|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 10 November 2004
doi: 10.1242/dev.01523
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Division of Biological Sciences, Section of Cell and Developmental Biology, University of California at San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0116, USA
* Author for correspondence (e-mail: rschmidt{at}ucsd.edu)
Accepted 7 October 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Silky1, Zmm16, B-class, Maize, MADS-box, Petal evolution
| Introduction |
|---|
|
|
|---|
|
Loss of B-class function results in the homeotic transformation of whorls
two and three, such that petals are converted to sepals, and stamens are
converted into carpels, which then fuse with the central gynoecium. In
Arabidopsis, two genes have been shown to control B-class function:
APETELA3 (AP3) and PISTILLATA (PI)
(Goto and Meyerowitz, 1994
;
Jack et al., 1992
). Similarly,
in Antirrhinum, the B-class function is controlled by the orthologous
genes: DEFICIENS (DEF) and GLOBOSA (GLO),
respectively (Sommer et al.,
1990
; Trobner et al.,
1992
). In both organisms, knockouts in either gene have nearly
identical phenotypes, and both genes are expressed in whorls two and three of
developing flowers. It has also been shown that the AP3 and PI proteins
function as an obligate heterodimer to bind DNA in vitro
(Riechmann et al., 1996
), and
to regulate their own transcription in vivo
(Goto and Meyerowitz, 1994
;
Jack et al., 1994
), as do DEF
and GLO (Schwarz-Sommer et al.,
1992
). Nuclear localization of the AP3 and PI
gene products requires their simultaneous expression
(McGonigle et al., 1996
).
These results suggest that obligate heterodimerization, and simultaneous
expression in petals and stamens, are conserved features of higher eudicot
B-class function. However, it is not yet clear that the B-class function
described for Arabidopsis and Antirrhinum is identical in
more basal groups, such as the monocots.
Analysis of B-class function in the grasses is complicated by their unique
morphology. The grass flower (floret) is highly derived relative to the
eudicot flower. Whereas the first two whorls of the eudicot flower contain
sepals and petals, the grass floret comprises a palea and a lemma followed by
lodicules (all grass-specific organs), then stamens and carpels as in eudicot
flowers (Fig. 1B). The
evolutionary relationship of lodicules, palea and lemma to the sterile organs
of other flowers has been historically controversial. However, analysis of
B-class genes identified and characterized in the grasses maize and rice has
suggested a possible interpretation of these structures. In both species,
there appears to be only one AP3 ortholog
(Ambrose et al., 2000
;
Moon et al., 1999
). Loss of
function of the maize AP3 ortholog Silky1 (Si1),
results in homeotic transformation of stamens into carpels, and lodicules into
palea/lemma-like organs (Ambrose et al.,
2000
). A nearly identical phenotype was observed in a recent
report of the knockout of the rice AP3 ortholog SUPERWOMAN1
(SPW1) (Nagasawa et al.,
2003
). There are at least three PI-like genes in maize,
Zmm16, Zmm18 and Zmm29
(Münster et al., 2001
),
and two in rice, OsMADS4 and OsMADS2
(Chung et al., 1995
). Reduction
of OsMADS4 transcript levels by antisense expression in transgenic
rice gives a similar phenotype to Si1 and spw1, with a
partial conversion of stamens to carpels and lodicules to palea/lemma
(Kang et al., 1998
). Taken
together, these results suggest an interpretation of palea/lemma as sepal
homologs, and lodicules as homologous to petals
(Ambrose et al., 2000
).
In order to more completely characterize the maize B-class function and its relationship to the Arabidopsis B-class function, we have undertaken a further functional analysis of two maize B-class genes: Si1 and Zmm16. We show that SI1 and ZMM16 interact to bind DNA as a heterodimer, and that each protein is capable of interacting with its distantly related Arabidopsis partner to bind DNA. Furthermore, we show that this in vitro binding activity is also present in vivo, as both maize genes can rescue stamen and petal identity in their corresponding Arabidopsis mutants when expressed from the AP3 promoter.
| Materials and methods |
|---|
|
|
|---|
In situ hybridization
A 300 bp PCR product of Zmm16 cDNA, containing all of the I and K
domains and part of the C domain, was used in all hybridizations. Probe
labeling, tissue preparation and hybridization were performed as previously
described (Ambrose et al.,
2000
).
