spacer gif spacer gif spacer gif spacer gif ARCHIVE ANNOUNCEMENT! spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 3 November 2004
doi: 10.1242/dev.01464


Development 131, 5825-5835 (2004)
Published by The Company of Biologists 2004


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.01464v1
131/23/5825    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Little, S. C.
Right arrow Articles by Mullins, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Little, S. C.
Right arrow Articles by Mullins, M. C.

Twisted gastrulation promotes BMP signaling in zebrafish dorsal-ventral axial patterning

Shawn C. Little and Mary C. Mullins*

Department of Cell and Developmental Biology, University of Pennsylvania School of Medicine, 1211 BRBII/III, 421 Curie Boulevard, Philadelphia, PA 19104-6058, USA

* Author for correspondence (e-mail: mullins{at}mail.med.upenn.edu)

Accepted 23 September 2004


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
In vertebrates and invertebrates, the bone morphogenetic protein (BMP) signaling pathway patterns cell fates along the dorsoventral (DV) axis. In vertebrates, BMP signaling specifies ventral cell fates, whereas restriction of BMP signaling by extracellular antagonists allows specification of dorsal fates. In misexpression assays, the conserved extracellular factor Twisted gastrulation (Tsg) is reported to both promote and antagonize BMP signaling in DV patterning. To investigate the role of endogenous Tsg in early DV patterning, we performed morpholino (MO)-based knockdown studies of Tsg1 in zebrafish. We found that loss of tsg1 results in a moderately strong dorsalization of the embryonic axis, suggesting that Tsg1 promotes ventral fates. Knockdown of tsg1 combined with loss of function of the BMP agonist tolloid (mini fin) or heterozygosity for the ligand bmp2b (swirl) enhanced dorsalization, supporting a role for Tsg1 in specifying ventral cell fates as a BMP signaling agonist. Moreover, loss of tsg1 partially suppressed the ventralized phenotypes of mutants of the BMP antagonists Chordin or Sizzled (Ogon). Our results support a model in which zebrafish Tsg1 promotes BMP signaling, and thus ventral cell fates, during DV axial patterning.

Key words: Twisted gastrulation, BMP signaling, Bone morphogenetic protein, Chordin, Zebrafish


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The bone morphogenetic protein (BMP) signaling pathway is essential for many developmental processes (Hogan, 1996Go), one of the earliest of which is to pattern cell fates along the dorsoventral (DV) axis in vertebrates and invertebrates (De Robertis and Sasai, 1996Go). In Xenopus and zebrafish, BMP signaling is required for the specification of ventral cell fates, whereas its restriction is necessary for proper specification of dorsal tissues (Holley and Ferguson, 1997Go). Genetic evidence implicating BMP signaling in DV patterning comes from a collection of zebrafish mutants that disrupt factors acting within a BMP signaling pathway (Hammerschmidt and Mullins, 2002Go). Mutations in genes encoding the ligands Bmp2b (Swirl) (Kishimoto et al., 1997Go; Nguyen et al., 1998Go) or Bmp7 (Snailhouse) (Dick et al., 2000Go; Schmid et al., 2000Go), the type I BMP receptor Alk8 (Lost-a-fin) (Bauer et al., 2001Go; Mintzer et al., 2001Go), or the intracellular effector Smad5 (Somitabun) (Kramer et al., 2002Go) result in the expansion of dorsal ectodermal and mesendodermal cell fates at the expense of nearly all ventral tissues.

Conversely, zebrafish mutants of the BMP antagonizing genes chordin (chordino) and sizzled (ogon) exhibit a reduction of dorsal and expansion of ventral cell types (Hammerschmidt et al., 1996Go). Extracellularly, Chordin, Follistatin and Noggin, which are expressed in dorsal domains, antagonize BMP signaling by directly binding and inhibiting BMP ligands, prohibiting activation of their receptors (De Robertis et al., 2000Go). Sizzled (Ogon) is unique as a BMP antagonist in its ventrally restricted expression pattern and its dependence on Chordin to antagonize BMP signaling (Yabe et al., 2003Go). Chordin is itself regulated by the Tolloid family of metalloproteases, which degrade Chordin and thus promote BMP signaling (Mullins, 1998Go). In zebrafish, mutations in tolloid [mini fin; tolloid like 1 (tll1) - Zebrafish Information Network] result in the loss of the ventral fin fold, tissue derived from the ventral most region of the gastrula (Connors et al., 1999Go). This mildly dorsalized phenotype has led to a model in which zebrafish Tolloid (Mini fin) activity restricts Chordin, and thus promotes high levels of BMP signaling, at or near the end of gastrulation (Connors et al., 1999Go). The combined activity of these extracellular factors ensures proper patterning, and is consistent with a model in which dorsally produced BMP antagonists diffuse laterally to produce a gradient of BMP signaling (Holley and Ferguson, 1997Go; Thomsen, 1997Go), which imparts positional information and/or cell fate decisions along the DV axis.

Although the activities of BMP ligands, the extracellular antagonist Chordin and the protease Tolloid are well agreed upon, the function of the secreted factor Twisted gastrulation (Tsg) in DV patterning in vertebrates has been less clear. Tsg displays both BMP promoting and antagonizing activities in gain-of-function and biochemical assays. Overexpression of Tsg at high levels in Xenopus embryos causes ventralization, indicative of high levels of BMP signaling (Oelgeschlager et al., 2000Go; Ross et al., 2001Go). When expressed with Tolloid or at high levels relative to Chordin, Tsg can act as an agonist of BMP signaling (Larrain et al., 2001Go; Ross et al., 2001Go; Oelgeschlager et al., 2003Go). Consistent with this, Tsg can release BMP ligands from Chordin cleavage products (Larrain et al., 2001Go; Oelgeschlager et al., 2000Go), and Tsg enhances Tolloid-mediated proteolysis of Chordin (Larrain et al., 2001Go; Scott et al., 2001Go; Shimmi and O'Connor, 2003Go; Yu et al., 2000Go). Conversely, lower levels of overexpressed Tsg antagonize BMP signaling, causing dorsalization (Chang et al., 2001Go; Ross et al., 2001Go; Scott et al., 2001Go). Biochemically, Tsg binds with high affinity directly to BMP ligands and enhances the binding of Chordin to BMPs (Chang et al., 2001Go; Larrain et al., 2001Go; Oelgeschlager et al., 2000Go; Scott et al., 2001Go), suggesting that Tsg inhibits BMP signaling. One model taking into account these results proposes that Tsg activity depends on the cleavage status of Chordin, and thus on the activity of Tolloid: uncleaved Chordin would elicit strong binding between Tsg and BMPs to antagonize BMP signaling, whereas Tolloid-generated Chordin fragments, which possess residual anti-BMP activity, would be released from BMPs by Tsg to promote BMP signaling (Larrain et al., 2001Go). This model is based largely upon overexpression experiments, leaving unanswered the question of the endogenous role of Tsg as a pro- or anti-BMP factor in DV patterning of the embryonic axis.

