|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 3 November 2004
doi: 10.1242/dev.01464
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Cell and Developmental Biology, University of Pennsylvania School of Medicine, 1211 BRBII/III, 421 Curie Boulevard, Philadelphia, PA 19104-6058, USA
* Author for correspondence (e-mail: mullins{at}mail.med.upenn.edu)
Accepted 23 September 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Twisted gastrulation, BMP signaling, Bone morphogenetic protein, Chordin, Zebrafish
| Introduction |
|---|
|
|
|---|
Conversely, zebrafish mutants of the BMP antagonizing genes
chordin (chordino) and sizzled (ogon)
exhibit a reduction of dorsal and expansion of ventral cell types
(Hammerschmidt et al., 1996
).
Extracellularly, Chordin, Follistatin and Noggin, which are expressed in
dorsal domains, antagonize BMP signaling by directly binding and inhibiting
BMP ligands, prohibiting activation of their receptors
(De Robertis et al., 2000
).
Sizzled (Ogon) is unique as a BMP antagonist in its ventrally restricted
expression pattern and its dependence on Chordin to antagonize BMP signaling
(Yabe et al., 2003
). Chordin
is itself regulated by the Tolloid family of metalloproteases, which degrade
Chordin and thus promote BMP signaling
(Mullins, 1998
). In zebrafish,
mutations in tolloid [mini fin; tolloid like 1
(tll1) - Zebrafish Information Network] result in the loss of the
ventral fin fold, tissue derived from the ventral most region of the gastrula
(Connors et al., 1999
). This
mildly dorsalized phenotype has led to a model in which zebrafish Tolloid
(Mini fin) activity restricts Chordin, and thus promotes high levels of BMP
signaling, at or near the end of gastrulation
(Connors et al., 1999
). The
combined activity of these extracellular factors ensures proper patterning,
and is consistent with a model in which dorsally produced BMP antagonists
diffuse laterally to produce a gradient of BMP signaling
(Holley and Ferguson, 1997
;
Thomsen, 1997
), which imparts
positional information and/or cell fate decisions along the DV axis.
Although the activities of BMP ligands, the extracellular antagonist
Chordin and the protease Tolloid are well agreed upon, the function of the
secreted factor Twisted gastrulation (Tsg) in DV patterning in vertebrates has
been less clear. Tsg displays both BMP promoting and antagonizing activities
in gain-of-function and biochemical assays. Overexpression of Tsg at high
levels in Xenopus embryos causes ventralization, indicative of high
levels of BMP signaling (Oelgeschlager et
al., 2000
; Ross et al.,
2001
). When expressed with Tolloid or at high levels relative to
Chordin, Tsg can act as an agonist of BMP signaling
(Larrain et al., 2001
;
Ross et al., 2001
;
Oelgeschlager et al., 2003
).
Consistent with this, Tsg can release BMP ligands from Chordin cleavage
products (Larrain et al.,
2001
; Oelgeschlager et al.,
2000
), and Tsg enhances Tolloid-mediated proteolysis of Chordin
(Larrain et al., 2001
;
Scott et al., 2001
;
Shimmi and O'Connor, 2003
;
Yu et al., 2000
). Conversely,
lower levels of overexpressed Tsg antagonize BMP signaling, causing
dorsalization (Chang et al.,
2001
; Ross et al.,
2001
; Scott et al.,
2001
). Biochemically, Tsg binds with high affinity directly to BMP
ligands and enhances the binding of Chordin to BMPs
(Chang et al., 2001
;
Larrain et al., 2001
;
Oelgeschlager et al., 2000
;
Scott et al., 2001
),
suggesting that Tsg inhibits BMP signaling. One model taking into account
these results proposes that Tsg activity depends on the cleavage status of
Chordin, and thus on the activity of Tolloid: uncleaved Chordin would elicit
strong binding between Tsg and BMPs to antagonize BMP signaling, whereas
Tolloid-generated Chordin fragments, which possess residual anti-BMP activity,
would be released from BMPs by Tsg to promote BMP signaling
(Larrain et al., 2001
). This
model is based largely upon overexpression experiments, leaving unanswered the
question of the endogenous role of Tsg as a pro- or anti-BMP factor in DV
patterning of the embryonic axis.