Electrophoretic mobility shift assays (EMSA)
AP3 and PI proteins were produced from clones derived from the in vitro
transcription-translation vector pSPUTK (Stratagene), as previously described
(Riechmann et al., 1996
). The
entire coding sequence of the Si1 cDNA was PCR-subcloned into the
pSPUTK vector, using a primer at the 5' end to create an NcoI
site at the start codon and KpnI site at the 3' end. Similarly,
the Zmm16 cDNA was sublconed into pSPUTK, with a 5'
NcoI site and a 3' EcoRI site. These clones were
subsequently used to produce unlabelled protein for the DNA-binding
experiments, using the TNT Coupled rabbit reticulocyte lysate in vitro
transcription-translation system (Promega), according to the manufacturer's
protocol. Control TNT reactions were carried out, in parallel with the
unlabelled ones, using 35S-labelled methionine, and the labeled
proteins were analyzed on 15% SDS-PAGE to verify protein translation
efficiency and quality. 32P-labelled, double-stranded
oligonucleotide probes were derived from the CArG box sequences of the
Arabidopsis AP3 and AGL5 promoters, and synthesized as
described by Riechmann et al. (Riechmann
et al., 1996
). The AGL5 sequence is
5'-AATTGGATTACCAAAAAAGGAAAGTT-3'. The AP3
sequence is 5'-TTAGGCAATACTTTCCATTTTTAGTAACTC-3'. The
mutant CArG sequence is
5'-AATTGGATTAGGAAAAAACCAAAGTT-3' (CArG box sequences
are underlined, mutations are in bold). DNA-binding reactions were carried out
in 1xBinding Buffer [BB1X: 10 mM Hepes (pH 7.8), 50 mM KCl, 1 mM EDTA, 5
mM DTT, 2 mg/ml BSA, 0.5 mg/ml fragmented salmon sperm DNA (as a non-specific
competitor) and 10% Glycerol] in a final volume of 25 µl. The average
amount of TNT reaction (or `protein input') used in one DNA-binding assay was
about 5 µl. Reactions were incubated without probe for 30 minutes at room
temperature. After the addition of the probe (1x106 cpm/ng of
double stranded oligo), the incubation was extended for 15 additional minutes
at room temperature. Reactions were then loaded onto a 5% polyacrylamide gel
(0.25xTBE) and run at 150 Volts constant for 1-2 hours in the cold room.
The gel was then dried and exposed to Biomax film (Kodak).
Arabidopsis transformation and genotyping
A
1.3 kb fragment of the AP3 promoter from 1312 to
16 relative to the start ATG (kind gift of the Weigel Laboratory) was
fused to the coding region of the AP3, Si1 and Zmm16 cDNAs
using standard subcloning methods (AP3pro:AP3,
AP3pro:Si1, and AP3pro:Zmm16, respectively).
These fusion constructs were then further subcloned into the binary vector
pMX202 and transformed into Agrobacterium tumefaciens by heat shock.
Arabidopsis plants segregating the ap3-3 mutation were
transformed with AP3pro:AP3 and
AP3pro:Si1, and plants segregating the pi-1
mutation were transformed with AP3pro:Zmm16 by the
floral-dip method (Clough and Bent,
1998
). Kanamycin-resistant seedlings were selected and genotyped
by PCR with transgene specific primers, and confirmed by Southern blot for the
presence of the transgene.
Homozygous ap3-3 transformants were isolated using a dCAPS marker
designed using the dCAPS finder program
(Neff et al., 1998
). The
forward primer (AAGAGGATAGAGAACCAGACAAAGAGA) introduces a
BsmAI site into the wild-type sequence (introduced mutation in bold)
but not the ap3-3 sequence. PCR performed with this primer and the
reverse primer (CAAAATCACCAAAAAAGTAGTGG) creates a 257 bp product which, when
digested with BsmAI, results in a 20 bp polymorphism between
wild-type and ap3-3 products. Homozygous pi-1 plants were
identified using a CAPs marker, in which FokI cuts the wild-type
sequence, but the site is abolished by the pi-1 mutation.
Expression analysis
Total RNA was extracted from the inflorescences of wild-type plants and
strongly rescued plants of ap3-3 homozygotes carrying the
Ap3pro:Si1 transgene, as well as pi-1 homozygotes
carrying the Ap3pro:Zmm16 transgene. RNA levels were
quantified by analysis of gel electrophoresis of the samples and confirmed by
verifying equal AGAMOUS levels on a dot blot. Dot-blot analysis of
expression levels was performed by spotting equal quantities of RNA from each
sample onto nylon membranes. Membranes were then probed with a
32P-dATP-labeled 280-bp fragment from a corresponding 3'
region of the Silky1, Zmm16, AP3, PI and AG cDNAs.
Hybridizations were performed at 42°C, as previously described
(Ambrose et al., 2000
). Blots
were washed and exposed to Kodak Biomax film, and a phosphoimager screen.
Quantification of levels was performed using the Scanner Control SI software
by subtracting background and averaging the total intensity of three or four
replicate dots for each sample.
SEM analysis
All tissues were fixed, dried and coated as described previously
(Mena et al., 1996
). Scanning
electron microscopy was performed on a Quanta 600 environmental scanning
electron microscope (ESEM) with an accelerating voltage of 15 kV.
| Results |
|---|
|
|
|---|
As the maize tassel develops, Zmm16 expression is first observed throughout the upper floret meristem, just before the stage when palea and lemma primordia begin to emerge (Fig. 2A). Later, as lemma and palea begin to form, Zmm16 is strongly expressed in the region that will give rise to the stamen and lodicule primordia, but is only weakly expressed in the center of the meristem where the carpel primordia will emerge (Fig. 2B,C). As the floret develops, Zmm16 expression is seen in the stamens and the lodicules, and is maintained at a high level throughout the development of these organs (Fig. 2D,F), but it eventually becomes completely absent from the developing carpel of the male spikelet (Fig. 2F). Development of the lower floret is retarded relative to the upper floret, and Zmm16 expression in the lower floret is consequently delayed yet mimics that in the upper floret, with initial expression throughout the meristem (Fig. 2D), and subsequent restriction to the region of the meristem that will give rise to stamen and lodicules (Fig. 2E). Zmm16 expression was never observed in glumes, palea, lemma or any other organ, with the exception of the developing endosperm and embryo (data not shown).
|
SI1 and ZMM16 proteins were synthesized in vitro, then analyzed in an
electrophoretic mobility shift assay for their ability to bind a radioactively
labeled CArG-box probe, either alone or in combination with other B-class
proteins from maize and Arabidopsis.