We performed morpholino (MO)-based loss-of-function studies of tsg1 (tsgb - Zebrafish Information Network) in the zebrafish and examined genetic interactions between tsg1 and several BMP signaling component mutants. We found that knockdown of Tsg1 results in a moderately strong dorsalization, consistent with a loss of BMP signaling. We show a genetic interaction between tsg1 and bmp2b (swirl), supporting a role for Tsg1 as a BMP signaling agonist. We demonstrate that mini fin (tolloid) and tsg1 cooperate in the promotion of BMP signaling. We also show that Tsg1 knockdown can partially suppress the chordino and sizzled (ogon) ventralized phenotypes, indicating that Tsg1 can act as a pro-BMP ventralizing factor in the absence of Chordin, as well as in the absence of Sizzled (Ogon). We propose that the predominant role of Tsg1 in DV patterning in the zebrafish is to promote BMP signaling, and that this function involves mechanisms that do not rely exclusively on the presence of Chordin or Chordin fragments.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Strains and genotyping
Mutant strains used were mini fintm124a, swirltc300a, chordinott250 and ogontm305. Genotyping was performed as described [mini fintm124a by Connors et al. (Connors et al., 1999Go)]; chordinott250 by Oelgeschlager et al. (Oelgeschlager et al., 2003Go); swirltc300a by Wagner and Mullins (Wagner and Mullins, 2002Go), except Taq{alpha}1 restriction enzyme was used to genotype ogontm305 using primers rk1-5' and rk1-3' (Yabe et al., 2003Go)]. Genotyping was performed on all individual embryos pictured. The results are included in the tables, except Fig. 5C-H and Fig. 6C-F, where homozygous mutant parents were used.



View larger version (76K):
[in this window]
[in a new window]
 
Fig. 5. Knockdown of Tsg function partially suppresses the chordino ventralization. (A) Uninjected chordino homozygote; arrowheads indicate multiple ventral fin folds, also seen in a slightly different view at higher magnification (inset). Appearance of multiple fin folds is suppressed by injection of 8 ng MO1 (B, inset shows dorsal view of tail of same embryo). (C-H) Injection of 25 ng MO5 into chordino homozygotes results in a substantial enlargement of dorsally derived tissues. Examination of live embryos at the six-somite stage showed reduced head neural tissue in C and suppression of the reduction in F (arrowheads). (C) Uninjected chordino homozygote; (F) injected chordino homozygote; lateral views, anterior is upwards. In situ analysis at the same stage with pax2.1 (arrowhead), krox20 (bracket) (D,G) and myod (E,H) showed that the somites, the MHB and rhombomeres 3 and 5 are increased in size in the injected (n=14/20) compared with uninjected mutants. (D,E) Uninjected mutants; (G,H) two views of the same injected mutant. In the injected mutant, the anterior neural and somitic mesoderm appears similar to wild type; however, the tail bud is still enlarged, indicating that the dino phenotype is not fully suppressed.

 



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 6. Tsg knockdown partially suppresses the sizzled (ogon) ventralized phenotype. (A) Dorsal view of the tail of an ogon mutant at 24 hpf showing duplication of the ventral fin fold (arrowheads). (B) The fin fold duplication is suppressed by 8 ng MO1. (C-H) Whole-mount in situ hybridization at 80% epiboly (animal pole views, dorsal towards the right) shows ventral marker eve1 expanded in uninjected mutants (C), whereas the dorsal marker foxb1.2 is reduced (D). Expression of these markers in mutants injected with 25 ng MO5 in E (n=16/22) and F (n=15/20) is similar to that seen in wild type (G,H).

 
RACE analysis of tsg1 maternal transcript
RT-PCR and in situ hybridization indicated that tsg1 transcripts are found in zebrafish one cell stage embryos (not shown). 5' RACE was performed to obtain the 5' untranslated sequence of maternal tsg1 mRNA using GeneRacer kit (Invitrogen), according to the manufacturer's instructions. The sequence we obtained (up to the first codon of the open reading frame) was 5' GCATTAGTTGAGTCTGCTCCAGTTTAGTTCTGCTCAGCTCAGAGTTCGGCGGTAAATGCTCTGCAGCAAAACCTCGTGAGTTCAACATCTTCATTCTCAAGGTCCGGTGGGCTCTGTTCGTGTCGTGATG 3'.

Morpholino and mRNA injections
Morpholinos were obtained from Gene Tools, LLC. Lyophilized powder was resuspended in water, then diluted into 1xDanieau buffer (Nasevicius and Ekker, 2000Go) for injection of 1 nl into one-cell stage embryos. The sequence of MO1 was as described by Ross et al. (Ross et al., 2001Go); MO4, 5' TAAACTGGAGCAGACTCAACTAATG 3'; MO5, 5' CGCCGAACTCTGAGCTGAGCAGAAC 3'; a four nucleotide mismatch MO to MO1 (mismatch MO1), 5' CTCATGTTGATGATGAACACCGCAT 3'; a 5 nucleotide mismatch MO to MO5 (mismatch MO5), 5' CCCCCAACTCTCAGCTCAGCACAAC 3'.

mRNA was in vitro transcribed as described (Nguyen et al., 1998Go) using SP6 mMessage mMachine kits (Ambion) and injected into embryos at the 1- to 2-cell stage. ztsg1 cDNA without its endogenous secretion signal was subcloned by PCR from zTsg1-pT3TS (a gift from M. O'Connor) into a derivative of pCS2 containing the Xenopus Chordin signal peptide and a FLAG epitope downstream of the signal peptide (Oelgeschläger et al., 2000Go). To create FLAG-tagged ztsg1 with its endogenous secretion signal, the Chordin secretion signal was replaced with ztsg1 sequence using standard molecular biology procedures.

tsg1 RNA was transcribed from these NotI linearized plasmids. tsg2 RNA was transcribed from pCS2-ztsg (a gift from M. Oelgeschläger and E. M. De Robertis) linearized with NotI. All injections were performed on at least three separate occasions. For rescue experiments, MO was injected first, followed by a second injection of mRNA into a random subset of the MO-injected embryos. Embryos injected with MO alone were then compared with those that were co-injected with mRNA.

Western blot analysis
Wild-type embryos were injected with mRNA encoding FLAG-tagged tsg1. A subset of these embryos were subsequently injected with 32 ng MO1 or mismatch MO1. Batches of five embryos were lysed in 20 µl SDS-PAGE loading buffer (Sambrook et al., 1989Go), boiled for five minutes, centrifuged for five minutes and the supernatants subject to SDS-PAGE analysis on 12% gels. After transferring to PVDF, membranes were probed with 1:1600 dilution of anti-FLAG antibody (Sigma) followed by 1:3000 dilution of HRP-conjugated sheep anti-mouse antibody (Amersham Biosciences) and detection with ECL plus western blotting detection kit (Amersham Biosciences) according to the manufacturer's instructions.