We performed morpholino (MO)-based loss-of-function studies of tsg1 (tsgb - Zebrafish Information Network) in the zebrafish and examined genetic interactions between tsg1 and several BMP signaling component mutants. We found that knockdown of Tsg1 results in a moderately strong dorsalization, consistent with a loss of BMP signaling. We show a genetic interaction between tsg1 and bmp2b (swirl), supporting a role for Tsg1 as a BMP signaling agonist. We demonstrate that mini fin (tolloid) and tsg1 cooperate in the promotion of BMP signaling. We also show that Tsg1 knockdown can partially suppress the chordino and sizzled (ogon) ventralized phenotypes, indicating that Tsg1 can act as a pro-BMP ventralizing factor in the absence of Chordin, as well as in the absence of Sizzled (Ogon). We propose that the predominant role of Tsg1 in DV patterning in the zebrafish is to promote BMP signaling, and that this function involves mechanisms that do not rely exclusively on the presence of Chordin or Chordin fragments.
| Materials and methods |
|---|
|
|
|---|
1 restriction enzyme was used to genotype
ogontm305 using primers rk1-5' and rk1-3'
(Yabe et al., 2003
|
|
Morpholino and mRNA injections
Morpholinos were obtained from Gene Tools, LLC. Lyophilized powder was
resuspended in water, then diluted into 1xDanieau buffer
(Nasevicius and Ekker, 2000
)
for injection of 1 nl into one-cell stage embryos. The sequence of MO1 was as
described by Ross et al. (Ross et al.,
2001
); MO4, 5' TAAACTGGAGCAGACTCAACTAATG 3'; MO5,
5' CGCCGAACTCTGAGCTGAGCAGAAC 3'; a four nucleotide mismatch MO to
MO1 (mismatch MO1), 5' CTCATGTTGATGATGAACACCGCAT 3'; a 5
nucleotide mismatch MO to MO5 (mismatch MO5), 5'
CCCCCAACTCTCAGCTCAGCACAAC 3'.
mRNA was in vitro transcribed as described
(Nguyen et al., 1998
) using
SP6 mMessage mMachine kits (Ambion) and injected into embryos at the 1- to
2-cell stage. ztsg1 cDNA without its endogenous secretion signal was
subcloned by PCR from zTsg1-pT3TS (a gift from M. O'Connor) into a derivative
of pCS2 containing the Xenopus Chordin signal peptide and a FLAG
epitope downstream of the signal peptide
(Oelgeschläger et al.,
2000
). To create FLAG-tagged ztsg1 with its endogenous
secretion signal, the Chordin secretion signal was replaced with
ztsg1 sequence using standard molecular biology procedures.
tsg1 RNA was transcribed from these NotI linearized plasmids. tsg2 RNA was transcribed from pCS2-ztsg (a gift from M. Oelgeschläger and E. M. De Robertis) linearized with NotI. All injections were performed on at least three separate occasions. For rescue experiments, MO was injected first, followed by a second injection of mRNA into a random subset of the MO-injected embryos. Embryos injected with MO alone were then compared with those that were co-injected with mRNA.
Western blot analysis
Wild-type embryos were injected with mRNA encoding FLAG-tagged
tsg1. A subset of these embryos were subsequently injected with 32 ng
MO1 or mismatch MO1. Batches of five embryos were lysed in 20 µl SDS-PAGE
loading buffer (Sambrook et al.,
1989
), boiled for five minutes, centrifuged for five minutes and
the supernatants subject to SDS-PAGE analysis on 12% gels. After transferring
to PVDF, membranes were probed with 1:1600 dilution of anti-FLAG antibody
(Sigma) followed by 1:3000 dilution of HRP-conjugated sheep anti-mouse
antibody (Amersham Biosciences) and detection with ECL plus western blotting
detection kit (Amersham Biosciences) according to the manufacturer's
instructions.