Fig. 3A shows that neither SI1
nor ZMM16 alone are capable of binding a CArG-box derived from the promoter of
the Arabidopsis AGL5 gene
(Savidge et al., 1995
);
however, SI1 and ZMM16 together bind this DNA sequence, suggesting that the
formation of a SI1-ZMM16 heterodimer is necessary for DNA binding. The
specificity of this binding is shown by a mutation of the CArG-box, which
abolishes binding (Fig. 2B). We
also tested DNA binding of SI1 and ZMM16, alone and together, using a CArG-box
probe derived from the AP3 promoter, and obtained identical results
to those from the binding assays performed using the AGL5 CArG-box
probe (data not shown).
|
Complementation of Arabidopsis B-class mutants with orthologous maize genes
To test the relevance of the SI1-PI and ZMM16-AP3 interaction observed in
the in vitro DNA-binding assays, and to determine whether maize B-class genes
are capable of functionally replacing their Arabidopsis orthologs, we
created rescue constructs using the Arabidopsis AP3 promoter
(AP3pro) to drive expression of the maize Si1 and
Zmm16 cDNAs in whorls two and three of developing
Arabidopsis flowers. As a control, we also fused the AP3
promoter to the AP3 cDNA to ensure that our AP3pro fragment
contained sufficient regulatory information to rescue an ap3 mutant.
The AP3pro:AP3 and AP3pro:Si1 transgenes
were transformed into Arabidopsis plants heterozygous for
ap3-3, a null allele caused by a stop codon in the MADS-box
(Jack et al., 1992
). The
AP3pro:Zmm16 construct was transformed into plants
heterozygous for pi-1, a null mutation caused by stop codon in the
I-domain (Goto and Meyerowitz,
1994
). Transformants both containing the appropriate transgenes
and homozygous for either ap3-3 or pi-1, respectively, were
identified by PCR and Southern blot (see Materials and methods). For all three
constructs, independent transformants were identified showing a range of
phenotypes (Table 1). Most of
the AP3pro:AP3 lines showed complete (4/9) or strong (2/9)
rescue. Twelve independent AP3pro:Si1 transformants were
identified that were homozygous for ap3-3, together with 12
independent AP3pro:Zmm16 transformants homozygous for
pi-1. In neither case did rescue result in a phenotype
indistinguishable from wild type, as was observed in some of the transformants
carrying the AP3:proAP3 construct. Four of the
AP3pro:Si1 lines showed relatively strong rescue (see
below), and six AP3pro:Zmm16 lines showed a similar level of
rescue. Medium to weak complementation was also seen for both lines, in which
neither stamens nor petals were completely rescued. In none of the lines was
there a rescue of stamen identity without a similar level of petal rescue. One
of each strongly rescued line was selected for more detailed phenotypic
analyses.
|
|
These results suggest that both SI1 and ZMM16 proteins are capable of interacting with their Arabidopsis partners in vivo to rescue B-class mutants. However, it is not clear from these experiments whether the maize genes are sufficient, in the absence of an Arabidopsis partner, to rescue Arabidopsis B-class mutants. In the rescued plants, it is possible that the native Arabidopsis AP3 or PI proteins only needed to dimerize with their maize partner to enter the nucleus and bind DNA, but were otherwise sufficient by themselves to activate the appropriate downstream genes. Consequently we created an ap3 pi double mutant containing both AP3pro:Si1 and AP3pro:Zmm16 transgenes by crossing strongly rescued AP3pro:Si1 and AP3pro:Zmm16 plants. The rescued double mutant showed a combination of traits of the individually rescued plants. Early flowers showed a weak rescue with very short stamens and greenish sepaloid petals (not shown). Later flowers had elongated stamens and white petals with the involuted margins of the AP3pro:Zmm16 plants (Fig. 4E,J). The stamens of later flowers produced fertile pollen and the plants were self fertile. The sepals of these plants showed even more dramatic petaloid characteristics than the AP3pro:Zmm16 plants, and were almost completely white (Fig. 4E). The epidermal cells of the rescued double mutant showed partial rescue similar to the individually rescued plants (Fig. 4O).
F2 progeny resulting from the above cross were also identified in which the AP3pro:Si1 transgene was present in a pi-1 homozygous background, and AP3pro:Zmm16 was present in the ap3-3 homozygous background. In both cases, the transgene failed to rescue the mutant, as the plants were indistinguishable from the ap3 and pi mutants (data not shown).
