|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 17 November 2004
doi: 10.1242/dev.01549
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Department of Biomedical Sciences, The University of Edinburgh, Hugh Robson
Building, George Square, Edinburgh EH8 9XD, UK
2 Institute of Gene Biology, Russian Academy of Sciences, Vavilova 34/5, Moscow,
119334, Russian Federation
3 Human Genetics Unit, MRC, Western General Hospital, Crewe Road, Edinburgh EH4
2XU, UK
Author for correspondence (e-mail:
r.meehan{at}hgu.mrc.ac.uk)
Accepted 28 October 2004
| SUMMARY |
|---|
|
|
|---|
Key words: DNA methylation, Kaiso, Transcriptional repression, Xenopus, Differentiation
| Introduction |
|---|
|
|
|---|
The general model for indirect repression by DNA methylation predicts that
methyl-CpG binding proteins mediate silencing in pre-MBT embryos by recruiting
enzymatic complexes that modify local chromatin structure
(Jones et al., 1998
;
Nan et al., 1998
;
Wade et al., 1999
). This
results in a closed heterochromatic structure that is refractory to
transcription (Jaenisch and Bird,
2003
). Conversely, loss of DNA methylation can lead to a
relaxation in chromatin-based silencing mechanisms in somatic cells such that
the threshold for gene activation and consequent developmental potential is
altered (Jaenisch and Bird,
2003
; Meehan,
2003
). In Xenopus, as in mice, inactivation of the
maintenance DNA methyltransferase xDnmt1 results in hypomethylation
of genomic DNA, ectopic expression of normally silent genes and embryonic
lethality (Jackson-Grusby et al.,
2001
; Stancheva and Meehan,
2000
). xDnmt1 deficient embryos exhibit premature gene
expression at least two cell cycles earlier than normal (prior to the MBT),
implying that the correct timing of zygotic activation is regulated in part by
the repressive effect of DNA methylation during early blastula stages
(Stancheva and Meehan,
2000
).
In mammals, three repressor proteins, MeCP2, MBD1 and MBD2, bind methylated
CpGs via a conserved motif called the methyl-CpG binding domain
(Cross et al., 1997
;
Hendrich and Bird, 1998
). The
MBD motif is
70 amino acids long and is found in a diverse number of
nuclear proteins, only a subset of which can bind methylated DNA
(Hendrich and Tweedie, 2003
).
In vitro and transient transfection experiments provide good evidence that
MeCP2, MBD1 and MBD2 act as transcriptional repressors of methylated reporter
templates (Nan et al., 1997
;
Ng et al., 1999
;
Ng et al., 2000
). In addition,
chromatin immunoprecipitation (ChIP) experiments localise MeCP2, MBD2 and MBD1
to methylated and silenced genes. The chromatin of these genes is also
hypoacetylated and contains H3 that is methylated on lysine 9 (H3K9Me), both
hallmarks of inactive chromatin (Ballestar
et al., 2003
; Gregory et al.,
2001
). A number of histone deacetylases (HDAC) and histone
methyltransferases (HMT) are associated with MeCP2, MBD1, MBD3 and DNA
methyltransferases. This reinforces the mechanistic link between DNA
methylation and specific histone modifications in promoting gene silencing
(Jaenisch and Bird, 2003
).
Mbd2/-derived embryonic cells have a
reduced ability to repress methylated reporter genes in transient transfection
assays, and the activation threshold of specific genes is altered upon
differentiation (Hendrich et al.,
2001
; Hutchins et al.,
2002
). However, the expectation that MeCP/MBDs might act as global
repressors of transcription from methylated templates in vivo was not
supported: the absence of MeCP2, MBD1 or MBD2 function does not disrupt
specific programs of developmental gene expression in mice (including
X-chromosome inactivation), nor does it phenocopy the effects of Dnmt1
inactivation (Chen et al.,
2001
; Guy et al.,
2001
; Hendrich et al.,
2001
; Tudor et al.,
2002
; Zhao et al.,
2003
). Only MBD3 is required for early murine development, but as
this MBD does not actually bind methylated DNA, MBD3/
embryo lethality is probably the result of its role as a core component of the
NuRD/MeCP1 transcription repressor complex
(Hendrich et al., 2001
).
A very different methylated DNA-dependent binding domain was identified in
the transcriptional repressor kaiso (ZBTB33 Human Gene
Nomenclature Database), which binds methyl CpGs through a zinc-finger (ZF)
motif (Prokhortchouk et al.,
2001
). Kaiso recognizes DNA sequences that contain at least two
methyl-CpGs, and represses transcription from reporter templates in a
methyl-CpG-dependent manner (Prokhortchouk
et al., 2001
; Yoon et al.,
2003
). It was originally discovered in a two-hybrid screen using
the cell adhesion co-factor p120ctn as bait
(Daniel and Reynolds, 1999
).
Like the armadillo-related protein ß-catenin, to which it is structurally
homologous, p120ctn interacts with the cytoplasmic domain of the
transmembrane cell adhesion molecule E-cadherin. Kaiso could possibly mediate
p120ctn/E-cadherin signalling to the nucleus to regulate the
expression of methylated target genes. In HeLa cells, kaiso mediates silencing
of the MTA2 gene by interacting with the N-CoR co-repressor complex via its
POZ domain (Yoon et al.,
2003
). A Xenopus homologue, xKaiso, has recently
been described (Kim et al.,
2002
). We noted that its expression pattern matched that of
xDnmt1 (A.R. and R.M., unpublished), which hinted that it could have
a potential role in regulating transcription silencing in pre-MBT embryos
(Stancheva and Meehan,
2000
).