Cell death assay and in situ hybridization
Labeling with digoxigenin-conjugated nucleotides by terminal
deoxynucleotidyl transferase was performed on embryos fixed in 4%
paraformaldehyde using ApopTag Detection Kit (Intergen) according to the
manufacturer's instructions. After incubation with alkaline
phosphatase-conjugated anti-digoxigenin antibody, staining was performed with
330 mg/ml NBT and 170 mg/ml BCIP (Sigma). Whole mount in situ hybridization
was performed as described (Nguyen et al.,
1998
) with probes against bmp4
(Chin et al., 1997
),
pax2.1 (Krauss et al.,
1991
), krox20 (Oxtoby
and Jowett, 1993
), myod
(Weinberg et al., 1996
),
eve1 (Joly et al.,
1993
), gsc (Stachel
et al., 1993
), foxb1.2 (formerly fkd3)
(Odenthal and Nüsslein-Volhard,
1998
), dlx3 (Akimenko
et al., 1994
), gata2
(Detrich et al., 1995
) and
chd (Miller-Bertoglio et al.,
1997
). All images were taken from an MZ12.5 stereomicroscope
(Leica) with a ColorSNAP-cf digital camera (Photometrics) and processed using
Adobe Photoshop.
| Results |
|---|
|
|
|---|
|
|
As a change in early patterning could not account for the reduction of
anterior structures at 48 hpf, we investigated if the defects were specific or
non-specific effects of MO1. To test this, we co-injected in vitro transcribed
tsg1 or tsg2 mRNA, which lack sequence complementary to MO1,
and assayed for rescue of the defects. We found that either mRNA could rescue
the vein edema in a large fraction of embryos
(Fig. 1C,
Table 1). However, we did not
detect rescue of the anterior structures by co-injection of tsg mRNA
(Fig. 1C). Examination of live
embryos revealed a high degree of cell death that became prominent at 24 hpf,
a common nonspecific effect of MOs
(Heasman, 2002
;
Nasevicius and Ekker, 2000
).
To determine if the decrease in anterior structures could be attributed to
cell death, we used a TUNEL-based assay to label the nuclei of dying cells. We
observed a substantial increase in cell death in anterior CNS tissues of
morphants (Fig. 1D,E), which
could not be rescued by RNA co-injection
(Fig. 1F). We attribute the
reduction in anterior tissues at 48 hpf to nonspecific, MO-induced cell
death.
Strong knockdown of Tsg1 results in dorsalization
We investigated whether the 8-16 ng tsg1 knockdown may be an
incomplete loss of tsg1 function by examining the effects of
injecting increasing amounts of MO1. We found that 32 ng of MO1 appeared to
dorsalize the embryo moderately to moderately strong, similar to class 3 (C3)
and class 4 (C4) dorsalizations (Table
2; Fig. 2K,O, not
shown) (Mullins et al., 1996
).
At no dose did we observe defects consistent with a ventralization. To verify
the specificity of MO1, we designed two additional MOs, MO4 and MO5, targeted
against non-overlapping sequences in the 5' untranslated region. We
found that injection of 32 ng of MO4 or 25 ng of MO5 induced a moderately
strong dorsalization (Fig. 2;
Table 2), similar to that of
MO1.
|
|
Tsg genetically interacts with Bmp2b
To examine if Tsg1 promotes ventral cell fates by promoting BMP signaling,
we tested whether tsg1 interacts genetically with known BMP pathway
component mutants. We injected a sub-dorsalizing amount of tsg1 MO1
(16 ng) into embryos from a cross between a swirl (bmp2b)
heterozygote and a wild type fish. In contrast to the uninjected,
phenotypically wild type swirl (bmp2b) heterozygotes,
greater than 95% of the tsg1 MO-injected heterozygotes displayed
dorsalized phenotypes at 24 hpf, ranging from weak (class 1, 13%; class 2,
36%), moderate (class 3, 28%) to strong (class 4, 21%)
(Fig. 3B-D; Table 3). Importantly, 90% of
injected wild-type sibling embryos were not dorsalized
(Fig. 3A and
Table 3). Dorsalization was
also evident during somitogenesis by an expansion of dorsally expressed
markers in the MO1-injected swirl heterozygotes
(Fig. 3E-J). Furthermore, we
found that 12 pg of bmp2b mRNA or 20 pg of mRNA encoding the
intracellular BMP effector Smad5 could rescue the tsg1 MO5
dorsalization (Table 2). Our
ability to rescue Tsg loss-of-function with multiple components of a BMP
signaling pathway, as well as the genetic interaction between loss of
swirl (bmp2b) and tsg1 function indicates that Tsg1
functions endogenously to promote BMP signaling in dorsoventral
patterning.
|
|
|
|
|
tsg1 overexpression dorsalizes wild type, and suppresses dino and ogon
Surprisingly, like the tsg1 knockdown phenotype, Tsg
overexpression also dorsalizes the zebrafish embryo (see also
Ross et al., 2001
). We
injected various amounts of tsg1 mRNA into wild-type embryos and
monitored DV patterning by in situ hybridization with pax2.1, krox20
and myoD at the eight-somite stage. We found that 100-200 pg of
tsg1 mRNA caused a moderate, lateral expansion of all three markers
(Fig. 7A-E), and mild to
moderate dorsalized phenotypes at 1 day post fertilization (dpf)
(Table 6;
Fig. 7F-I). About half of the
mildly dorsalized embryos (class 1 or class 2,
Fig. 7G,H) also displayed small
duplications in the fin fold (Fig.