In order to determine the approximate insert copy number for these rescued plants, Southern blot analysis was carried out with a transgene specific probe. The AP3pro:Si1 line contained 7-11 copies of the transgene, whereas the AP3pro:Zmm16 line contained 4-8 copies (data not shown). The large number of inserts may indicate increased levels of transgene expression relative to their native Arabidopsis orthologs. In order to assess expression levels, we performed an RNA dot blot with total RNA isolated from the inflorescences of the rescued lines and wild type, and hybridized with gene-specific AP3, Si1 and Zmm16 probes (see Materials and methods). The AP3pro:Si1 transgene was expressed at approximately five times the level of the wild-type AP3, whereas AP3pro:Zmm16 was expressed at twice the wild-type AP3 levels (Fig. 5). These results indicate that although capable of rescuing the mutant phenotype, the maize B-function orthologs may require higher levels of expression than are exhibited by the wild-type Arabidopsis B-class genes.
|
| Discussion |
|---|
|
|
|---|
A careful analysis of Zmm16 expression in developing male
spikelets shows that Zmm16 expression mimics that of the previously
characterized Si1, with the exception of a slightly higher level of
expression in the emerging carpel primordia. A similar expression pattern was
reported previously (Münster et al.,
2001
). However, our in situ results also show a downregulation in
the center of the floral meristem prior to organogenesis. A similar
downregulation is seen with Si1, and suggests that the maize B-class
genes are tightly co-regulated.
That Si1 and Zmm16 expression domains overlap in the stamen and the lodicule primordia suggests that SI1 and ZMM16 proteins interact there to promote stamen and lodicule identity, as do AP3 and PI in promoting stamen and petal identity. Further evidence for this interaction is provided by the DNA-binding assays, which show that neither SI1 nor ZMM16 can bind DNA alone; instead each requires the presence of the other. The similar expression patterns of Si1 and Zmm16, together with their mutual dependence for DNA binding, indicate that an obligate heterodimer pair performs the B-class function of promoting stamens and lodicules in maize just as AP3/PI and DEF/GLO promote petal and stamen identity in the eudicot species Arabidopsis and Antirrhinum, respectively. Our observation of obligate heterodimerization is further corroborated by, and is consistent with, the silky1 mutant phenotype. Unlike many closely related MADS-box genes that show genetic redundancy in Arabidopsis (e.g. SEPALATA1, 2 and 3), AP3 and PI show no apparent redundancy, a probable result of obligate heterodimerization. It is clear from the si1 phenotype that ZMM16 alone is not capable of promoting either stamen or lodicule identity, suggesting that a SI1-ZMM16 heterodimer is necessary for B-class function in maize.
A study of the DNA-binding properties of B-class genes from Gnetum
gnemon (a gymnosperm) and Lilium regale (lily, a monocot) has
suggested that obligate heterodimerization of AP3-like proteins with PI-like
proteins evolved from homodimerization
(Winter et al., 2002b
).
Interestingly, that study shows that the two lily PI-like proteins, LRGLOA and
LRGLOB, are both capable of binding DNA as a homodimer, whereas the lily
AP3-like protein, LRDEF, requires a PI-like partner. Similar results were
found for B-class proteins in Tulipa, a genus closely related to
Lilium (Kanno et al.,
2003
). These data appear to be inconsistent with our observation
that ZMM16 cannot bind DNA as a homodimer, but requires SI1 as a partner.
However, a clear interpretation of these findings is complicated by the
existence of various PI-like gene duplications in monocots and
insufficient analysis of this character among those lineages. Consequently, it
is not clear whether obligate heterodimerization is an ancestral state that
was lost in the LRGLOA/B lineage, or whether homodimerization is
ancestral and obligate heterodimerization evolved independently in the lineage
leading to Zmm16. Although the ability of the gymnosperm B-class
protein GGM2 to bind DNA as a homodimer might suggest that homodimerization is
ancestral, it is potentially problematic to draw inferences from such a
distant outgroup that diverged before the duplication that created the
AP3 and PI lineages. A more phylogenetically representative
analysis of the dimerization specificity of monocot and other PI-like
proteins, including the two other maize duplicates of ZMM16 (ZMM18 and ZMM29),
would help to elucidate these issues. This is especially important in the
light of recent evidence suggesting divergent roles for the rice PI
orthologs OsMADS2 and OsMADS4
(Prasad and Vijayraghavan,
2003
).
Evidence for conservation of B-Class gene function between Arabidopsis and maize
Our observation that both Si1 and Zmm16 are sufficient to
rescue their corresponding Arabidopsis mutants also provides
compelling evidence for the conservation of B-class function. It would be
expected, if B-class genes had evolved significantly different roles in either
maize or Arabidopsis, that the maize genes would not be sufficient to
functionally replace the Arabidopsis genes. However, our results
indicate that the maize genes, either in combination with their respective
Arabidopsis B-class protein partners, or together in Arabidopsis
ap3 pi double mutants, are capable of correctly regulating the downstream
targets necessary for stamen and petal development, even though in maize,
B-class activity is essential for promoting stamen and lodicule
development.