We wished to determine the binding specificity of xKaiso and its ability to act as a methylation-dependent repressor, and to investigate its role in transcriptional silencing during early amphibian development. We show that xKaiso has a similar, if not more pronounced preference for methylated DNA compared with its mammalian counterpart. Depletion of xKaiso function in Xenopus embryos results in premature activation of pre-MBT zygotic transcription. The depletion phenotype can be rescued by overexpression of wild-type human kaiso, but not by a mutant lacking a functional methyl-CpG binding domain. Our analysis suggests that xKaiso is essential for methylation-dependent transcriptional silencing in early amphibian embryos.
| Materials and methods |
|---|
|
|
|---|
EMSA experiments
Binding reactions were as described using 5% PAGE in 0.3 x TBE to
resolve DNA-protein complexes with Non-Sm and Me-Sm probes
(Prokhortchouk et al., 2001
)
and the human matrilysin (Hmat) oligo
(Daniel et al., 2002
).
Methyl CpG-dependent repression test
The ability of xKaiso to repress transcription from a methylated
reporter gene using Mbd2/ cells was
performed as described previously
(Hendrich et al., 2001
;
Prokhortchouk et al.,
2001
).
Protein extracts and immunoblots
Total protein extracts for western blotting were prepared from staged
wild-type eggs, and wild-type and KMO-injected blastulae and gastrulae as
described (Stancheva et al.,
2001
). Extracts were run in 10% SDS-polyacrylamide gels and
electro-transferred to PVDF membrane. xKaiso was detected by a
monoclonal antibody against the conserved N-terminal domain of mouse kaiso
(Zymed, clone 6F). Anti-mouse HRP-conjugated IgGs were used as secondary
antibodies.
Kaiso p120 catenin interaction test
p120 mouse cDNA (forms 1A and 3A) was cloned into pFASTBAC1 vector
(Invitrogen) from pMS2-p1201A and pMS2-p1203A (provided by Dr Al Reynolds).
The proteins (1A and 3A co-transfected) were expressed in Sf9 insect
cells using the Bac-to-Bac Baculovirus Expression System (Invitrogen). Cell
extracts were added to GST-Kaiso Sepharose, incubated for 1 hour at
room temperature, washed three times with PBS. Bound proteins were eluted with
glutathione and resolved by SDS-PAGE, blotted and visualised with antibodies
specific either to p120 catenin (mAb clone 15D2) or to kaiso (ZF6).
Embryos and microinjections
Xenopus embryos were obtained from in vitro fertilized wild-type
and albino eggs or by natural mating of sexually mature frogs. They were
grown, staged and microinjected according to standard procedures
(Stancheva and Meehan, 2000
).
At the two-cell stage, the embryos were injected into the animal half of the
embryos with 0.5-10 ng/cell of xKaiso morpholino oligo (KMO),
GATCAGCTTTTTTGTCTCCATGTCT; xDnmt1 morpholino oligo (DMO),
GGACAGGCGTGAAACAGACTCGGC; or control morpholino, CGCTCAGCTCCTCCATGTCTGCCGC
(Gene-Tools); and/or 200-750 pg of sense capped RNA synthesized in vitro
(T3/T7 Cap-Scribe kit, Boehringer). Whole-embryo run-on experiments with
[
-35S]UTP incorporation were performed using 5 ng
KMO-injected and wild-type embryos, as described
(Stancheva and Meehan, 2000
).
The whole-mount TUNEL staining of embryos was as described previously
(Hensey and Gautier,
1998
).
RT-PCR analysis
RNA was isolated as described previously
(Stancheva and Meehan, 2000
).
cDNA was synthesised from five embryos using Superscript II reverse
transcriptase (RT) (Invitrogen). RT-PCR was performed over a range of cDNA
dilutions and PCR cycles to ensure exponential amplification. xODC
was used as a loading control, and cDNA was synthesised in the absence of RT
to control for genomic DNA contamination. Primer sequences used were: xBEF-U,
5'-CCGAAACAGCTTCCAGACAA-3'; xBEF-L,
5'-TGAAAGGAAAGCAGACGCTC-3'; xDRAK1-U,
5'-ACCGAGAGGAGGAAGTCACT-3'; xDRAK-L,
5'-GGCTTAAAGGAAACAAGTCC-3'; xOct-25-U,
5'-TAATGGAGAGATGCTTGATG-3'; xOct-25-L,
5'-TTCTCTATGTTCGTCCTCC-3'; xODC-U,
5'-GGAGCTGCAAGTTTGGAGA-3'; xODC-L,
5'-TCAGTTGCCAGTGTGGTC-3'.
Magex array hybridisation and analysis
cDNA filters were obtained from Viagenx (Canada). Arrays were probed as
described previously with minor modifications
(Helbing et al., 2003
). In
brief, Xenopus total RNA was isolated and cDNA was synthesised using
the SuperSMART kit (Clontech, USA) (Barnett
et al., 1998
). cDNA was amplified in the exponential phase by PCR
using 21-23 cycles at an annealing temperature of 63°C. cDNA probes were
labelled with [
-32P]dCTP by random priming using the
HexaLabel kit (Fermentas, UK). Arrays were hybridised in Church & Gilbert
hybridisation solution (0.5 M Na2HPO4, 7% SDS, 1 mM
EDTA, pH 7.2) at 65°C and washed to high stringency in 40 mM
Na2HPO4, 1% SDS at 65°C. Images were acquired using
AIDA software and the FLA2000 phosphorimager. Scanalyze
(Eisen et al., 1998
) was used
to acquire gene spot intensities and non-signal backgrounds. Data across
hybridisation experiments were normalised to the 18S rRNA spots intensity.