Cell death assay and in situ hybridization
Labeling with digoxigenin-conjugated nucleotides by terminal deoxynucleotidyl transferase was performed on embryos fixed in 4% paraformaldehyde using ApopTag Detection Kit (Intergen) according to the manufacturer's instructions. After incubation with alkaline phosphatase-conjugated anti-digoxigenin antibody, staining was performed with 330 mg/ml NBT and 170 mg/ml BCIP (Sigma). Whole mount in situ hybridization was performed as described (Nguyen et al., 1998Go) with probes against bmp4 (Chin et al., 1997Go), pax2.1 (Krauss et al., 1991Go), krox20 (Oxtoby and Jowett, 1993Go), myod (Weinberg et al., 1996Go), eve1 (Joly et al., 1993Go), gsc (Stachel et al., 1993Go), foxb1.2 (formerly fkd3) (Odenthal and Nüsslein-Volhard, 1998Go), dlx3 (Akimenko et al., 1994Go), gata2 (Detrich et al., 1995Go) and chd (Miller-Bertoglio et al., 1997Go). All images were taken from an MZ12.5 stereomicroscope (Leica) with a ColorSNAP-cf digital camera (Photometrics) and processed using Adobe Photoshop.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
No alterations in DV patterning by low level Tsg1 knockdown
To study the function of Tsg1 in early development, we injected an antisense MO oligonucleotide to inhibit Tsg1 translation. This MO, designated MO1, is complementary to the first 25 nucleotides of the tsg1 open reading frame and of identical sequence to a MO used previously (Ross et al., 2001Go). Injection of 8 ng of MO1 into wild-type embryos resulted in the formation of an edema in the ventral tail vein in 61% of embryos (Fig. 1A,B; Table 1). In these embryos, the tail vein is dilated and blood pools within it. This phenotype is first visible at about 28 hours post fertilization (hpf) as a mild edema, which becomes prominent by 48 hpf (Fig. 1A,B; Table 1). A less severe phenotype was evident in 24% of the embryos, as decreased blood flow through the ventral tail vein (not shown). In all MO-injected embryos, we observed a reduction in anterior tissues at 48 hpf (compare bars in Fig. 1A,B). Surprisingly, the morphants did not display duplications of ventral tail fin tissue, which are typical of ventralized zebrafish mutants (see Figs 5, 6). These defects are similar to those seen in a previous study (Ross et al., 2001Go), where it was concluded that tsg1 morphants resemble weakly ventralized zebrafish mutants.



View larger version (103K):
[in this window]
[in a new window]
 
Fig. 1. Low-level tsg1 knockdown causes a ventral tail vein edema and cell death in anterior structures, but does not alter patterning during early somitogenesis. Uninjected embryo (A); a wild-type embryo injected with 8 ng MO1 (B) displays a slightly reduced head and a large edema in, or dilation of, the ventral tail vein (arrowhead), in which the blood accumulates and circulation slows. (C) The vein edema can be rescued by injection of tsg1 mRNA (10% with edema phenotype, n=133, not shown) or tsg2 mRNA (8% with edema phenotype, n=106), whereas the reduction in head size is unaltered. Scale bars in A-C show the diameter of the eye as a measure of the extent of anterior tissues. TUNEL analysis as a measure of cell death in 24 hours post fertilization (hpf) uninjected wild-type (D) and 8 ng MO1-injected sibling (E) embryos. Cell death is not rescued by co-injection of tsg mRNA (F). (D-F) Anterior towards the left, dorsal view posterior to the MHB boundary. (G-N) Whole-mount in situ hybridization of uninjected embryos (G-J) or embryos injected with 8 ng MO1 (K-N). (G,K) Expression of pax2.1 (arrowhead) and krox20 (bracket) in the mid/hindbrain (MHB) boundary and rhombomeres 3 and 5, respectively. (H,L) More posterior views of the embryos in G and K. pax2.1 expression in the pronephric system (arrowheads) and myoD in anterior somitic mesoderm is unchanged. (I,M) Lateral views of untreated or injected embryos showing no alterations in anterior expression of pax2.1 in the eye field (asterisk). (J,N) Expression of bmp4 anteriorly (asterisk) and in the tail bud (arrowhead) at the three-somite stage is normal in injected embryos. Insets show tail bud views. (G-I,K-M) Eight somites. (J,N) Three somites. (G,H,K,L) Dorsal views with anterior upwards. (I,J,M,N) Lateral views, anterior is upwards.

 


View this table:
[in this window]
[in a new window]
 
Table 1. Vein edema phenotype and RNA rescue

 
To determine if patterning was affected in MO1-injected embryos, we examined gene expression markers of dorsally and ventrally derived tissues. During early somitogenesis stages, we did not observe changes in the expression of pax2.1 or krox20, which mark dorsal ectodermal gastrula derivatives of the midbrain-hindbrain boundary and rhombomeres 3 and 5, respectively (Fig. 1G,K), or the extent of myoD expression to indicate dorsal mesoderm (Fig. 1H,L). Neither did we observe alterations in ventrally derived tissue, as revealed by pax2.1 expression in the pronephric system (Fig. 1H,L) or bmp4 ventral tail bud expression (Fig. 1J,N). Additionally, the most anterior expression domains of bmp4 and pax2.1 were not altered (asterisks in Fig. 1I,J,M,N). Based on these results, we conclude that 8 ng of MO1 does not induce significant alterations in DV patterning. Thus, our results are incongruent with those of Ross et al. (Ross et al., 2001Go), who reported a reduction in dorsal markers and an expansion in ventral markers during somitogenesis stages. We subsequently injected doses of 12, 15, and 16 ng of MO1. Although we saw increased penetrance and severity of the vein phenotype, we did not observe alterations in the expression domains of pax2.1, krox20, myoD, bmp4 or gata2 with these amounts of MO (not shown).

As a change in early patterning could not account for the reduction of anterior structures at 48 hpf, we investigated if the defects were specific or non-specific effects of MO1. To test this, we co-injected in vitro transcribed tsg1 or tsg2 mRNA, which lack sequence complementary to MO1, and assayed for rescue of the defects. We found that either mRNA could rescue the vein edema in a large fraction of embryos (Fig. 1C, Table 1). However, we did not detect rescue of the anterior structures by co-injection of tsg mRNA (Fig. 1C). Examination of live embryos revealed a high degree of cell death that became prominent at 24 hpf, a common nonspecific effect of MOs (Heasman, 2002Go; Nasevicius and Ekker, 2000Go). To determine if the decrease in anterior structures could be attributed to cell death, we used a TUNEL-based assay to label the nuclei of dying cells. We observed a substantial increase in cell death in anterior CNS tissues of morphants (Fig. 1D,E), which could not be rescued by RNA co-injection (Fig. 1F). We attribute the reduction in anterior tissues at 48 hpf to nonspecific, MO-induced cell death.

Strong knockdown of Tsg1 results in dorsalization
We investigated whether the 8-16 ng tsg1 knockdown may be an incomplete loss of tsg1 function by examining the effects of injecting increasing amounts of MO1. We found that 32 ng of MO1 appeared to dorsalize the embryo moderately to moderately strong, similar to class 3 (C3) and class 4 (C4) dorsalizations (Table 2; Fig. 2K,O, not shown) (Mullins et al., 1996Go). At no dose did we observe defects consistent with a ventralization. To verify the specificity of MO1, we designed two additional MOs, MO4 and MO5, targeted against non-overlapping sequences in the 5' untranslated region. We found that injection of 32 ng of MO4 or 25 ng of MO5 induced a moderately strong dorsalization (Fig. 2; Table 2), similar to that of MO1.