It is important to note that the rescue seen in the two strong lines
examined was correlated with higher levels of expression than that of the
Arabidopsis orthologs. Consequently, it may be necessary to have
higher levels of the maize proteins in order to rescue the
Arabidopsis mutants. Considering there is an estimated 150 million
years of evolution separating monocots and eudicots, and that there is an
overall amino acid sequence identity of only 48% in the case of Si1
and AP3, and 51% for Zmm16 and PI, higher amounts
of the maize proteins may be required to drive interactions with other
Arabidopsis proteins on target gene promoters. Furthermore,
Si1 is a member of the paleoAP3 lineage, whereas
AP3 is a member of the higher eudicot euAP3 lineage, created
by a gene duplication event and a subsequent translational frameshift that
resulted in distinct C-terminal motifs characteristic of each lineage
(Kramer et al., 1998
;
Vandenbussche et al., 2003
).
In the light of this divergence, it is perhaps not surprising that increased
levels of the maize genes are necessary to strongly rescue the
Arabidopsis B-class mutants. When the eudicot Antirrhinum
DEF gene was used to rescue the Arabidopsis ap3-3 mutant, the
rescue was not complete (Irish and
Yamamoto, 1995
). Thus, even a closely related AP3 homolog
of the euAP3 lineage is not sufficient to fully rescue the strong
ap3-3 mutant.
If it is granted that lodicules represent a modified petal, then our
complementation results make it intriguing to speculate on the difference
between a petal and lodicule. The extreme morphological differences between
mature lodicules and petals suggest that many of the genes controlling their
respective morphogenesis would either be different, or have evolved different
transcriptional or biochemical roles. Contrary to this expectation, our
results show that the major regulators of lodicule identity in maize are
capable of correctly identifying most of the immediate downstream targets
needed to correctly specify petal identity in Arabidopsis, suggesting
that many of the immediate B-class gene targets may be similar in maize and
Arabidopsis. It is possible, then, that the differences between
petals and lodicules are largely due to the differential activity of genes
downstream of the initial targets of B-class proteins. However, a microarray
analysis designed to identify the downstream targets of Arabidopsis
AP3 and PI proteins suggests that they regulate very few transcription
factors, and thus directly control the basic biochemical genes involved in
petal and stamen morphogenesis (Zik and
Irish, 2003
). In the light of that study, another possibility is
that the unique morphogenesis of lodicules requires an ancestral
petal-promoting activity that is still associated with the maize B-class
genes, in addition to an important novel transcriptional activity necessary
for lodicule specification.
To our knowledge, our results represent the first time an orthologous maize
regulatory gene has been successful at rescuing an Arabidopsis
developmental mutant, when expressed from the orthologous promoter. It seems
likely, therefore, that many maize genes are capable of complementing
Arabidopsis developmental mutants. A study in which the R
gene (a maize bHLH transcription factor that regulates anthocyanin
biosynthesis) was constitutively expressed in Arabidopsis showed that
it could rescue the transparent testa glabrous (ttg) mutant
(Lloyd et al., 1992
). However,
TTG was subsequently shown to be caused by a mutation in a gene
encoding a WD40 repeat protein, and was clearly not orthologous to R
(Walker et al., 1999
).
Consequently, care must be taken when interpreting rescue as sufficient
evidence of functional equivalence without further genetic or biochemical
evidence. In the case of Si1 and Zmm16, we feel that there
is a strong case for functional equivalence when one considers the similarity
in mutant phenotypes of Si1 plants with those of ap3 or
pi, together with the similarity in DNA-binding activity of the maize
and Arabidopsis B-class genes, and the ability of the maize genes to
largely complement their corresponding Arabidopsis mutants when
expressed under an appropriate B-class promoter.
Implications for the evolution of angiosperm petals
Some interesting issues raised by the ability of maize B-class genes to
functionally replace Arabidopsis homologs concern the relationship of
lodicules to petals, and the history of petal evolution in angiosperms. The
classical view of flower evolution in angiosperms holds that the reproductive
structures (stamens and carpels) evolved just once, whereas the petals and
sepals independently evolved many times (Takthajan, 1991). It is generally
accepted that B-class genes promote stamen identity across the angiosperms.
Such a role is likely to be derived from an ancestral role, maintained in
gymnosperms, of specifying male cone identity
(Fukui et al., 2001
;
Mouradov et al., 1999
;
Sundstrom et al., 1999
;
Sundstrom and Engstrom, 2002
;
Winter et al., 1999
). However,
a conserved B-class role in specifying petal identity in all angiosperms is
more controversial, as B-class gene expression is often highly variable, even
among the basal eudicots (Kramer and
Irish, 1999
; Kramer and Irish,
2000
). More recently, Lamb and Irish
(Lamb and Irish, 2003
) have
shown that the C terminus from a basal eudicot AP3-like protein, when fused to
the Arabidopsis AP3, is capable of rescuing stamen but not petal
development in an ap3 mutant. In contrast to these findings, our
results show that the more distantly related, full-length grass B-class
proteins are capable of identifying and properly regulating the genes
necessary for proper petal and stamen development in a eudicot flower. Thus,
the lack of petal rescue observed by Lamb and Irish
(Lamb and Irish, 2003
) may
represent a derived state of this lineage of basal eudicot AP3 genes
resulting from gene duplication and divergence. Alternatively, amino acid
differences in the C-terminal region of this AP3 ortholog may require
compensatory changes in other domains of the protein in order to promote both
stamen and petal development. Their derived fusion construct between AP3 and
the C terminus of this paleoAP3 would not have contained such compensatory
changes.