7H inset), similar to overexpression of Xenopus Tsg mRNA
in zebrafish (Oelgeschlager et al.,
2003
) and some weakly dorsalized mutants
(Kramer et al., 2002
). Higher
amounts of tsg1 mRNA caused more severely dorsalized phenotypes (not
shown). Lower amounts had negligible effects. At no dose did we observe
ventralized phenotypes.
|
|
Overall, these experiments show that overexpressed Tsg can antagonize ventral cell fate specification in wild-type and mutant backgrounds. However, our loss-of-function results indicate that endogenous Tsg1 promotes ventral cell fate specification. It is possible that Tsg1 acts as a crucial component of a BMP-promoting complex that cannot form in either the absence of Tsg1 or the presence of excess Tsg (see Discussion).
| Discussion |
|---|
|
|
|---|
A previous model of Tsg function suggests that full-length Chordin causes
Tsg to act as a BMP antagonist, whereas the presence of Chordin fragments
allows Tsg to exhibit pro-BMP behavior
(Larrain et al., 2001
). Thus,
the activity of Tsg may depend on the cleavage status of Chordin. However, the
partial suppression of the chordin mutant phenotype by Tsg1 knockdown
indicates that endogenous Tsg1 acts as a ventralizing factor in a manner that
does not rely entirely on Chordin. These results are consistent with the
finding that an overexpressed mutant Tsg that cannot bind BMPs reduces ventral
tissues to a greater extent than loss of Chordin alone
(Oelgeschlager et al., 2003
).
Thus, Tsg1 may promote BMP signaling in part by inactivating BMP antagonists
in addition to Chordin or Chordin fragments.
However, as tsg1 knockdown only partially suppresses the
dino ventralized phenotype and tsg1 is not epistatic to
dino, Tsg1 probably also inactivates Chordin in conjunction with
Tolloid, as previous studies indicate
(Larrain et al., 2001
;
Oelgeschlager et al., 2000
).
Moreover, as dino mutants display a range of phenotypes from a mild
ventralization that is viable to a moderate ventralization that is lethal
(Fisher and Halpern, 1999
), it
is possible that loss of tsg1 affects the range of dino
phenotypes, with the mild phenotype becoming predominant. This could be a
direct effect of Tsg on other antagonists, as discussed above, or it could be
indirect by unknown mechanism(s) that also modulate the dino
phenotype.
Tsg has been reported to enhance Tolloid proteolysis of Chordin
(Larrain et al., 2001
;
Scott et al., 2001
;
Shimmi and O'Connor, 2003
;
Yu et al., 2000
). We found
that a sub-dorsalizing knockdown of Tsg1 in wild type exacerbates the mildly
dorsalized phenotype of mini fin (tolloid) mutants
(Fig. 5), suggesting a
previously unknown role for Mini fin (Tolloid) in patterning rostral tissues
in zebrafish (Connors et al.,
1999
; Mullins et al.,
1996
). There is evidence that additional Tolloid-related enzymes
function during gastrulation (J. Xie and S. Fisher, personal communication),
which may normally mask the loss of mini fin (tolloid)
during these stages. If Tsg1 increases the rate of proteolysis of multiple
Tolloid enzymes, then loss of Tsg could dorsalize the embryo by reducing the
ability of multiple Tolloid factors to degrade their targets.
If endogenous Tsg1 promotes ventral cell fates by facilitating BMP
signaling, why does Tsg1 overexpression dorsalize the embryo, reflecting a
loss of BMP signaling? One possibility is that Tsg functions in a
multi-component protein complex, binding both to a BMP ligand, as previously
shown (Chang et al., 2001
;
Larrain et al., 2001
;
Oelgeschlager et al., 2000
;
Ross et al., 2001
;
Scott et al., 2001
), and at
least one other factor required to promote BMP signaling. Loss of Tsg would
disrupt formation of this complex and result in decreased BMP signaling.