CpG island analysis
DNA sequences were analysed using the CpG island analysis tool at the
Potential Promoter Regulatory Element Database
(http://idealab.cs.uiowa.edu/cgi-bin/HPD/cg.cgi).
The following parameters were used: minimum CpG island length 200 bp, minimum
CpG content 0.5, and observed/expected CpG ratio 0.6. The genes from the MAGEX
array were divided into three groups: genes containing (1) a CpG-rich region
within first 100 bp of cDNA sequence; (2) CpG-rich region(s) outside the first
100 bp of cDNA sequence; and (3) no CpG-rich regions.
| Results |
|---|
|
|
|---|
|
|
15% of control non-methylated reporter transcription
activity. Expression of either xKaiso or human kaiso in this cell
line restored repression from the methylated reporter, but not from the
non-methylated control (Fig.
1D, and data not shown). Thus, xKaiso shows the same
ability to repress transcription from a methylated reporter gene in the
Mbd2/ cell system as its mammalian homologue
(Prokhortchouk et al.,
2001
xKaiso is essential for Xenopus development
To analyse xKaiso function during development, we injected
Xenopus two-cell stage embryos with a stabilised antisense
xKaiso morpholino oligonucleotide (KMO) corresponding to the
5'-UTR and first six codons (see Materials and methods). This
efficiently blocks xKaiso protein translation
(Fig. 2G). Injection with 10 ng
of a control non-inhibitory morpholino (CMO) resulted in normal development
(see Table S1 in the supplementary material;
Fig. 2A). By contrast, embryos
injected with 0.5-10 ng KMO morpholino failed to develop and exhibited a
variety of dose-dependent phenotypes (see Table S1 in the supplementary
material; Fig. 2B-E). The
characteristic feature of the 5 ng KMO-injected embryos is the appearance of
white apoptopic cells near the edge of the blastopore in neurulating embryos
(Fig. 2B-D;
Fig. 4). By stages 21-22, the
KMO embryos are developmentally arrested and the embryo surface is covered
with apoptotic cells that are associated with cell shedding
(Fig. 2C). Injection of a low
dose (0.5 ng) of KMO into two-cell stage embryos led to a less severe
phenotype with a delay in blastopore closure at stage 15
(Fig. 2D); many of these
embryos exhibited short axis or reduced dorsal structures (spina bifida) by
tadpole stage (Fig. 2E).
Phenotypically, the effect of the KMO injection was similar to that of
xDnmt1 depletion (Fig.
2F) (Stancheva et al.,
2001
; Stancheva and Meehan,
2000
). This overlap with the effects of loss of DNA methylation
suggests that xKaiso may be responsible for mediating silencing of
methylated genes in pre-MBT embryos, and is equally essential to their
survival.
|
|
Kaiso-depleted embryos are apoptotic
xDnmt1 depletion in Xenopus embryos results in induction
of apoptosis (Stancheva et al.,
2001
). We therefore checked whether KMO-injected embryos were
apoptotic, using the whole-mount TUNEL assay, a highly sensitive indicator of
DNA fragmentation in situ (Hensey and
Gautier, 1998
; Stancheva et
al., 2001
). A small number (1-2%) of non-injected control embryos
have low levels of apoptotic cells that are restricted mainly to the
developing nervous system at later stages of neurulation
(Fig. 4A-C)
(Hensey and Gautier, 1998
). By
contrast, in 11% of embryos injected at the two-cell stage with 5 ng of KMO, a
small number of TUNEL-positive cells already appeared at late blastula stage
(Fig. 4D). Fifteen percent of
KMO injected embryos showed TUNEL-positive cells at mid-gastrula stage 11,
mainly restricted to the ectodermal layer
(Fig. 4E). By neurulation, a
general pattern of apoptosis was detected in more than 90% of KMO-injected
embryos (Fig. 4F), consistent
with their visible appearance (Fig.
2C), and development was arrested. Overall, the cellular apoptotic
patterns caused by xKaiso depletion are similar to those observed for
xDnmt1-deficient embryos, further emphasizing the functional
equivalence of loss of this CpG-dependent repressor, or loss of CpG
methylation itself.
Loss of xKaiso activity results in premature activation of gene expression in blastula stage embryos
Reduction in genomic levels of 5mC in Xenopus embryos
results in transcription activation approximately two cycles earlier than
normal (Stancheva et al.,
2002
; Stancheva and Meehan,
2000
). We tested for premature activation of zygotic transcription
in xKaiso-depleted embryos by measuring the incorporation of
-35S labelled UTP in KMO-injected and control embryos at
blastula and gastrula stages (Newport and
Kirschner, 1982a
; Newport and
Kirschner, 1982b
; Stancheva
and Meehan, 2000
). As expected, control embryos begin to
incorporate label above background after MBT. By contrast, 35S-UTP
incorporation in xKaiso-depleted embryos was detected two cell cycles
earlier (Fig. 5A), as had been
previously described for xDnmt1-depleted embryos
(Stancheva and Meehan, 2000
).