We feel that the striking rescue of petal identity in Arabidopsis
by maize B-class genes is further evidence supporting the homology between
petals and grass lodicules. Although compelling, this evidence cannot exclude
the possibility that B-class genes were recruited independently to specify
lodicules in grasses. Furthermore, the petal rescue demonstrated by
Si1 and Zmm16 could be interpreted as non-specific, and
simply the result of expressing a related gene family member. However, we
think this is an unlikely explanation, as a Gnetum gnemon B-class
gene is totally incapable of promoting petal identity in the second whorl of
an Arabidopsis ap3-3 mutant
(Winter et al., 2002a
).
Nevertheless, a more rigorous demonstration of homology would need to involve
loss of B-class gene function in a range of species, including monocots that
have more obvious petaloid organs. One such mutant possibly exists in the
viridiflora cultivar of tulip, which shows homeotic transformations
similar to eudicot B-class mutants (van
Tunen et al., 1993
). However, it is not yet known whether a mutant
B-class MADS-box gene is involved. It is interesting to note that the
Joinvilleaceae, a sister group to the grasses
(Kellogg, 2000
), has a
differentiated whorl of sepals and petals, and Streptochaeta, a basal
grass genus, contains three foliar organs in the position of lodicules
(Mathews et al., 2000
;
Page, 1951
). Analysis of
B-class gene expression in these species will provide evidence that may help
resolve these questions regarding the relationship of lodicules and
petals.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ambrose, B. A., Lerner, D. R., Ciceri, P., Padilla, C. M., Yanofsky, M. F. and Schmidt, R. J. (2000). Molecular and genetic analyses of the silky1 gene reveal conservation in floral organ specification between eudicots and monocots. Mol. Cell 5, 569-579.[CrossRef][Medline]
Angenent, G. C., Franken, J., Busscher, M., van Dijken, A., van Went, J. L., Dons, H. J. and van Tunen, A. J. (1995). A novel class of MADS box genes is involved in ovule development in petunia. Plant Cell 7,1569 -1582.[Abstract]
Burr, B., Burr, F. A., Thompson, K. H., Albertson, M. C. and
Stuber, C. W. (1988). Gene mapping with recombinant
inbreds in maize. Genetics
118,519
-526.
Chung, Y.-Y., Kim, S.-R., Kang, H.-G., Noh, Y.-S., Chul, P. M., Finkela, D. and An, G. (1995). Characterization of two rice MADS box genes homologous to GLOBOSA. Plant Sci. 109, 45-56.[CrossRef]
Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16,735 -743.[CrossRef][Medline]
Coen, E. S. and Meyerowitz, E. M. (1991). The war of the whorls: genetic interactions controlling flower development. Nature 353,31 -37.[CrossRef][Medline]
Colombo, L., Franken, J., Koetje, E., van Went, J., Dons, H. J., Angenent, G. C. and van Tunen, A. J. (1995). The petunia MADS box gene FBP11 determines ovule identity. Plant Cell 7,1859 -1868.[Abstract]
Fukui, M., Futamura, N., Mukai, Y., Wang, Y., Nagao, A. and
Shinohara, K. (2001). Ancestral MADS box genes in
Sugi, Cryptomeria japonica D. Don (Taxodiaceae), homologous to the B function
genes in angiosperms. Plant Cell Physiol.
42,566
-575.
Goto, K. and Meyerowitz, E. M. (1994). Function
and regulation of the Arabidopsis floral homeotic gene PISTILLATA.
Genes Dev. 8,1548
-1560.
Irish, V. F. and Yamamoto, Y. T. (1995). Conservation of floral homeotic gene function between Arabidopsis and antirrhinum. Plant Cell 7,1635 -1644.[Abstract]
Jack, T., Brockman, L. L. and Meyerowitz, E. M. (1992). The homeotic gene APETALA3 of Arabidopsis thaliana encodes a MADS box and is expressed in petals and stamens. Cell 68,683 -697.[CrossRef][Medline]
Jack, T., Fox, G. L. and Meyerowitz, E. M. (1994). Arabidopsis homeotic gene APETALA3 ectopic expression: transcriptional and posttranscriptional regulation determine floral organ identity. Cell 76,703 -716.[CrossRef][Medline]
Kang, H. G., Jeon, J. S., Lee, S. and An, G. (1998). Identification of class B and class C floral organ identity genes from rice plants. Plant Mol. Biol. 38,1021 -1029.[CrossRef][Medline]
Kanno, A., Saeki, H., Kameya, T., Saedler, H. and Theissen, G. (2003). Heterotopic expression of class B floral homeotic genes supports a modified ABC model for tulip (Tulipa gesneriana). Plant Mol. Biol. 52,831 -841.[CrossRef][Medline]
Kellogg, E. A. (2000). The grasses: a case study in macroevolution. Annu. Rev. Ecol. Syst. 31,217 -238.[CrossRef]
Kramer, E. M. and Irish, V. F. (1999). Evolution of genetic mechanisms controlling petal development. Nature 399,144 -148.[CrossRef][Medline]
Kramer, E. M. and Irish, V. F. (2000). Evolution of the petal and stamen developmental programs: evidence from comparative studies of the lower eudicots and basal angiosperms. Int. J. Plant Sci. 161,S29 -S40.[CrossRef]
Kramer, E. M., Dorit, R. L. and Irish, V. F.