View this table:
[in this window]
[in a new window]
 
Table 2. Dorsalization phenotype of tsg1 knockdown and RNA rescue

 



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 2. High level tsg1 knockdown dorsalizes the embryo. Uninjected embryos (A-E,K-M) compared with siblings injected with 25 ng MO5 (F-J,N,P,Q) or 32 ng MO1 (O). (A-J) Whole-mount in situ hybridization at 80% epiboly (mid-gastrulation); animal pole views, dorsal towards the right. Reduced ventral domain of eve1 (n=32/54), dlx3 (n=25/41) and gata2 (n=28/50) expression (A-C,F-H) and expanded foxb1.2 (n=34/46) and chordin (chd) (n=16/30) expression in dorsal regions (D,E,I,J) in injected compared with uninjected embryos (delineated by arrowheads) was observed. gsc expression in the dorsal midline prechordal plate mesoderm is not affected (A,F), similar to results in other dorsalized BMP signaling pathway mutants in zebrafish (Mullins et al., 1996Go; Nguyen et al., 1998Go). (K-Q) During somitogenesis, injected embryos display dorsalized characteristics similar to class 3 (N) and class 4 (O) dorsalized mutants, as assessed by the lateral extent of somites in live embryos (arrowheads in K,N,O), by whole-mount in situ hybridization with myod in anterior somitic mesoderm (M,P,Q), and by expansion of pax2.1 (arrowhead) and krox20 (bracket) expression in the MHB and rhombomeres 3 and 5, respectively (L,Q). The embryos in N,P display a class 3 or moderate dorsalization, whereas those in O,Q exhibit a greater expansion of the somitic mesoderm and neural tissue, similar to a class 4 dorsalization. (L) Dorsoanterior view; (M) a more posterior view of the same uninjected embryo. (R) Anti-FLAG western blot on lysates of embryos injected with FLAG-tagged tsg1 alone or with 32 ng MO1 or mismatch MO1. Bars to the left of the blot represent the positions of protein standards with molecular weights of 50, 37 and 25 kDa.

 
We assayed patterning during gastrulation and early somitogenesis to determine if the presumptive dorsalization reflects a change in pattern formation. During mid-gastrula stages, we found that morphants displayed more restricted expression domains of the ventral markers eve1, dlx3, and gata2 (Fig. 2A-C,F-H). Concomitantly, the expression of foxb1.2 and chordin, which are normally dorsally restricted, were expanded into lateral domains (Fig. 2D,E,I,J), consistent with an alteration in DV patterning during the gastrula period when BMP signaling is thought to act. During early somitogenesis, we examined injected embryos for expression of pax2.1, krox20 and myoD, and found that all expression domains of dorsally derived tissues were expanded (Fig. 2L,M,P,Q), indicating a dorsalized phenotype. As controls for the specificity of the dorsalized appearance, we injected up to 60 ng of two different mismatch MOs, which did not cause dorsalization (not shown). To test for the ability of the MOs to block translation, we injected 32 ng of MO1 or its four base mismatch control into embryos that were co-injected with a FLAG-tagged tsg1 mRNA containing the MO1 binding site. We found that MO1 blocked translation of tsg1, whereas the mismatch control did not (Fig. 2R). Furthermore, we could partially rescue the MO-induced dorsalization by co-injection of 2 pg of tsg1 mRNA (Table 2). Taken together, these results demonstrate that a strong knockdown of Tsg1 function by high levels of tsg1 MO induces specific dorsalization phenotypes, strongly suggesting that the in vivo role of Tsg1 in zebrafish is to promote the specification of ventral cell fates.

Tsg genetically interacts with Bmp2b
To examine if Tsg1 promotes ventral cell fates by promoting BMP signaling, we tested whether tsg1 interacts genetically with known BMP pathway component mutants. We injected a sub-dorsalizing amount of tsg1 MO1 (16 ng) into embryos from a cross between a swirl (bmp2b) heterozygote and a wild type fish. In contrast to the uninjected, phenotypically wild type swirl (bmp2b) heterozygotes, greater than 95% of the tsg1 MO-injected heterozygotes displayed dorsalized phenotypes at 24 hpf, ranging from weak (class 1, 13%; class 2, 36%), moderate (class 3, 28%) to strong (class 4, 21%) (Fig. 3B-D; Table 3). Importantly, 90% of injected wild-type sibling embryos were not dorsalized (Fig. 3A and Table 3). Dorsalization was also evident during somitogenesis by an expansion of dorsally expressed markers in the MO1-injected swirl heterozygotes (Fig. 3E-J). Furthermore, we found that 12 pg of bmp2b mRNA or 20 pg of mRNA encoding the intracellular BMP effector Smad5 could rescue the tsg1 MO5 dorsalization (Table 2). Our ability to rescue Tsg loss-of-function with multiple components of a BMP signaling pathway, as well as the genetic interaction between loss of swirl (bmp2b) and tsg1 function indicates that Tsg1 functions endogenously to promote BMP signaling in dorsoventral patterning.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 3. Interaction between sub-dorsalizing tsg1 knockdown and swirl (bmp2b) heterozygotes. All embryos were injected with 16 ng tsg1 MO. At 24 hpf, an injected wild-type embryo was not dorsalized (A), whereas injected swirl (bmp2b) heterozygous siblings were dorsalized. The extent of dorsalization was categorized as follows: (B) weak, class 1 (arrowhead indicates partial loss of the ventral tail fin); (C) moderate, class 3; and (D) strong, class 4. (E-J) Whole-mount in situ hybridization of myod, pax2a and krox20 in 16 ng tsg1 MO1 injected embryos at the eight-somite stage. Injected wild-type embryos were not affected (E,F), whereas heterozygotes displayed a range of dorsalizations (G,H, moderate; I, strong; J, stronger). (F,H) More posterior views of the same embryos shown in E,G, respectively. (J) The somites extend around the circumference, which is typical of a strong, class 4 dorsalization.

 


View this table:
[in this window]
[in a new window]
 
Table 3. Dorsalization of bmp2b (swirl) heterozygotes by sub-dorsalizing tsg1 knockdown

 
Tsg cooperates with tolloid (mini fin) to promote BMP signaling
As discussed above, previous work in Xenopus suggests that the pro-BMP activity of Tsg depends on the ability of Tolloid to cleave Chordin into fragments (Larrain et al., 2001Go). These fragments contain residual anti-BMP activity, which Tsg can inactivate. To address whether Mini Fin (Mfn) (Tolloid) is required for Tsg1 function, we injected 12.5 ng of MO5 into the progeny of a cross of mfntm124a heterozygous adults, which carry a presumptive null mutation in tolloid (Connors et al., 1999Go). The mfn mutation produces a weakly dorsalized (class 1) phenotype, which is characterized by loss of ventral fin fold tissue (Fig. 4A,B) (Connors et al., 1999Go). Whereas most (94%, Table 4) tsg1 MO5-injected wild-type or heterozygous siblings were not dorsalized, a large majority of mfn homozygous mutants (76%, Table 4) exhibited a significantly stronger dorsalized phenotype (class 3, Fig. 4C,E) than did uninjected mfn mutants (Fig. 4B,D). These results indicate that Tsg1 ventralizing activity does not depend on the product of the mfn gene or the ability of Mfn to generate Chordin fragments. Additionally, this result uncovers a previously undetected role for Mfn/Tolloid in patterning dorsoanterior tissues, which remain unaltered in mfn mutants (Connors et al., 1999Go; Mullins et al., 1996Go), but are expanded by injection of tsg1 MO at amounts insufficient to alter wild-type siblings.



View larger version (119K):
[in this window]
[in a new window]
 
Fig. 4. Knockdown of Tsg function enhances dorsalization in mini fin (tolloid) mutants. (A) Wild-type and (B) mfn homozygous mutant embryo at 1 dpf. Arrowheads indicate normal and deficient ventral tail tissue. Injection of 12.5 ng MO5 into mfn/mfn embryos results in a moderate class 3 dorsalization (C). The increase in phenotypic strength is seen at the four-somite stage with the lateral expansion of somites in injected (E) mfn homozygotes (arrowheads) compared with uninjected (D).