In diploid embryos, premature global activation has only been observed upon
xDnmt1 depletion. This strongly suggests that xDnmt1 and
xKaiso may participate in the same pathway to silence genes in
pre-MBT embryos.
|
xKaiso is a genome wide repressor of transcription in the developing embryo
Our results suggest that the methyl-CpG-dependent repression function of
xKaiso is required to maintain transcriptional silence in pre-MBT
Xenopus embryos. To explore the capacity of xKaiso as a
general transcription repressor, we screened a Xenopus cDNA
mini-array with cDNA probes synthesized from pre-MBT stage 8 wild-type embryos
(WT8), and xKaiso morpholino-injected (KMO8) and xKaiso
morpholino/human kaiso mRNA co-injected (KMO8rescue) embryos. The
fold expression changes between KMO8:WT8 and KMO8rescue:WT8 were
computed using ScanAlyze and compared using a threshold of 1.5-fold expression
change (Fig. 6A; Table S2 in
the supplementary material). Fifty-seven genes (13%) were misregulated in the
KMO:WT8 experiments, of which 55 (96%) were upregulated 1.5-fold or more in
KMO8 embryos, and two genes [Mad2 and p33 ringo (ls26)] exhibited a decrease
in expression relative to WT8 embryos (Fig.
6A). Many (25/55) of the genes upregulated in KMO8 were in the
range of a 5- to 10-fold increase. We observed a similar change in expression
pattern for this gene set in xDnmt1-deficient embryos (D.D. and R.M.,
unpublished). By sharp contrast, the overexpression of the 55 genes analysed
in the KMO8:WT8 comparison was largely neutralised in KMO8rescue
embryos. Only 18 (31%) of the genes were greater than 1.5 upregulated (e.g.
GemH1, xMEK2, CycA1 and CycB2 in Fig.
6A,B). Six genes (11%) were essentially expressed at similar
levels, while expression of the remainder (58%) was reduced in
KMO8rescue embryos. This suggests that the rescued embryos have
reduced levels of ectopic gene activation compared with
xKaiso-depleted embryos.
|
|
| Discussion |
|---|
|
|
|---|
The mechanism by which transcriptional silencing is maintained in early
development is not clear. CpG methylation can directly inhibit transcription
factor binding or affect nucleosome positioning
(Davey et al., 2004
;
Meehan, 2003
), but it is also
a target for methyl-CpG binding domain (MBD)-containing proteins such as
MeCP2, MBD1 and MBD2. However, the absence of these proteins in MeCP2-, MBD1-
and MBD2-null mice does not have the same deleterious consequences as
Dnmt1 depletion (Chen et al.,
2001
; Guy et al.,
2001
; Hendrich et al.,
2001
; Li et al.,
1992
; Tudor et al.,
2002
; Zhao et al.,
2003
). This could be due to functional redundancy between MBD
proteins. However, this does not seem to be the case for MBD2 and MeCP2
(Guy et al., 2001
). Possibly,
the exceptionally early MZT before the first cell division in mice is
functionally different from the period of transcriptional quiescence typical
for other organisms (Beaujean et al.,
2004a
; Beaujean et al.,
2004b
). A further difference exists in the DNA binding ability of
MBD3: Xenopus contains an MBD3 isoform that, unlike its mammalian
counterpart, binds to methylated DNA (Wade
et al., 1999
). This is due to a tyrosine to phenylalanine
substitution at position 29 of the MBD that is crucial for contacts with the
phosphate backbone (Saito and Ishikawa,
2002
). Alternatively, additional methyl-CpG activities could exist
that mediate global silencing of methylated genes in animals.
In this work, we identify xKaiso as the likely candidate for
mediating CpG methylation-dependent gene repression in the developing embryo.
Kaiso is a transcription repressor with a distinct methyl-CpG binding ability
contained in its zinc-finger domain. We demonstrate that despite considerable
amino acid divergence in the third zinc-finger motif, xKaiso binds
methylated DNA in vitro with a similar binding specificity to its mammalian
counterpart, but with less non-methylated DNA sequence specificity than
observed for mouse kaiso (Daniel et al.,
2002
). In addition, we show that ectopic expression of
xKaiso in MBD2/ deficient
fibroblasts restores repression of a methylated reporter construct,
establishing its credentials as a CpG methylation-dependent repressor, rather
than a general transcription repressor
(Kim et al., 2002
). In stark
contrast with the minor consequences of depletion/knockouts of MBD proteins in
mouse, xKaiso is essential for normal Xenopus development.
An xKaiso knockdown mimics xDnmt1 depletion in every aspect
studied: embryos show precocious activation of gene expression, apoptosis and
developmental arrest. The specificity of the depletion phenotype and
functional conservation was demonstrated by expressing human kaiso in
Xenopus KMO embryos. This rescued a high proportion of these embryos,
while enabling a majority to complete neurulation. Importantly, a mutation in
the third zinc finger that abolished the ability of kaiso to bind methylated
DNA could not rescue the KMO phenotype. Our results strongly suggest that the
main developmental changes observed after loss of CpG methylation are normally
under control of the xKaiso transcriptional repressor and dependent
on its methyl CpG binding domain.
Our gene array data reveal that xKaiso may control more than 10%
of genes in early development. This is consistent with an important role for
xKaiso in these processes, its absence leading to developmental
arrest. The reported interaction with p120ctn is interesting with
regard to the possible role of kaiso in the MBT. Apart from the onset of
zygotic transcription, the MBT is also associated with the slowing of cell
division and the onset of cell migration
(Masui and Wang, 1998
;
Veenstra, 2002
). The
p120ctn interaction links E-cadherin cell adhesion with
transcription in the nucleus, and loss of this connection may be responsible
for the dose-dependent effects of xKaiso depletion on gastrulation
movements. Loss of cell adhesion is observed with xDnmt1 as well as
kaiso knockdown embryonic tissues (I.S., A.R. and R.M., unpublished).
Over-expression experiments nevertheless do not support a mutual inhibition
mechanism for p120ctn versus kaiso function in vivo.