Excess Tsg would bind independently to both free BMP ligands and the other
factor in the complex, again preventing formation of the trimolecular complex
and reducing BMP signaling. Thus, both the loss- and gain-of-function
phenotypes would cause the same defect
(Fig. 8). A similar phenomenon
is also observed in the loss- and gain-of-function phenotypes of some Wnt
planar cell polarity components and other genes
(Gubb et al., 1999
;
Hiromi et al., 1993
;
Krasnow and Adler, 1994
;
Strutt et al., 1997
;
Tomlinson et al., 1997
).
|
In contrast to our study, a recent loss of function study in
Xenopus reports that MO-induced knockdown of Tsg causes
ventralization, indicating that Tsg predominantly inhibits BMP signaling in
Xenopus (Blitz et al.,
2003
). Tsg knockdown in Xenopus mildly restricts a small
fraction of dorsally expressed genes during midgastrulation, with more
substantial changes evident during neurula stages. These findings led to the
conclusion that in Xenopus Tsg maintains the specification of dorsal
cell fates, presumably after BMP signaling has patterned the early DV axis. We
find that Tsg1 knockdown in zebrafish causes a moderately strong dorsalization
in pattern formation during gastrulation. It is possible that Tsg acts
oppositely at different stages and/or activity levels to affect the DV pattern
of the embryo or functions in a nonconserved manner in these two
organisms.
In Drosophila, Tsg also modulates BMP signaling during DV axial
patterning. Tsg functions similarly to the Chordin ortholog Short gastrulation
(Sog) in specifying the dorsal-most tissue, the amnioserosa, which requires
the highest levels of BMP signaling in the fly embryo
(Ashe and Levine, 1999
;
Francois et al., 1994
;
Mason et al., 1994
;
Ross et al., 2001
;
Zusman and Wieschaus, 1985
).
In addition to this pro-BMP activity, both Tsg and Sog exhibit anti-BMP
activity in dorsolateral regions of the embryo
(Ross et al., 2001
). Current
models suggest that Sog and Tsg bind to and transport BMP ligands toward
dorsal regions of the embryo, where they are released from Sog by the activity
of Tolloid, thereby generating the highest levels of BMP signal dorsally
(Decotto and Ferguson, 2001
;
Eldar et al., 2002
;
Shimmi and O'Connor, 2003
). In
this model, the activity of Tsg relies on the presence of Sog and Tolloid. In
vertebrates, there is no evidence for a role for Chordin in promoting gastrula
BMP signaling, although it is possible it plays such a role at later stages in
tail patterning (Hammerschmidt and
Mullins, 2002
; Wagner and
Mullins, 2002
). Thus, all aspects of how Sog/Chordin and Tsg
function in DV patterning in vertebrates and invertebrates may not be
conserved.
In zebrafish, Tsg1 could act as a BMP antagonist at other stages of development or under particular conditions that we did not detect in our studies. We do not know the nature of the tail vein edema phenotype observed in low level Tsg knockdown embryos (Fig. 1). It may reflect its role as a BMP antagonist, as chordin mutants exhibit a similar edema, although in conjunction with other ventralized defects, which we do not detect in tsg1 morphants. It is likely that the timing, location and/or levels of expression of Tsg, possibly with other factors, are crucial in determining whether Tsg functions to promote or antagonize BMP signaling in different developmental contexts. In zebrafish, the mechanism by which Tsg promotes BMP signaling, and the identity of any additional Tsg-interacting factors, remains unclear. Further work will be required to determine how Tsg acts in relation to other BMP modulating factors, in order to elucidate the mechanism by which Tsg promotes BMP signaling.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ashe, H. L. and Levine, M. (1999). Local inhibition and long-range enhancement of Dpp signal transduction by Sog. Nature 398,427 -431.[CrossRef][Medline]
Akimenko, M.-A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994). Combinatorial expression of three zebrafish genes related to distal-less: part of a homeobox gene code for the head. J. Neurosci. 14,3475 -3486.[Abstract]
Bauer, H., Lele, Z., Rauch, G. J., Geisler, R. and Hammerschmidt, M. (2001). The type I serine/threonine kinase receptor Alk8/Lost-a-fin is required for Bmp2b/7 signal transduction during dorsoventral patterning of the zebrafish embryo. Development 128,849 -858.[Abstract]
Blitz, I. L., Cho, K. W. and Chang, C. (2003).
