CrossRef][Medline]
Soriano, P. (1999). Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71.[CrossRef][Medline]
Suzuki, H., Watkins, D. N., Jair, K. W., Schuebel, K. E., Markowitz, S. D., Dong-Chen, W., Pretlow, T. P., Yang, B., Akiyama, Y., van Engeland, M. et al. (2004). Epigenetic inactivation of SFRP genes allows constitutive WNT signaling in colorectal cancer. Nat. Genet. 36,417 -422.[CrossRef][Medline]
Tago, K., Nakamura, T., Nishita, M., Hyodo, J., Nagai, S.,
Murata, Y., Adachi, S., Ohwada, S., Morishita, Y., Shibuya, H. et
al. (2000). Inhibition of Wnt signaling by ICAT, a novel
beta-catenin-interacting protein. Genes Dev.
14,1741
-1749.
Torres, M., Stoykova, A., Huber, O., Chowdhury, K., Bonaldo,
P., Mansouri, A., Butz, S., Kemler, R. and Gruss, P.
(1997). An alpha-E-catenin gene trap mutation defines its
function in preimplantation development. Proc. Natl. Acad. Sci.
USA 94,901
-906.
Vestweber, D. and Kemler, R. (1984). Rabbit antiserum against a purified surface glycoprotein decompacts mouse preimplantation embryos and reacts with specific adult tissues. Exp. Cell Res. 152,169 -178.[CrossRef][Medline]
Wang, Q. T., Piotrowska, K., Ciemerych, M. A., Milenkovic, L., Scott, M. P., Davis, R. W. and Zernicka-Goetz, M. (2004). A genome-wide study of gene activity reveals developmental signaling pathways in the preimplantation mouse embryo. Dev. Cell 6,133 -144.[CrossRef][Medline]
Wodarz, A. and Nusse, R. (1998). Mechanisms of Wnt signaling in development. Annu. Rev. Cell Dev. Biol. 14,59 -88.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
I. Ramis-Conde, D. Drasdo, A. R. A. Anderson, and M. A. J. Chaplain Modeling the Influence of the E-Cadherin-{beta}-Catenin Pathway in Cancer Cell Invasion: A Multiscale Approach Biophys. J., July 1, 2008; 95(1): 155 - 165. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. He, D. Pant, A. Schiffmacher, A. Meece, and C. L. Keefer Lymphoid Enhancer Factor 1-Mediated Wnt Signaling Promotes the Initiation of Trophoblast Lineage Differentiation in Mouse Embryonic Stem Cells Stem Cells, April 1, 2008; 26(4): 842 - 849. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xie, S. Tranguch, X. Jia, H. Zhang, S. K. Das, S. K. Dey, C. J. Kuo, and H. Wang Inactivation of nuclear Wnt-{beta}-catenin signaling limits blastocyst competency for implantation Development, February 15, 2008; 135(4): 717 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wu, R. F. Xu, L. Xiao, H. Xu, and G. Gao Expression of the -Catenin Gene in the Skin of Embryonic Geese During Feather Bud Development Poult. Sci., January 1, 2008; 87(1): 204 - 211. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hohenstein and N. D. Hastie The many facets of the Wilms' tumour gene, WT1 Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R196 - R201. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chazaud and J. Rossant Disruption of early proximodistal patterning and AVE formation in Apc mutants Development, September 1, 2006; 133(17): 3379 - 3387. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. W. Heiser, J. Lau, M. M. Taketo, P. L. Herrera, and M. Hebrok Stabilization of {beta}-catenin impacts pancreas growth Development, May 15, 2006; 133(10): 2023 - 2032. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Den, X. Cheng, M. Merched-Sauvage, and P. J. Koch Desmocollin 3 is required for pre-implantation development of the mouse embryo J. Cell Sci., February 1, 2006; 119(3): 482 - 489. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shi, M. Stahl, L. Lu, and P. Stanley Canonical Notch Signaling Is Dispensable for Early Cell Fate Specifications in Mammals Mol. Cell. Biol., November 1, 2005; 25(21): 9503 - 9508. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||