(1998). Molecular evolution of genes controlling petal and stamen
development: duplication and divergence within the APETALA3 and PISTILLATA
MADS-box gene lineages. Genetics
149,765
-783.
Krizek, B. A. and Meyerowitz, E. M. (1996). The Arabidopsis homeotic genes APETALA3 and PISTILLATA are sufficient to provide the B class organ identity function. Development 122, 11-22.[Abstract]
Kyozuka, J. and Shimamoto, K. (2002). Ectopic
expression of OsMADS3, a rice ortholog of AGAMOUS, caused a homeotic
transformation of lodicules to stamens in transgenic rice plants.
Plant Cell Physiol. 43,130
-135.
Lamb, R. S. and Irish, V. F. (2003). Functional
divergence within the APETALA3/PISTILLATA floral homeotic gene lineages.
Proc. Natl. Acad. Sci. USA
100,6558
-6563.
Lloyd, A. M., Walbot, V. and Davis, R. W.
(1992). Arabidopsis and Nicotiana anthocyanin production
activated by maize regulators R and C1. Science
258,1773
-1775.
Mathews, S., Tsai, R. C. and Kellogg, E. A.
(2000). Phylogenetic structure in the grass family (Poaceae):
evidence from the nuclear gene phytochrome B. Am. J.
Bot. 87,96
-107.
McGonigle, B., Bouhidel, K. and Irish, V. F.
(1996). Nuclear localization of the Arabidopsis APETALA3 and
PISTILLATA homeotic gene products depends on their simultaneous expression.
Genes Dev. 10,1812
-1821.
Mena, M., Mandel, M. A., Lerner, D. R., Yanofsky, M. F. and Schmidt, R. J. (1995). A characterization of the MADS-box gene family in maize. Plant J. 8, 845-854.[CrossRef][Medline]
Mena, M., Ambrose, B. A., Meeley, R. B., Briggs, S. P.,
Yanofsky, M. F. and Schmidt, R. J. (1996). Diversification of
C-function activity in maize flower development.
Science 274,1537
-1540.
Moon, Y. H., Jung, J. Y., Kang, H. G. and An, G. (1999). Identification of a rice APETALA3 homologue by yeast two-hybrid screening. Plant Mol. Biol. 40,167 -177.[CrossRef][Medline]
Mouradov, A., Hamdorf, B., Teasdale, R. D., Kim, J. T., Winter, K. U. and Theissen, G. (1999). A DEF/GLO-like MADS-box gene from a gymnosperm: Pinus radiata contains an ortholog of angiosperm B class floral homeotic genes. Dev. Genet. 25,245 -252.[CrossRef][Medline]
Münster, T., Wingen, L. U., Faigl, W., Werth, S., Saedler, H. and Theissen, G. (2001). Characterization of three GLOBOSA-like MADS-box genes from maize: evidence for ancient paralogy in one class of floral homeotic B-function genes of grasses. Gene 262,1 -13.[CrossRef][Medline]
Nagasawa, N., Miyoshi, M., Sano, Y., Satoh, H., Hirano, H.,
Sakai, H. and Nagato, Y. (2003). SUPERWOMAN1 and
DROOPING LEAF genes control floral organ identity in rice.
Development 130,705
-718.
Neff, M. M., Neff, J. D., Chory, J. and Pepper, A. E. (1998). dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: experimental applications in Arabidopsis thaliana genetics. Plant J. 14,387 -392.[CrossRef][Medline]
Page, V. M. (1951). Morphology of the Spikelet of Streptochaeta. Bull. Torrey Club 78, 22-37.[CrossRef]
Pelaz, S., Ditta, G. S., Baumann, E., Wisman, E. and Yanofsky, M. F. (2000). B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature 405,200 -203.[CrossRef][Medline]
Prasad, K. and Vijayraghavan, U. (2003).
Double-stranded RNA interference of a rice PI/GLO paralog, OsMADS2, uncovers
its second-whorl-specific function in floral organ patterning.
Genetics 165,2301
-2305.
Riechmann, J. L. and Meyerowitz, E. M. (1997). MADS domain proteins in plant development. Biol. Chem. 378,1079 -1101.[Medline]
Riechmann, J. L., Krizek, B. A. and Meyerowitz, E. M.
(1996). Dimerization specificity of Arabidopsis MADS domain
homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS.
Proc. Natl. Acad. Sci. USA
93,4793
-4798.