Twisted gastrulation loss-of-function analyses support its role as a BMP
inhibitor during early Xenopus embryogenesis.
Development 130,4975
-4988.
Chang, C., Holtzman, D. A., Chau, S., Chickering, T., Woolf, E. A., Holmgren, L. M., Bodorova, J., Gearing, D. P., Holmes, W. E. and Brivanlou, A. H. (2001). Twisted gastrulation can function as a BMP antagonist. Nature 410,483 -487.[CrossRef][Medline]
Chin, A. J., Chen, J. N. and Weinberg, E. S. (1997). Bone morphogenic protein-4 expression characterizes inductive boundaries in organs of developing zebrafish. Dev. Genes Evol. 207,107 -114.[CrossRef]
Connors, S. A., Trout, J., Ekker, M. and Mullins, M. C. (1999). The role of tolloid/mini fin in dorsoventral pattern formation of the zebrafish embryo. Development 126,3119 -3130.[Abstract]
De Robertis, E. M. and Sasai, Y. (1996). A common plan for dorsoventral patterning in Bilateria. Nature 380,37 -40.[CrossRef][Medline]
De Robertis, E. M., Larrain, J., Oelgeschlager, M. and Wessely, O. (2000). The establishment of Spemann's organizer and patterning of the vertebrate embryo. Nat. Rev. Genet. 1, 171-181.[CrossRef][Medline]
Decotto, E. and Ferguson, E. L. (2001). A
positive role for Short gastrulation in modulating BMP signaling during
dorsoventral patterning in the Drosophila embryo.
Development 128,3831
-3841.
Detrich, H. W., Kieran, M. W., Chan, F. Y., Barone, L. M., Yee,
K., Rundstadler, J. A. and Zon, L. I. (1995).
Intraembryonic hematopoietic cell migration during vertebrate development.
Proc. Natl. Acad. Sci. USA
92,10713
-10717.
Dick, A., Hild, M., Bauer, H., Imai, Y., Maifeld, H., Schier, A. F., Talbot, W. S., Bouwmeester, T. and Hammerschmidt, M. (2000). Essential role of Bmp7 (snailhouse) and its prodomain in dorsoventral patterning of the zebrafish embryo. Development 127,343 -354.[Abstract]
Eldar, A., Dorfman, R., Weiss, D., Ashe, H., Shilo, B. Z. and Barkai, N. (2002). Robustness of the BMP morphogen gradient in Drosophila embryonic patterning. Nature 419,304 -308.[CrossRef][Medline]
Fisher, S. and Halpern, M. E. (1999). Patterning the zebrafish axial skeleton requires early chordin function. Nat. Genet. 23,442 -446.[CrossRef][Medline]
Francois, V., Solloway, M., O'Neill, J. W., Emery, J. and Bier,
E. (1994). Dorsal-ventral patterning of the Drosophila embryo
depends on a putative negative growth factor encoded by the short gastrulation
gene. Genes Dev. 8,2602
-2616.
Gubb, D., Green, C., Huen, D., Coulson, D., Johnson, G., Tree,
D., Collier, S. and Roote, J. (1999). The balance
between isoforms of the prickle LIM domain protein is critical for planar
polarity in Drosophila imaginal discs. Genes Dev.
13,2315
-2327.
Hammerschmidt, M. and Mullins, M. C. (2002). Dorsoventral patterning in the zebrafish: bone morphogenetic proteins and beyond. In Pattern Formation in Zebrafish, Vol.40 (ed. L. Solnica-Krezel), pp.219 -255. Heidelberg, Germany: Springer-Verlag.
Hammerschmidt, M., Pelegri, F., Mullins, M. C., Kane, D. A., van Eeden, F. J. M., Granato, M., Brand, M., Furutani-Seiki, M., Haffter, P., Heisenberg, C.-P. et al. (1996). dino and mercedes, two genes regulating dorsal development in the zebrafish embryo. Development 123,95 -102.[Abstract]
Heasman, J. (2002). Morpholino oligos: making sense of antisense? Dev. Biol. 243,209 -214.[CrossRef][Medline]
Hiromi, Y., Mlodzik, M., West, S. R., Rubin, G. M. and Goodman, C. S. (1993). Ectopic expression of seven-up causes cell fate changes during ommatidial assembly. Development 188,1123 -1135.