Milder phenotypes result from over-expression of murine p120ctn or
reduction of xp120ctn in Xenopus compared with
kaiso depletion (Fang et al.,
2004
; Geis et al.,
1998
; Paulson et al.,
1999
). Conversely, an excess of kaiso does not appear to disturb
essential developmental processes, as our embryo controls developed normally
when injected with 750 pg of wild-type human kaiso RNA. The point mutant
C552R-kaiso is able to bind p120ctn, but could not rescue the
depletion phenotype through a p120ctn-mediated pathway.
xKaiso depletion, like xDnmt1, causes the premature
activation of gene transcription at least two cycles prior to MBT. Our results
indicate that it is unlikely that the MBT is simply brought forward; rather,
gene silencing is relieved outside the normal context of the MBT. This
unscheduled entry into transcription is not accompanied by the increase in
transcription-related gene products normally observed at the MBT
(Altmann et al., 2001
). Levels
of maternal mRNA and/or cytoplasmic volume may trigger this production of
transcription machinery independently
(Masui and Wang, 1998
;
Veenstra, 2002
). The premature
transcription we observe could therefore be rate limiting with regards to
these components.
However, it is clear that xKaiso normally represses an abundance
of genes involved in cell growth and control. Only a small set of this class
of genes is normally activated at MBT
(Altmann et al., 2001
). This
specialisation of a methylation-dependent transcription repressor is perhaps
not surprising in view of the role of DNA methylation in cancer. It is also
consistent with the observation of tumours in xDnmt1-depleted,
apoptosis-inactivated Xenopus embryos
(Stancheva et al., 2001
). We
demonstrate that apoptosis is triggered by the depletion of xKaiso,
as observed with Dnmt1 depletion. Elevated expression in both
xKaiso- and xDnmt1-deficient pre-MBT embryos suggest a
common pathway of repression of a set of candidate genes previously implicated
in MBT (Stancheva and Meehan,
2000
). Their scheduled release from repression implies a
regulatory control over the methylation-dependent repression pathway subject
to developmental checkpoints by apoptosis. Receptor signalling pathways could
be involved based on the recruitment of N-CoR in association with HDAC3
observed for human kaiso at the human MTA2 gene, when abnormally
methylated in HeLa cells (Yoon et al.,
2003
). N-CoR is expressed at all stages of Xenopus
development and may also be required to mediate transcriptional silencing in
pre-MBT embryos (Koide et al.,
2001
). In addition, methylation mapping data suggest that
Dnmt1 may contribute specificity by selectively maintaining CpG
methylation at certain loci while total levels decrease prior to the MBT
(Stancheva et al., 2002
). It
is also possible that xMBD3, which has been shown to be part of the NuRD
repressor complex has a general role in developmental gene activation at MBT
and preliminary analysis suggests that it is also essential for
Xenopus development (D.D. and R.M., unpublished)
(Iwano et al., 2004
).
The point at which embryonic transcription initiates in mammals varies
between species with MZT occurring at the end of the one-cell stage in mice,
the four- to eight-cell stage in humans, and at the eight- to 16-cell stage in
rabbits, sheep and cattle (Kanka,
2003
). Amphibians, and also zebrafish
(Martin et al., 1999
),
exemplify the situation where high initial levels of CpG methylation correlate
with transcriptional quiescence in the presence of large supplies of maternal
transcripts. In species where the MZT occurs after more than one cleavage,
transcriptional silence is likely to be maintained because of a non-permissive
chromatin state that may involve DNA methylation and methyl-CpG repressor
proteins, such as xKaiso. Our results raise the issue of whether the
global role of xKaiso in CpG-dependent transcriptional silence is
specific to early development. The indications are that MBD1, MBD2 and MeCP2
are not required to regulate MZT; instead they are used at later stages of
development (Jaenisch and Bird,
2003
; Stancheva et al.,
2003
).
A key point is that CpG methylation in differentiated somatic cells is implicated in stable gene silencing that may involve the sequestering of genes in the heterochromatic (late replicating) compartment of the nucleus. This is associated with the restriction of developmental potential and maintenance of differentiation. A very different situation applies to the pre-MBT embryo, where the genome is quiescent but in fact poised to start transcription at MZT to provide a pluripotent cell type. We propose that this poised repression, which is different from stable silencing, requires xKaiso, a transcriptional repressor (rather than silencing mediator) with connections to signalling pathways that permit the scheduled release from transcriptional quiescence at MZT.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/131/24/6185/DC1
* These authors contributed equally to this work ![]()
| REFERENCES |
|---|
|
|
|---|
Almouzni, G. and Wolffe, A. P. (1995). Constraints on transcriptional activator function contribute to transcriptional quiescence during early Xenopus embryogenesis. EMBO J. 14,1752 -1765.[Medline]
Almouzni, G., Khochbin, S., Dimitrov, S. and Wolffe, A. P. (1994). Histone acetylation influences both gene expression and development of Xenopus laevis. Dev. Biol. 165,654 -669.[CrossRef][Medline]
Altmann, C. R., Bell, E., Sczyrba, A., Pun, J., Bekiranov, S., Gaasterland, T. and Brivanlou, A. H. (2001). Microarray-based analysis of early development in Xenopus laevis. Dev. Biol. 236,64 -75.[CrossRef][Medline]
Ballestar, E., Paz, M. F., Valle, L., Wei, S., Fraga, M. F., Espada, J., Cigudosa, J. C., Huang, T. H. and Esteller, M. (2003). Methyl-CpG binding proteins identify novel sites of epigenetic inactivation in human cancer. EMBO J. 22,6335 -6345.[CrossRef][Medline]
Barnett, M. W., Old, R. W. and Jones, E. A. (1998). Neural induction and patterning by fibroblast growth factor, notochord and somite tissue in Xenopus. Dev. Growth Differ. 40,47 -57.[CrossRef][Medline]
Beaujean, N., Hartshorne, G., Cavilla, J., Taylor, J., Gardner, J., Wilmut, I., Meehan, R. and Young, L. (2004a). Non-conservation of mammalian preimplantation methylation dynamics. Curr. Biol. 14,R266 -R267.[CrossRef][Medline]
Beaujean, N., Taylor, J. E., McGarry, M., Gardner, J. O.,
Wilmut, I., Loi, P., Ptak, G., Galli, C., Lazzari, G., Bird, A., Young, L. E.
and Meehan, R. R. (2004b). The effect of interspecific
oocytes on demethylation of sperm DNA. Proc. Natl. Acad. Sci.