 


View this table:
[in this window]
[in a new window]
 
Table 4. Enhancement of mfn/mfn dorsalization by sub-dorsalizing tsg1 knockdown

 
Tsg does not require Chordin or Sizzled (Ogon) to function as a ventralizing factor
We tested the genetic interaction between Chordin and Tsg1 loss of function. In Xenopus, low levels of Tsg overexpressed simultaneously with Chordin lead to additive dorsalization (Chang et al., 2001Go; Ross et al., 2001Go; Scott et al., 2001Go), whereas higher levels of Tsg can release BMP from Chordin fragments and promote ventralization (Oelgeschlager et al., 2000Go; Ross et al., 2001Go). Thus, Tsg might function exclusively through Chordin, and consequently the chordino (chordin) mutation may be epistatic to Tsg loss of function. A zebrafish chordino null mutation causes a moderate ventralized phenotype, including a reduction in dorsoanterior neural and somitic mesodermal tissue, expansion of the ventrally derived blood and duplications in the ventral fin fold (Fig. 5A) (Hammerschmidt et al., 1996Go). The expected protein product of this mutant chordin allele lacks all its BMP-binding domains (Fisher and Halpern, 1999Go; Schulte-Merker et al., 1997Go). We found that injection of 8 ng of MO1 into chordino mutants could suppress duplications of the ventral tail fin fold (Fig. 5B; Table 5), not supporting a mechanism in which chordino is epistatic to tsg1. Additionally, chordino null mutants injected with 25 ng of MO5 displayed more prominent dorsoanterior neural and somitic mesodermal tissue during early somitogenesis stages, compared with uninjected mutant siblings (Fig. 5C-H), indicating a partial suppression of these ventralized defects as well (compare with wild-type embryos; Fig. 2L,M). Thus, the endogenous ventralizing activity of Tsg1 does not rely exclusively on the presence of Chordin or Chordin fragments.


View this table:
[in this window]
[in a new window]
 
Table 5. Suppression of dino and ogon ventral fin fold duplication by sub-dorsalizing tsg1 knockdown

 
Similarly, we tested whether Tsg depends on Sizzled (Ogon) activity. At 24 hpf, ogon mutants display a mild ventralization, which includes multiple ventral fin folds and expanded blood precursors (Fig. 6A) (Hammerschmidt et al., 1996Go; Miller-Bertoglio et al., 1999Go; Solnica-Krezel et al., 1996Go). When injected with 8 ng MO1, however, ogon mutants displayed a single ventral fin fold, similar to the suppression seen in chordino mutants (Fig. 6B; Table 5). Additionally, injection of 20 ng of MO5 into ogon mutants suppressed the expansion of a ventral marker (eve1, Fig. 6C,E) and the restriction of a dorsal marker (foxb1.2, Fig. 6D,F) during gastrulation. These results indicate that Tsg1 can promote BMP signaling when the BMP antagonistic function of Ogon is deficient. Our observations that tsg1 MO can partially suppress both the chordino and ogon mutant phenotypes is consistent with the dependence of Sizzled (Ogon) dorsalizing activity on the function of Chordin (Yabe et al., 2003Go).

tsg1 overexpression dorsalizes wild type, and suppresses dino and ogon
Surprisingly, like the tsg1 knockdown phenotype, Tsg overexpression also dorsalizes the zebrafish embryo (see also Ross et al., 2001Go). We injected various amounts of tsg1 mRNA into wild-type embryos and monitored DV patterning by in situ hybridization with pax2.1, krox20 and myoD at the eight-somite stage. We found that 100-200 pg of tsg1 mRNA caused a moderate, lateral expansion of all three markers (Fig. 7A-E), and mild to moderate dorsalized phenotypes at 1 day post fertilization (dpf) (Table 6; Fig. 7F-I). About half of the mildly dorsalized embryos (class 1 or class 2, Fig. 7G,H) also displayed small duplications in the fin fold (Fig. 7H inset), similar to overexpression of Xenopus Tsg mRNA in zebrafish (Oelgeschlager et al., 2003Go) and some weakly dorsalized mutants (Kramer et al., 2002Go). Higher amounts of tsg1 mRNA caused more severely dorsalized phenotypes (not shown). Lower amounts had negligible effects. At no dose did we observe ventralized phenotypes.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 7. Overexpression of tsg1 RNA causes dorsalization. (A-E) Whole-mount in situ hybridization with pax2.1 (arrowhead), krox20 (brackets) and myod reveals expansion of all three markers in embryos injected with 200 pg tsg1 RNA (C-E) relative to wild type (A,B). (B,D) More posterior views of embryos shown in A and C, respectively. (C,D) Mildly dorsalized and (E) moderately dorsalized embryos. (F-I) At 1 dpf, embryos injected with 100 pg tsg1 RNA show a range of dorsalized phenotypes. (F) Uninjected sibling. (G) Class 1 dorsalization, arrowhead indicates gap in ventral tail fin. (H) Class 2 dorsalization, inset shows duplication in fin fold tissue seen in 50% of class 1 and class 2 embryos. (I) Class 3 phenotype.

 


View this table:
[in this window]
[in a new window]
 
Table 6. tsg1 overexpression

 
We also injected tsg1 mRNA into ventralized mutant embryos. We intercrossed chordino (dino) heterozygotes, injected their progeny with 75-150 pg tsg1 mRNA, then scored and genotyped the embryos. The majority of homozygotes retained a ventralized phenotype (Table 6) and could be readily distinguished from wild-type and heterozygous siblings. Frequently, this class displayed a partial loss of proximal ventral fin fold tissue, but maintained multiple distal fin duplications (not shown), a phenotype seen in dino-/-; swirl+/- mutants and in a small fraction of dino mutants (Wagner and Mullins, 2002Go; Hammerschmidt and Mullins, 2002Go). In addition, 39% of dino mutants exhibited either a partial or complete suppression of the ventralization or a dorsalized phenotype. Thirty-four percent of homozygous mutants displayed weakly dorsalized phenotypes, indistinguishable from those seen in wild-type or heterozygous injected siblings. Additionally, a small fraction (5%) of dino mutants were rescued to a nearly wild-type phenotype (Table 6), showing that overexpressed Tsg can suppress the absence of Chordin, consistent with overexpressed Tsg antagonizing BMP signaling. Similar results were seen with sizzled (ogon) mutants injected with 75-200 pg of tsg1 mRNA (Table 6), which normally display a weakly ventralized phenotype.

Overall, these experiments show that overexpressed Tsg can antagonize ventral cell fate specification in wild-type and mutant backgrounds. However, our loss-of-function results indicate that endogenous Tsg1 promotes ventral cell fate specification. It is possible that Tsg1 acts as a crucial component of a BMP-promoting complex that cannot form in either the absence of Tsg1 or the presence of excess Tsg (see Discussion).


    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Here, we demonstrate that a strong knockdown of Tsg1 dorsalizes the zebrafish embryo, indicating that in zebrafish Tsg1 functions predominantly as a ventralizing factor in DV patterning. We demonstrate a genetic interaction between tsg and bmp2b (swirl), consistent with Tsg promoting BMP signaling. Sub-dorsalizing knockdown of tsg1 increases the severity of the tolloid (mini fin) mutant, suggesting that Tsg1 and Mini fin cooperate to pattern anterior tissue, a function not previously attributed to Mini fin (Tolloid). Furthermore, we show that Tsg functions as a ventralizing factor, in part, independently of the dorsalizing factors Chordin and Sizzled (Ogon). In contrast to the strong dorsalizations observed in null bmp2b (swirl), bmp7 (snailhouse), MZ-alk8 (lost-a-fin) and MZ-smad5 (somitabun) mutants (Bauer et al., 2001Go; Kramer et al., 2002Go; Mintzer et al., 2001Go; Schmid et al., 2000Go), we found that the strongest tsg1 knockdown phenotype is a moderately strong dorsalization of the embryo. As we do not know if Tsg1 function is completely knocked down, the moderately strong dorsalization may reflect the complete or partial role of Tsg1 in DV patterning and BMP signal modulation. Nevertheless, our results demonstrate a clear role in the zebrafish for Tsg1 as an agonist in BMP signaling during DV pattern formation.