Hogan, B. L. (1996). Bone morphogenic proteins:
mulitifunctional regulators of vertebrate development. Genes
Dev. 10,1580
-1594.
Holley, S. A. and Ferguson, E. L. (1997). Fish are like flies are like frogs: conservation of dorsal-ventral patterning mechanisms. BioEssays 19,281 -284.[CrossRef][Medline]
Joly, J. S., Joly, C., Schulte-Merker, S., Boulekbache, H. and Condamine, H. (1993). The ventral and posterior expression of the zebrafish homeobox gene eve1 is perturbed in dorsalized and mutant embryos. Development 119,1261 -1275.[Abstract]
Kishimoto, Y., Lee, K. H., Zon, L., Hammerschmidt, M. and Schulte-Merker, S. (1997). The molecular nature of zebrafish swirl: BMP2 function is essential during early dorsoventral patterning. Development 124,4457 -4466.[Abstract]
Kramer, C., Mayr, T., Nowak, M., Schumacher, J., Runke, G., Bauer, H., Wagner, D. S., Schmid, B., Imai, Y., Talbot, W. S. et al. (2002). Maternally supplied smad5 is required for ventral specification in zebrafish embryos prior to zygotic Bmp signaling. Dev. Biol. 250,263 -279.[CrossRef][Medline]
Krasnow, R. E. and Adler, P. N. (1994). A single frizzled protein has a dual function in tissue polarity. Development 120,1883 -1893.[Abstract]
Krauss, S., Johansen, T., Korzh, V. and Fjose, A. (1991). Expression pattern of zebrafish pax genes suggests a role in early brain Regionalization. Nature 353,267 -270.[CrossRef][Medline]
Larrain, J., Oelgeschlager, M., Ketpura, N. I., Reversade, B., Zakin, L. and de Robertis, E. M. (2001). Proteolytic cleavage of Chordin as a switch for the dual activities of Twisted gastrulation in BMP signaling. Development 128,4439 -4447.[Medline]
Mason, E. D., Konrad, K. D., Webb, C. D. and Marsh, J. L.
(1994). Dorsal midline fate in Drosophila embryos
requires twisted gastrulation, a gene encoding a secreted protein
related to human connective tissue growth factor. Genes
Dev. 8,1489
-1501.
Miller-Bertoglio, V., Fisher, S., Sanchez, A., Mullins, M. C. and Halpern, M. E. (1997). Differential regulation of chordin expression domains in mutant zebrafish. Dev. Biol. 192,537 -550.[CrossRef][Medline]
Miller-Bertoglio, V., Carmany-Rampey, A., Furthauer, M., Gonzalez, E. M., Thisse, C., Thisse, B., Halpern, M. E. and Solnica-Krezel, L. (1999). Maternal and zygotic activity of the zebrafish ogon locus antagonizes BMP signaling. Dev. Biol. 214,72 -86.[CrossRef][Medline]
Mintzer, K. A., Lee, M. A., Runke, G., Trout, J., Whitman, M. and Mullins, M. C. (2001). Lost-a-fin encodes a type I BMP receptor, Alk8, acting maternally and zygotically in dorsoventral pattern formation. Development 128,859 -869.[Abstract]
Mullins, M. C. (1998). Holy Tolloido: Tolloid cleaves Sog/Chordin to free DPP/Bmps. Trends Genet. 14,127 -129.[CrossRef][Medline]
Mullins, M. C., Hammerschmidt, M., Kane, D. A., Odenthal, J., Brand, M., van Eeden, F. J. M., Furutani-Seiki, M., Granato, M., Haffter, P., Heisenberg, C.-P. et al. (1996). Genes establishing dorsoventral pattern formation in the zebrafish embryo: the ventral specifying genes. Development 123, 81-93.[Abstract]
Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene `knockdown' in zebrafish. Nat. Genet. 26,216 -220.[CrossRef][Medline]
Nguyen, V. H., Schmid, B., Trout, J., Connors, S. A., Ekker, M. and Mullins, M. C. (1998). Ventral and lateral regions of the zebrafish gastrula, including the neural crest progenitors, are established by a bmp2b/swirl pathway of genes. Dev. Biol. 199,93 -110.[CrossRef][Medline]
Nosaka, T., Morita, S., Kitamura, H., Nakajima, H., Shibata,
F., Morikawa, Y., Kataoka, Y., Ebihara, Y., Kawashima, T., Itoh, T. et
al. (2003). Mammalian Twisted gastrulation is essential for
skeletolymphogenesis. Mol. Cell. Biol.