USA 101,7636
-7640.
Bird, A. P. (1986). CpG-rich islands and the function of DNA methylation. Nature 321,209 -213.[CrossRef][Medline]
Bird, A. (2002). DNA methylation patterns and
epigenetic memory. Genes Dev.
16, 6-21.
Chen, R. Z., Akbarian, S., Tudor, M. and Jaenisch, R. (2001). Deficiency of methyl-CpG binding protein-2 in CNS neurons results in a Rett-like phenotype in mice. Nat. Genet. 27,327 -331.[CrossRef][Medline]
Cross, S. H., Meehan, R. R., Nan, X. and Bird, A. (1997). A component of the transcriptional repressor MeCP1 shares a motif with DNA methyltransferase and HRX proteins. Nat. Genet. 16,256 -259.[CrossRef][Medline]
Daniel, J. M. and Reynolds, A. B. (1999). The
catenin p120(ctn) interacts with Kaiso, a novel BTB/POZ domain zinc finger
transcription factor. Mol. Cell. Biol.
19,3614
-3623.
Daniel, J. M., Spring, C. M., Crawford, H. C., Reynolds, A. B.
and Baig, A. (2002). The p120(ctn)-binding partner Kaiso is a
bi-modal DNA-binding protein that recognizes both a sequence-specific
consensus and methylated CpG dinucleotides. Nucleic Acids
Res. 30,2911
-2919.
Davey, C. S., Pennings, S., Reilly, C., Meehan, R. R. and Allan,
J. (2004). A determining influence for CpG dinucleotides on
nucleosome positioning in vitro. Nucleic Acids Res.
32,4322
-4331.
Eisen, M. B., Spellman, P. T., Brown, P. O. and Botstein, D.
(1998). Cluster analysis and display of genome-wide expression
patterns. Proc. Natl. Acad. Sci. USA
95,14863
-14868.
Fang, X., Ji, H., Kim, S. W., Park, J. I., Vaught, T. G.,
Anastasiadis, P. Z., Ciesiolka, M. and McCrea, P. D. (2004).
Vertebrate development requires ARVCF and p120 catenins and their interplay
with RhoA and Rac. J. Cell Biol.
165, 87-98.
Geis, K., Aberle, H., Kuhl, M., Kemler, R. and Wedlich, D. (1998). Expression of the Armadillo family member p120cas1B in Xenopus embryos affects head differentiation but not axis formation. Dev. Genes Evol. 207,471 -481.[CrossRef][Medline]
Gregory, R. I., Randall, T. E., Johnson, C. A., Khosla, S.,
Hatada, I., O'Neill, L. P., Turner, B. M. and Feil, R.
(2001). DNA methylation is linked to deacetylation of histone H3,
but not H4, on the imprinted genes Snrpn and U2af1-rs1. Mol. Cell.
Biol. 21,5426
-5436.
Guy, J., Hendrich, B., Holmes, M., Martin, J. E. and Bird, A. (2001). A mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome. Nat. Genet. 27,322 -326.[CrossRef][Medline]
Helbing, C. C., Werry, K., Crump, D., Domanski, D., Veldhoen, N.
and Bailey, C. M. (2003). Expression profiles of novel
thyroid hormone-responsive genes and proteins in the tail of Xenopus laevis
tadpoles undergoing precocious metamorphosis. Mol.
Endocrinol. 17,1395
-1409.
Hendrich, B. and Bird, A. (1998).
Identification and characterization of a family of mammalian methyl-CpG
binding proteins. Mol. Cell. Biol.
18,6538
-6547.
Hendrich, B. and Tweedie, S. (2003). The methyl-CpG binding domain and the evolving role of DNA methylation in animals. Trends Genet. 19,269 -277.[CrossRef][Medline]
Hendrich, B., Guy, J., Ramsahoye, B., Wilson, V. A. and Bird,
A. (2001). Closely related proteins MBD2 and MBD3 play
distinctive but interacting roles in mouse development. Genes
Dev. 15,710
-723.
Hensey, C. and Gautier, J. (1998). Programmed cell death during Xenopus development: a spatio-temporal analysis. Dev. Biol. 203,36 -48.[CrossRef][Medline]
Hutchins, A. S., Mullen, A. C., Lee, H. W., Sykes, K. J., High, F. A., Hendrich, B. D., Bird, A. P. and Reiner, S. L. (2002). Gene silencing quantitatively controls the function of a developmental trans-activator. Mol. Cell 10, 81-91.[CrossRef][Medline]
Iwano, H., Nakamura, M. and Tajima, S. (2004). Xenopus MBD3 plays a crucial role in an early stage of development. Dev. Biol. 268,416 -428.[CrossRef][Medline]
Jackson-Grusby, L., Beard, C., Possemato, R., Tudor, M., Fambrough, D., Csankovszki, G., Dausman, J., Lee, P., Wilson, C., Lander, E. and Jaenisch, R. (2001). Loss of genomic methylation causes p53-dependent apoptosis and epigenetic deregulation. Nat. Genet. 27,31 -39.[CrossRef][Medline]
Jaenisch, R. and Bird, A. (2003). Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat. Genet. Suppl. 33,245 -254.