A previous model of Tsg function suggests that full-length Chordin causes Tsg to act as a BMP antagonist, whereas the presence of Chordin fragments allows Tsg to exhibit pro-BMP behavior (Larrain et al., 2001Go). Thus, the activity of Tsg may depend on the cleavage status of Chordin. However, the partial suppression of the chordin mutant phenotype by Tsg1 knockdown indicates that endogenous Tsg1 acts as a ventralizing factor in a manner that does not rely entirely on Chordin. These results are consistent with the finding that an overexpressed mutant Tsg that cannot bind BMPs reduces ventral tissues to a greater extent than loss of Chordin alone (Oelgeschlager et al., 2003Go). Thus, Tsg1 may promote BMP signaling in part by inactivating BMP antagonists in addition to Chordin or Chordin fragments.

However, as tsg1 knockdown only partially suppresses the dino ventralized phenotype and tsg1 is not epistatic to dino, Tsg1 probably also inactivates Chordin in conjunction with Tolloid, as previous studies indicate (Larrain et al., 2001Go; Oelgeschlager et al., 2000Go). Moreover, as dino mutants display a range of phenotypes from a mild ventralization that is viable to a moderate ventralization that is lethal (Fisher and Halpern, 1999Go), it is possible that loss of tsg1 affects the range of dino phenotypes, with the mild phenotype becoming predominant. This could be a direct effect of Tsg on other antagonists, as discussed above, or it could be indirect by unknown mechanism(s) that also modulate the dino phenotype.

Tsg has been reported to enhance Tolloid proteolysis of Chordin (Larrain et al., 2001Go; Scott et al., 2001Go; Shimmi and O'Connor, 2003Go; Yu et al., 2000Go). We found that a sub-dorsalizing knockdown of Tsg1 in wild type exacerbates the mildly dorsalized phenotype of mini fin (tolloid) mutants (Fig. 5), suggesting a previously unknown role for Mini fin (Tolloid) in patterning rostral tissues in zebrafish (Connors et al., 1999Go; Mullins et al., 1996Go). There is evidence that additional Tolloid-related enzymes function during gastrulation (J. Xie and S. Fisher, personal communication), which may normally mask the loss of mini fin (tolloid) during these stages. If Tsg1 increases the rate of proteolysis of multiple Tolloid enzymes, then loss of Tsg could dorsalize the embryo by reducing the ability of multiple Tolloid factors to degrade their targets.

If endogenous Tsg1 promotes ventral cell fates by facilitating BMP signaling, why does Tsg1 overexpression dorsalize the embryo, reflecting a loss of BMP signaling? One possibility is that Tsg functions in a multi-component protein complex, binding both to a BMP ligand, as previously shown (Chang et al., 2001Go; Larrain et al., 2001Go; Oelgeschlager et al., 2000Go; Ross et al., 2001Go; Scott et al., 2001Go), and at least one other factor required to promote BMP signaling. Loss of Tsg would disrupt formation of this complex and result in decreased BMP signaling. Excess Tsg would bind independently to both free BMP ligands and the other factor in the complex, again preventing formation of the trimolecular complex and reducing BMP signaling. Thus, both the loss- and gain-of-function phenotypes would cause the same defect (Fig. 8). A similar phenomenon is also observed in the loss- and gain-of-function phenotypes of some Wnt planar cell polarity components and other genes (Gubb et al., 1999Go; Hiromi et al., 1993Go; Krasnow and Adler, 1994Go; Strutt et al., 1997Go; Tomlinson et al., 1997Go).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 8. Model of Tsg function.

 
In the mouse, Tsg mutants do not display defects in DV patterning of the embryonic axis (Nosaka et al., 2003Go; Petryk et al., 2004Go; Zakin and De Robertis, 2004Go). However, they do exhibit several other defects consistent with possible roles in either promoting or inhibiting BMP signaling. For example, thymocytes from Tsg-/- animals show increased phospho-Smad1 levels, suggesting an increase in BMP signaling in the absence of Tsg (Nosaka et al., 2003Go). Tsg-/- mice also display defective skeletogenesis, similar to the effect of a dominant-negative BMP receptor (Nosaka et al., 2003Go; Zakin and De Robertis, 2004Go), indicating a possible defect in BMP signaling. Interestingly, a genetic interaction is also observed in the mouse, as we observe in zebrafish, between a tsg and BMP mutation. Tsg-/-;Bmp4+/- animals display holoprosencephaly and craniofacial defects, not seen in either Tsg mutant animals or Bmp4 heterozygotes (Zakin and De Robertis, 2004Go). These results support a role for Tsg in promoting BMP signaling in head development in the mouse.

In contrast to our study, a recent loss of function study in Xenopus reports that MO-induced knockdown of Tsg causes ventralization, indicating that Tsg predominantly inhibits BMP signaling in Xenopus (Blitz et al., 2003Go). Tsg knockdown in Xenopus mildly restricts a small fraction of dorsally expressed genes during midgastrulation, with more substantial changes evident during neurula stages. These findings led to the conclusion that in Xenopus Tsg maintains the specification of dorsal cell fates, presumably after BMP signaling has patterned the early DV axis. We find that Tsg1 knockdown in zebrafish causes a moderately strong dorsalization in pattern formation during gastrulation. It is possible that Tsg acts oppositely at different stages and/or activity levels to affect the DV pattern of the embryo or functions in a nonconserved manner in these two organisms.

In Drosophila, Tsg also modulates BMP signaling during DV axial patterning. Tsg functions similarly to the Chordin ortholog Short gastrulation (Sog) in specifying the dorsal-most tissue, the amnioserosa, which requires the highest levels of BMP signaling in the fly embryo (Ashe and Levine, 1999Go; Francois et al., 1994Go; Mason et al., 1994Go; Ross et al., 2001Go; Zusman and Wieschaus, 1985Go). In addition to this pro-BMP activity, both Tsg and Sog exhibit anti-BMP activity in dorsolateral regions of the embryo (Ross et al., 2001Go). Current models suggest that Sog and Tsg bind to and transport BMP ligands toward dorsal regions of the embryo, where they are released from Sog by the activity of Tolloid, thereby generating the highest levels of BMP signal dorsally (Decotto and Ferguson, 2001Go; Eldar et al., 2002Go; Shimmi and O'Connor, 2003Go). In this model, the activity of Tsg relies on the presence of Sog and Tolloid. In vertebrates, there is no evidence for a role for Chordin in promoting gastrula BMP signaling, although it is possible it plays such a role at later stages in tail patterning (Hammerschmidt and Mullins, 2002Go; Wagner and Mullins, 2002Go). Thus, all aspects of how Sog/Chordin and Tsg function in DV patterning in vertebrates and invertebrates may not be conserved.