23,2969
-2980.
Odenthal, J. and Nüsslein-Volhard, C. (1998). fork head domain genes in zebrafish. Dev. Genes Evol. 208,245 -258.[CrossRef][Medline]
Oelgeschlager, M., Larrain, J., Geissert, D. and de Robertis, E. M. (2000). The evolutionarily conserved BMP-binding protein Twisted gastrulation promotes BMP signalling. Nature 405,757 -763.[CrossRef][Medline]
Oelgeschlager, M., Reversade, B., Larrain, J., Little, S.,
Mullins, M. C. and de Robertis, E. M. (2003). The pro-BMP
activity of Twisted gastrulation is independent of BMP binding.
Development 130,4047
-4056.
Oxtoby, E. and Jowett, T. (1993). Cloning of
the zebrafish krox-20 gene (krx-20) and its expression
during hindbrain development. Nucleic Acids Res.
21,1087
-1095.
Petryk, A., Anderson, R. M., Jarcho, M. P., Leaf, I., Carlson, C. S., Klingensmith, J., Shawlot, W. and O'Connor, M. B. (2004). The mammalian twisted gastrulation gene functions in foregut and craniofacial development. Dev. Biol. 267,374 -386.[CrossRef][Medline]
Ross, J. J., Shimmi, O., Vilmos, P., Petryk, A., Kim, H., Gaudenz, K., Hermanson, S., Ekker, S. C., O'Connor, M. B. and Marsh, J. L. (2001). Twisted gastrulation is a conserved extracellular BMP antagonist. Nature 410,479 -483.[CrossRef][Medline]
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Schmid, B., Furthauer, M., Connors, S. A., Trout, J., Thisse, B., Thisse, C. and Mullins, M. C. (2000). Equivalent genetic roles for bmp7/snailhouse and bmp2b/swirl in dorsoventral pattern formation. Development 127,957 -967.[Abstract]
Schulte-Merker, S., Lee, K. J., McMahon, A. P. and Hammerschmidt, M. (1997). The zebrafish organizer requires chordino. Nature 387,862 -863.[CrossRef][Medline]
Scott, I. C., Blitz, I. L., Pappano, W. N., Maas, S. A., Cho, K. W. and Greenspan, D. S. (2001). Homologues of Twisted gastrulation are extracellular cofactors in antagonism of BMP signalling. Nature 410,475 -478.[CrossRef][Medline]
Shimmi, O. and O'Connor, M. B. (2003). Physical
properties of Tld, Sog, Tsg and Dpp protein interactions are predicted to help
create a sharp boundary in Bmp signals during dorsoventral patterning of the
Drosophila embryo. Development
130,4673
-4682.
Solnica-Krezel, L., Stemple, D. L., Mountcastle-Shah, E., Rangini, Z., Neuhauss, S. C. F., Malicki, J., Schier, A. F., Stanier, D. Y. R., Zwartkruis, F., Abdelilah, S. et al. (1996). Mutations affecting cell fates and cellular rearrangements during gastrulation in zebrafish. Development 123, 67-80.[Abstract]
Stachel, S. E., Grunwald, D. J. and Myers, P. Z. (1993). Lithium perturbation and goosecoid expression identify a dorsal specification pathway in the pregastrula zebrafish. Development 117,1261 -1274.[Abstract]
Strutt, D. I., Weber, U. and Mlodzik, M. (1997). The role of RhoA in tissue polarity and Frizzled signaling. Nature 387,292 -295.[CrossRef][Medline]
Thomsen, G. H. (1997). Antagonism within and around the organizer: BMP inhibitors in vertebrate body patterning. Trends Genet. 13,209 -211.[CrossRef][Medline]
Tomlinson, A., Strapps, W. R. and Heemskerk, J. (1997). Linking Frizzled and Wnt signaling in Drosophila development. Development 124,4515 -4521.[Abstract]
Wagner, D. S. and Mullins, M. C. (2002). Modulation of BMP activity in dorsal-ventral pattern formation by the Chordin and Ogon antagonists. Dev. Biol. 245,109