Savidge, B., Rounsley, S. D. and Yanofsky, M. F. (1995). Temporal relationship between the transcription of two Arabidopsis MADS box genes and the floral organ identity genes. Plant Cell 7,721 -733.[Abstract]
Schwarz-Sommer, Z., Hue, I., Huijser, P., Flor, P. J., Hansen, R., Tetens, F., Lonnig, W. E., Saedler, H. and Sommer, H. (1992). Characterization of the Antirrhinum floral homeotic MADS-box gene deficiens: evidence for DNA binding and autoregulation of its persistent expression throughout flower development. EMBO J. 11,251 -263.[Medline]
Sommer, H., Beltran, J. P., Huijser, P., Pape, H., Lonnig, W. E., Saedler, H. and Schwarz-Sommer, Z. (1990). Deficiens, a homeotic gene involved in the control of flower morphogenesis in Antirrhinum majus: the protein shows homology to transcription factors. EMBO J. 9,605 -613.[Medline]
Sundstrom, J. and Engstrom, P. (2002). Conifer reproductive development involves B-type MADS-box genes with distinct and different activities in male organ primordia. Plant J. 31,161 -169.[CrossRef][Medline]
Sundstrom, J., Carlsbecker, A., Svensson, M. E., Svenson, M., Johanson, U., Theissen, G. and Engstrom, P. (1999). MADS-box genes active in developing pollen cones of Norway spruce (Picea abies) are homologous to the B-class floral homeotic genes in angiosperms. Dev. Genet. 25,253 -266.[CrossRef][Medline]
Takhtajan, A. (1991). Evolutionary trends in flowering plants. New York, NY: Columbia University Press.
Trobner, W., Ramirez, L., Motte, P., Hue, I., Huijser, P., Lonnig, W. E., Saedler, H., Sommer, H. and Schwarz-Sommer, Z. (1992). GLOBOSA: a homeotic gene which interacts with DEFICIENS in the control of Antirrhinum floral organogenesis. EMBO J. 11,4693 -4704.[Medline]
van Tunen, A. J., Eikelboom, W. and Angenent, G. C. (1993). Floral organogenesis in Tulipa. Flowering Newslett. 16,33 -37.
Vandenbussche, M., Theissen, G., van de Peer, Y. and Gerats,
T. (2003). Structural diversification and
neo-functionalization during floral MADS-box gene evolution by C-terminal
frameshift mutations. Nucleic Acids Res.
31,4401
-4409.
Walker, A. R., Davison, P. A., Bolognesi-Winfield, A. C., James,
C. M., Srinivasan, N., Blundell, T. L., Esch, J. J., Marks, M. D. and
Gray, J. C. (1999). The TRANSPARENT TESTA GLABRA1 locus,
which regulates trichome differentiation and anthocyanin biosynthesis in
Arabidopsis, encodes a WD40 repeat protein. Plant Cell
11,1337
-1350.
Weigel, D. and Meyerowitz, E. M. (1994). The ABCs of floral homeotic genes. Cell 78,203 -209.[CrossRef][Medline]
Wikstrom, N., Savolainen, V. and Chase, M. W. (2001). Evolution of the angiosperms: calibrating the family tree. Proc. R. Soc. Lond., B, Biol. Sci. 268,2211 -2220.[Medline]
Winter, K. U., Becker, A., Münster, T., Kim, J. T.,
Saedler, H. and Theissen, G. (1999). MADS-box genes
reveal that gnetophytes are more closely related to conifers than to flowering
plants. Proc. Natl. Acad. Sci. USA
96,7342
-7347.
Winter, K. U., Saedler, H. and Theissen, G. (2002a). On the origin of class B floral homeotic genes: functional substitution and dominant inhibition in Arabidopsis by expression of an orthologue from the gymnosperm Gnetum. Plant J. 31,457 -475.[CrossRef][Medline]
Winter, K. U., Weiser, C., Kaufmann, K., Bohne, A., Kirchner,
C., Kanno, A., Saedler, H. and Theissen, G. (2002b).
Evolution of class B floral homeotic proteins: obligate heterodimerization
originated from homodimerization. Mol. Biol. Evol.
19,587
-596.
Zik, M. and Irish, V. F. (2003). Global
identification of target genes regulated by APETALA3 and PISTILLATA floral
homeotic gene action. Plant Cell
15,207
-222.
This article has been cited by other articles:
![]() |
W.-C. Tsai, Z.-J. Pan, Y.-Y. Hsiao, M.-F. Jeng, T.-F. Wu, W.-H. Chen, and H.-H. Chen Interactions of B-class complex proteins involved in tepal development in Phalaenopsis orchid Plant Cell Physiol., May 1, 2008; 49(5): 814 - 824. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Drea, L. C. Hileman, G. de Martino, and V. F. Irish Functional analyses of genetic pathways controlling petal specification in poppy Development, December 1, 2007; 134(23): 4157 - 4166. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Piwarzyk, Y. Yang, and T. Jack Conserved C-Terminal Motifs of the Arabidopsis Proteins APETALA3 and PISTILLATA Are Dispensable for Floral Organ Identity Function Plant Physiology, December 1, 2007; 145(4): 1495 - 1505. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shitsukawa, C. Tahira, K.-i. Kassai, C. Hirabayashi, T. Shimizu, S. Takumi, K. Mochida, K. Kawaura, Y. Ogihara, and K. Murai Genetic and Epigenetic Alteration among Three Homoeologous Genes of a Class E MADS Box Gene in Hexaploid Wheat PLANT CELL, June 1, 2007; 19(6): 1723 - 1737. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Yadav, K. Prasad, and U. Vijayraghavan Divergent Regulatory OsMADS2 Functions Control Size, Shape and Differentiation of the Highly Derived Rice Floret Second-Whorl Organ Genetics, May 1, 2007; 176(1): 283 - 294. [Abstract] [Full Text] [PDF] |
||||