In zebrafish, Tsg1 could act as a BMP antagonist at other stages of development or under particular conditions that we did not detect in our studies. We do not know the nature of the tail vein edema phenotype observed in low level Tsg knockdown embryos (Fig. 1). It may reflect its role as a BMP antagonist, as chordin mutants exhibit a similar edema, although in conjunction with other ventralized defects, which we do not detect in tsg1 morphants. It is likely that the timing, location and/or levels of expression of Tsg, possibly with other factors, are crucial in determining whether Tsg functions to promote or antagonize BMP signaling in different developmental contexts. In zebrafish, the mechanism by which Tsg promotes BMP signaling, and the identity of any additional Tsg-interacting factors, remains unclear. Further work will be required to determine how Tsg acts in relation to other BMP modulating factors, in order to elucidate the mechanism by which Tsg promotes BMP signaling.


    ACKNOWLEDGMENTS
 
We thank M. Oelgeschläger and E. M. De Robertis for the tsg2 clone and pCS2 secretion vector, and M. O'Connor for the tsg1 clone. We are grateful to J. Xie and S. Fisher for communicating their work prior to publication. We thank D. Wagner for many helpful discussions; and R. Dosch, T. Gupta, F. Marlow and J. Schumacher for comments on the manuscript and other advice. This work was supported by NIH grant GM56326 and a Developmental Grant Award from the Center for FOP and Related Disorders to M.C.M. and training grants 5 T32 GM07229-28 and 2 T32 HD007516-05 to S.C.L.


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 

Ashe, H. L. and Levine, M. (1999). Local inhibition and long-range enhancement of Dpp signal transduction by Sog. Nature 398,427 -431.[CrossRef][Medline]

Akimenko, M.-A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994). Combinatorial expression of three zebrafish genes related to distal-less: part of a homeobox gene code for the head. J. Neurosci. 14,3475 -3486.[Abstract]

Bauer, H., Lele, Z., Rauch, G. J., Geisler, R. and Hammerschmidt, M. (2001). The type I serine/threonine kinase receptor Alk8/Lost-a-fin is required for Bmp2b/7 signal transduction during dorsoventral patterning of the zebrafish embryo. Development 128,849 -858.[Abstract]

Blitz, I. L., Cho, K. W. and Chang, C. (2003). Twisted gastrulation loss-of-function analyses support its role as a BMP inhibitor during early Xenopus embryogenesis. Development 130,4975 -4988.[Abstract/Free Full Text]

Chang, C., Holtzman, D. A., Chau, S., Chickering, T., Woolf, E. A., Holmgren, L. M., Bodorova, J., Gearing, D. P., Holmes, W. E. and Brivanlou, A. H. (2001). Twisted gastrulation can function as a BMP antagonist. Nature 410,483 -487.[CrossRef][Medline]

Chin, A. J., Chen, J. N. and Weinberg, E. S. (1997). Bone morphogenic protein-4 expression characterizes inductive boundaries in organs of developing zebrafish. Dev. Genes Evol. 207,107 -114.[CrossRef]

Connors, S. A., Trout, J., Ekker, M. and Mullins, M. C. (1999). The role of tolloid/mini fin in dorsoventral pattern formation of the zebrafish embryo. Development 126,3119 -3130.[Abstract]

De Robertis, E. M. and Sasai, Y. (1996). A common plan for dorsoventral patterning in Bilateria. Nature 380,37 -40.[CrossRef][Medline]

De Robertis, E. M., Larrain, J., Oelgeschlager, M. and Wessely, O. (2000). The establishment of Spemann's organizer and patterning of the vertebrate embryo. Nat. Rev. Genet. 1, 171-181.[CrossRef][Medline]

Decotto, E. and Ferguson, E. L. (2001). A positive role for Short gastrulation in modulating BMP signaling during dorsoventral patterning in the Drosophila embryo. Development 128,3831 -3841.[Abstract/Free Full Text]

Detrich, H. W., Kieran, M. W., Chan, F. Y., Barone, L. M., Yee, K., Rundstadler, J. A. and Zon, L. I. (1995). Intraembryonic hematopoietic cell migration during vertebrate development. Proc. Natl. Acad. Sci. USA 92,10713 -10717.[Abstract/Free Full Text]

Dick, A., Hild, M., Bauer, H., Imai, Y., Maifeld, H., Schier, A. F., Talbot, W. S., Bouwmeester, T. and Hammerschmidt, M. (2000). Essential role of Bmp7 (snailhouse) and its prodomain in dorsoventral patterning of the zebrafish embryo. Development 127,343 -354.[Abstract]

Eldar, A., Dorfman, R., Weiss, D., Ashe, H., Shilo, B. Z. and Barkai, N. (2002). Robustness of the BMP morphogen gradient in Drosophila embryonic patterning. Nature 419,304 -308.[CrossRef][Medline]

Fisher, S. and Halpern, M. E. (1999). Patterning the zebrafish axial skeleton requires early chordin function. Nat. Genet. 23,442 -446.[CrossRef][Medline]

Francois, V., Solloway, M., O'Neill, J. W., Emery, J. and Bier, E. (1994). Dorsal-ventral patterning of the Drosophila embryo depends on a putative negative growth factor encoded by the short gastrulation gene. Genes Dev. 8,2602 -2616.[Abstract/Free Full Text]

Gubb, D., Green, C., Huen, D., Coulson, D., Johnson, G., Tree, D., Collier, S. and Roote, J. (1999). The balance between isoforms of the prickle LIM domain protein is critical for planar polarity in Drosophila imaginal discs. Genes Dev. 13,2315 -2327.[Abstract/Free Full Text]

Hammerschmidt, M. and Mullins, M. C. (2002). Dorsoventral patterning in the zebrafish: bone morphogenetic proteins and beyond. In Pattern Formation in Zebrafish, Vol.40 (ed. L. Solnica-Krezel), pp.219 -255. Heidelberg, Germany: Springer-Verlag.

Hammerschmidt, M., Pelegri, F., Mullins, M. C., Kane, D. A., van Eeden, F. J. M., Granato, M., Brand, M., Furutani-Seiki, M., Haffter, P., Heisenberg, C.-P. et al. (1996). dino and mercedes, two genes regulating dorsal development in the zebrafish embryo. Development 123,95 -102.[Abstract]

Heasman, J. (2002). Morpholino oligos: making sense of antisense? Dev. Biol. 243,209 -214.[CrossRef][Medline]

Hiromi, Y., Mlodzik, M., West, S. R., Rubin, G. M. and Goodman, C. S. (1993). Ectopic expression of seven-up causes cell fate changes during ommatidial assembly. Development 188,1123 -1135.

Hogan, B. L. (1996). Bone morphogenic proteins: mulitifunctional regulators of vertebrate development. Genes Dev. 10,1580 -1594.[Free Full Text]

Holley, S. A. and Ferguson, E. L. (1997). Fish are like flies are like frogs: conservation of dorsal-ventral patterning mechanisms. BioEssays 19,281 -284.[CrossRef][Medline]

Joly, J. S., Joly, C., Schulte-Merker, S., Boulekbache, H. and Condamine, H. (1993). The ventral and posterior expression of the zebrafish homeobox gene eve1 is perturbed in dorsalized and mutant embryos. Development 119,1261 -1275.[Abstract]

Kishimoto, Y., Lee, K. H., Zon, L., Hammerschmidt, M. and Schulte-Merker, S. (1997). The molecular nature of zebrafish swirl: BMP2 function is essential during early dorsoventral patterning. Development 124,4457 -4466.[Abstract]

Kramer, C., Mayr, T., Nowak, M., Schumacher, J., Runke, G., Bauer, H., Wagner, D. S., Schmid, B., Imai, Y., Talbot, W. S. et al. (2002). Maternally supplied smad5 is required for ventral specification in zebrafish embryos prior to zygotic Bmp signaling. Dev. Biol. 250,263 -279.[CrossRef][Medline]