Jones, P. L., Veenstra, G. J., Wade, P. A., Vermaak, D., Kass, S. U., Landsberger, N., Strouboulis, J. and Wolffe, A. P. (1998). Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat. Genet. 19,187 -191.[CrossRef][Medline]
Kanka, J. (2003). Gene expression and chromatin structure in the pre-implantation embryo. Theriogenology 59,3 -19.[CrossRef][Medline]
Kim, S. W., Fang, X., Ji, H., Paulson, A. F., Daniel, J. M.,
Ciesiolka, M., van Roy, F. and McCrea, P. D. (2002).
Isolation and characterization of XKaiso, a transcriptional repressor that
associates with the catenin Xp120(ctn) in Xenopus laevis. J. Biol.
Chem. 277,8202
-8208.
Koide, T., Downes, M., Chandraratna, R. A., Blumberg, B. and
Umesono, K. (2001). Active repression of RAR signaling is
required for head formation. Genes Dev.
15,2111
-2121.
Lei, H., Oh, S. P., Okano, M., Juttermann, R., Goss, K. A., Jaenisch, R. and Li, E. (1996). De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development 122,3195 -3205.[Abstract]
Li, E., Bestor, T. H. and Jaenisch, R. (1992). Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69,915 -926.[CrossRef][Medline]
Martin, C. C., Laforest, L., Akimenko, M. A. and Ekker, M. (1999). A role for DNA methylation in gastrulation and somite patterning. Dev. Biol. 206,189 -205.[CrossRef][Medline]
Masui, Y. and Wang, P. (1998). Cell cycle transition in early embryonic development of Xenopus laevis. Biol. Cell 90,537 -548.[CrossRef][Medline]
Meehan, R. R. (2003). DNA methylation in animal development. Semin. Cell Dev. Biol. 14, 53-65.[CrossRef][Medline]
Nan, X., Campoy, F. J. and Bird, A. (1997). MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin. Cell 88,471 -481.[CrossRef][Medline]
Nan, X., Ng, H. H., Johnson, C. A., Laherty, C. D., Turner, B. M., Eisenman, R. N. and Bird, A. (1998). Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 393,386 -389.[CrossRef][Medline]
Newport, J. and Kirschner, M. (1982a). A major developmental transition in early Xenopus embryos: I. characterization and timing of cellular changes at the midblastula stage. Cell 30,675 -686.[CrossRef][Medline]
Newport, J. and Kirschner, M. (1982b). A major developmental transition in early Xenopus embryos: II. Control of the onset of transcription. Cell 30,687 -696.[CrossRef][Medline]
Ng, H. H., Zhang, Y., Hendrich, B., Johnson, C. A., Turner, B. M., Erdjument-Bromage, H., Tempst, P., Reinberg, D. and Bird, A. (1999). MBD2 is a transcriptional repressor belonging to the MeCP1 histone deacetylase complex. Nat. Genet. 23, 58-61.[Medline]
Ng, H. H., Jeppesen, P. and Bird, A. (2000).
Active repression of methylated genes by the chromosomal protein MBD1.
Mol. Cell. Biol. 20,1394
-1406.
Paulson, A. F., Fang, X., Ji, H., Reynolds, A. B. and McCrea, P. D. (1999). Misexpression of the catenin p120(ctn)1A perturbs Xenopus gastrulation but does not elicit Wnt-directed axis specification. Dev. Biol. 207,350 -363.[CrossRef][Medline]
Prokhortchouk, A., Hendrich, B., Jorgensen, H., Ruzov, A., Wilm,
M., Georgiev, G., Bird, A. and Prokhortchouk, E. (2001). The
p120 catenin partner Kaiso is a DNA methylation-dependent transcriptional
repressor. Genes Dev.
15,1613
-1618.
Saito, M. and Ishikawa, F. (2002). The
mCpG-binding domain of human MBD3 does not bind to mCpG but interacts with
NuRD/Mi2 components HDAC1 and MTA2. J. Biol. Chem.
277,35434
-35439.
Stancheva, I. and Meehan, R. R. (2000).
Transient depletion of xDnmt1 leads to premature gene activation in Xenopus
embryos. Genes Dev. 14,313
-327.
Stancheva, I., Hensey, C. and Meehan, R. R. (2001). Loss of the maintenance methyltransferase, xDnmt1, induces apoptosis in Xenopus embryos. EMBO J. 20,1963 -1973.[CrossRef][Medline]
Stancheva, I., El Maarri, O., Walter, J., Niveleau, A. and Meehan, R. R. (2002). DNA methylation at promoter regions regulates the timing of gene activation in Xenopus laevis embryos. Dev. Biol. 243,155 -165.[CrossRef][Medline]
Stancheva, I., Collins, A. L., Van, d. V., I, Zoghbi, H. and Meehan, R. R. (2003). A mutant form of MeCP2 protein associated with human Rett syndrome cannot be displaced from methylated DNA by notch in Xenopus embryos. Mol. Cell 12,425 -435.[CrossRef][Medline]
Tudor, M., Akbarian, S., Chen, R. Z. and Jaenisch, R.
(2002). Transcriptional profiling of a mouse model for Rett
syndrome reveals subtle transcriptional changes in the brain. Proc.
Natl. Acad. Sci. USA 99,15536
-15541.
Tykocinski, M. L. and Max, E. E. (1984). CG
dinucleotide clusters in MHC genes and in 5' demethylated genes.