Krasnow, R. E. and Adler, P. N. (1994). A single frizzled protein has a dual function in tissue polarity. Development 120,1883 -1893.[Abstract]

Krauss, S., Johansen, T., Korzh, V. and Fjose, A. (1991). Expression pattern of zebrafish pax genes suggests a role in early brain Regionalization. Nature 353,267 -270.[CrossRef][Medline]

Larrain, J., Oelgeschlager, M., Ketpura, N. I., Reversade, B., Zakin, L. and de Robertis, E. M. (2001). Proteolytic cleavage of Chordin as a switch for the dual activities of Twisted gastrulation in BMP signaling. Development 128,4439 -4447.[Medline]

Mason, E. D., Konrad, K. D., Webb, C. D. and Marsh, J. L. (1994). Dorsal midline fate in Drosophila embryos requires twisted gastrulation, a gene encoding a secreted protein related to human connective tissue growth factor. Genes Dev. 8,1489 -1501.[Abstract/Free Full Text]

Miller-Bertoglio, V., Fisher, S., Sanchez, A., Mullins, M. C. and Halpern, M. E. (1997). Differential regulation of chordin expression domains in mutant zebrafish. Dev. Biol. 192,537 -550.[CrossRef][Medline]

Miller-Bertoglio, V., Carmany-Rampey, A., Furthauer, M., Gonzalez, E. M., Thisse, C., Thisse, B., Halpern, M. E. and Solnica-Krezel, L. (1999). Maternal and zygotic activity of the zebrafish ogon locus antagonizes BMP signaling. Dev. Biol. 214,72 -86.[CrossRef][Medline]

Mintzer, K. A., Lee, M. A., Runke, G., Trout, J., Whitman, M. and Mullins, M. C. (2001). Lost-a-fin encodes a type I BMP receptor, Alk8, acting maternally and zygotically in dorsoventral pattern formation. Development 128,859 -869.[Abstract]

Mullins, M. C. (1998). Holy Tolloido: Tolloid cleaves Sog/Chordin to free DPP/Bmps. Trends Genet. 14,127 -129.[CrossRef][Medline]

Mullins, M. C., Hammerschmidt, M., Kane, D. A., Odenthal, J., Brand, M., van Eeden, F. J. M., Furutani-Seiki, M., Granato, M., Haffter, P., Heisenberg, C.-P. et al. (1996). Genes establishing dorsoventral pattern formation in the zebrafish embryo: the ventral specifying genes. Development 123, 81-93.[Abstract]

Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene `knockdown' in zebrafish. Nat. Genet. 26,216 -220.[CrossRef][Medline]

Nguyen, V. H., Schmid, B., Trout, J., Connors, S. A., Ekker, M. and Mullins, M. C. (1998). Ventral and lateral regions of the zebrafish gastrula, including the neural crest progenitors, are established by a bmp2b/swirl pathway of genes. Dev. Biol. 199,93 -110.[CrossRef][Medline]

Nosaka, T., Morita, S., Kitamura, H., Nakajima, H., Shibata, F., Morikawa, Y., Kataoka, Y., Ebihara, Y., Kawashima, T., Itoh, T. et al. (2003). Mammalian Twisted gastrulation is essential for skeletolymphogenesis. Mol. Cell. Biol. 23,2969 -2980.[Abstract/Free Full Text]

Odenthal, J. and Nüsslein-Volhard, C. (1998). fork head domain genes in zebrafish. Dev. Genes Evol. 208,245 -258.[CrossRef][Medline]

Oelgeschlager, M., Larrain, J., Geissert, D. and de Robertis, E. M. (2000). The evolutionarily conserved BMP-binding protein Twisted gastrulation promotes BMP signalling. Nature 405,757 -763.[CrossRef][Medline]

Oelgeschlager, M., Reversade, B., Larrain, J., Little, S., Mullins, M. C. and de Robertis, E. M. (2003). The pro-BMP activity of Twisted gastrulation is independent of BMP binding. Development 130,4047 -4056.[Abstract/Free Full Text]

Oxtoby, E. and Jowett, T. (1993). Cloning of the zebrafish krox-20 gene (krx-20) and its expression during hindbrain development. Nucleic Acids Res. 21,1087 -1095.[Abstract/Free Full Text]

Petryk, A., Anderson, R. M., Jarcho, M. P., Leaf, I., Carlson, C. S., Klingensmith, J., Shawlot, W. and O'Connor, M. B. (2004). The mammalian twisted gastrulation gene functions in foregut and craniofacial development. Dev. Biol. 267,374 -386.[CrossRef][Medline]

Ross, J. J., Shimmi, O., Vilmos, P., Petryk, A., Kim, H., Gaudenz, K., Hermanson, S., Ekker, S. C., O'Connor, M. B. and Marsh, J. L. (2001). Twisted gastrulation is a conserved extracellular BMP antagonist. Nature 410,479 -483.[CrossRef][Medline]

Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Schmid, B., Furthauer, M., Connors, S. A., Trout, J., Thisse, B., Thisse, C. and Mullins, M. C. (2000). Equivalent genetic roles for bmp7/snailhouse and bmp2b/swirl in dorsoventral pattern formation. Development 127,957 -967.[Abstract]

Schulte-Merker, S., Lee, K. J., McMahon, A. P. and Hammerschmidt, M. (1997). The zebrafish organizer requires chordino. Nature 387,862 -863.[CrossRef][Medline]

Scott, I. C., Blitz, I. L., Pappano, W. N., Maas, S. A., Cho, K. W. and Greenspan, D. S. (2001). Homologues of Twisted gastrulation are extracellular cofactors in antagonism of BMP signalling. Nature 410,475 -478.[CrossRef][Medline]

Shimmi, O. and O'Connor, M. B. (2003). Physical properties of Tld, Sog, Tsg and Dpp protein interactions are predicted to help create a sharp boundary in Bmp signals during dorsoventral patterning of the Drosophila embryo. Development 130,4673 -4682.[Abstract/Free Full Text]

Solnica-Krezel, L., Stemple, D. L., Mountcastle-Shah, E., Rangini, Z., Neuhauss, S. C. F., Malicki, J., Schier, A. F., Stanier, D. Y. R., Zwartkruis, F., Abdelilah, S. et al. (1996). Mutations affecting cell fates and cellular rearrangements during gastrulation in zebrafish. Development 123, 67-80.[Abstract]

Stachel, S. E., Grunwald, D. J. and Myers, P. Z. (1993). Lithium perturbation and goosecoid expression identify a dorsal specification pathway in the pregastrula zebrafish. Development 117,1261 -1274.[Abstract]

Strutt, D. I., Weber, U. and Mlodzik, M. (1997). The role of RhoA in tissue polarity and Frizzled signaling. Nature 387,292 -295.[CrossRef][Medline]

Thomsen, G. H. (1997). Antagonism within and around the organizer: BMP inhibitors in vertebrate body patterning. Trends Genet. 13,209 -211.[CrossRef][Medline]

Tomlinson, A., Strapps, W. R. and Heemskerk, J. (1997). Linking Frizzled and Wnt signaling in Drosophila development. Development 124,4515 -4521.[Abstract]

Wagner, D. S. and Mullins, M. C. (2002). Modulation of BMP activity in dorsal-ventral pattern formation by the Chordin and Ogon antagonists. Dev. Biol. 245,109