Nucleic Acids Res. 12,4385
-4396.
Veenstra, G. J. (2002). Early embryonic gene transcription in Xenopus. Adv. Dev. Biol. Biochem. 12, 85-105.
Veenstra, G. J., Destree, O. H. and Wolffe, A. P.
(1999). Translation of maternal TATA-binding protein mRNA
potentiates basal but not activated transcription in Xenopus embryos at the
midblastula transition. Mol. Cell. Biol.
19,7972
-7982.
Wade, P. A., Gegonne, A., Jones, P. L., Ballestar, E., Aubry, F. and Wolffe, A. P. (1999). Mi-2 complex couples DNA methylation to chromatin remodelling and histone deacetylation. Nat. Genet. 23,62 -66.[Medline]
Yoon, H. G., Chan, D. W., Reynolds, A. B., Qin, J. and Wong, J. (2003). N-CoR mediates DNA methylation-dependent repression through a methyl CpG binding protein Kaiso. Mol. Cell 12,723 -734.[CrossRef][Medline]
Zhao, X., Ueba, T., Christie, B. R., Barkho, B., McConnell, M.
J., Nakashima, K., Lein, E. S., Eadie, B. D., Willhoite, A. R., Muotri, A. R.,
Summers, R. G., Chun, J., Lee, K. F. and Gage, F. H. (2003).
Mice lacking methyl-CpG binding protein 1 have deficits in adult neurogenesis
and hippocampal function. Proc. Natl. Acad. Sci. USA
100,6777
-6782.
Related articles in Development:
This article has been cited by other articles:
![]() |
A. Ruzov, B. Shorning, O. Mortusewicz, D. S. Dunican, H. Leonhardt, and R. R. Meehan MBD4 and MLH1 are required for apoptotic induction in xDNMT1-depleted embryos Development, July 1, 2009; 136(13): 2277 - 2286. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ruzov, E. Savitskaya, J. A. Hackett, J. P. Reddington, A. Prokhortchouk, M. J. Madej, N. Chekanov, M. Li, D. S. Dunican, E. Prokhortchouk, et al. The non-methylated DNA-binding function of Kaiso is not required in early Xenopus laevis development Development, March 1, 2009; 136(5): 729 - 738. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ruzov, J. A. Hackett, A. Prokhortchouk, J. P. Reddington, M. J. Madej, D. S. Dunican, E. Prokhortchouk, S. Pennings, and R. R. Meehan The interaction of xKaiso with xTcf3: a revised model for integration of epigenetic and Wnt signalling pathways Development, March 1, 2009; 136(5): 723 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Baroux, D. Autran, C.S. Gillmor, D. Grimanelli, and U. Grossniklaus The Maternal to Zygotic Transition in Animals and Plants Cold Spring Harb Symp Quant Biol, February 9, 2009; (2009) sqb.2008.73.053v1. [Abstract] [PDF] |
||||
![]() |
E. C. Lopes, E. Valls, M. E. Figueroa, A. Mazur, F.-G. Meng, G. Chiosis, P. W. Laird, N. Schreiber-Agus, J. M. Greally, E. Prokhortchouk, et al. Kaiso Contributes to DNA Methylation-Dependent Silencing of Tumor Suppressor Genes in Colon Cancer Cell Lines Cancer Res., September 15, 2008; 68(18): 7258 - 7263. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Dunican, A. Ruzov, J. A. Hackett, and R. R. Meehan xDnmt1 regulates transcriptional silencing in pre-MBT Xenopus embryos independently of its catalytic function Development, April 1, 2008; 135(7): 1295 - 1302. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Schier The Maternal-Zygotic Transition: Death and Birth of RNAs Science, April 20, 2007; 316(5823): 406 - 407. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Rupon, S. Z. Wang, K. Gaensler, J. Lloyd, and G. D. Ginder Methyl binding domain protein 2 mediates {gamma}-globin gene silencing in adult human betaYAC transgenic mice PNAS, April 25, 2006; 103(17): 6617 - 6622. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Heasman Patterning the early Xenopus embryo. Development, April 1, 2006; 133(7): 1205 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Angrisano, F. Lembo, R. Pero, F. Natale, A. Fusco, V. E. Avvedimento, C. B. Bruni, and L. Chiariotti TACC3 mediates the association of MBD2 with histone acetyltransferases and relieves transcriptional repression of methylated promoters Nucleic Acids Res., January 12, 2006; 34(1): 364 - 372. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. P. Filion, S. Zhenilo, S. Salozhin, D. Yamada, E. Prokhortchouk, and P.-A. Defossez A Family of Human Zinc Finger Proteins That Bind Methylated DNA and Repress Transcription Mol. Cell. Biol., January 1, 2006; 26(1): 169 - 181. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Prokhortchouk, O. Sansom, J. Selfridge, I. M. Caballero, S. Salozhin, D. Aithozhina, L. Cerchietti, F. G. Meng, L. H. Augenlicht, J. M. Mariadason, et al. Kaiso-Deficient Mice Show Resistance to Intestinal Cancer Mol. Cell. Biol., January 1, 2006; 26(1): 199 - 208. [Abstract] [Full Text] [PDF] |
||||
![]() |
A K E Swales and N Spears Genomic imprinting and reproduction Reproduction, October 1, 2005; 130(4): 389 - 399. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Soubry, J. van Hengel, E. Parthoens, C. Colpaert, E. Van Marck, D. Waltregny, A. B. Reynolds, and F. van Roy Expression and Nuclear Location of the Transcriptional Repressor Kaiso Is Regulated by the Tumor Microenvironment Cancer Res., March 15, 2005; 65(6): 2224 - 2233. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||