spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 17 November 2004
doi: 10.1242/dev.01549


Development 131, 6185-6194 (2004)
Published by The Company of Biologists 2004


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
dev.01549v1
131/24/6185    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Development
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruzov, A.
Right arrow Articles by Meehan, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruzov, A.
Right arrow Articles by Meehan, R. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Kaiso is a genome-wide repressor of transcription that is essential for amphibian development

Alexey Ruzov1,2,3,*, Donncha S. Dunican1,3,*, Anna Prokhortchouk2, Sari Pennings1, Irina Stancheva1, Egor Prokhortchouk2 and Richard R. Meehan1,3,{dagger}

1 Department of Biomedical Sciences, The University of Edinburgh, Hugh Robson Building, George Square, Edinburgh EH8 9XD, UK
2 Institute of Gene Biology, Russian Academy of Sciences, Vavilova 34/5, Moscow, 119334, Russian Federation
3 Human Genetics Unit, MRC, Western General Hospital, Crewe Road, Edinburgh EH4 2XU, UK

{dagger} Author for correspondence (e-mail: r.meehan{at}hgu.mrc.ac.uk)

Accepted 28 October 2004


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
DNA methylation in animals is thought to repress transcription via methyl-CpG specific binding proteins, which recruit enzymatic machinery promoting the formation of inactive chromatin at targeted loci. Loss of DNA methylation can result in the activation of normally silent genes during mouse and amphibian development. Paradoxically, global changes in gene expression have not been observed in mice that are null for the methyl-CpG specific repressors MeCP2, MBD1 or MBD2. Here, we demonstrate that xKaiso, a novel methyl-CpG specific repressor protein, is required to maintain transcription silencing during early Xenopus laevis development. In the absence of xKaiso function, premature zygotic gene expression occurs before the mid-blastula transition (MBT). Subsequent phenotypes (developmental arrest and apoptosis) strongly resemble those observed for hypomethylated embryos. Injection of wild-type human kaiso mRNA can rescue the phenotype and associated gene expression changes of xKaiso-depleted embryos. Our results, including gene expression profiling, are consistent with an essential role for xKaiso as a global repressor of methylated genes during early vertebrate development.

Key words: DNA methylation, Kaiso, Transcriptional repression, Xenopus, Differentiation


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The presence of methylated CpGs in the DNA sequence of a promoter is generally incompatible with gene expression in animal somatic cells (Bird, 2002Go). Over 70% of CpGs in vertebrate DNA contain the 5-methyl cytosine modification, presenting a potential for global gene silencing. Distinct patterns of DNA methylation exist at specific loci, which can vary between different tissues and developmental stages. In Xenopus laevis embryos, global DNA methylation levels are high in early stages, but drop by about 40% in late blastula and subsequently recover during later gastrula stages (Stancheva et al., 2002Go; Stancheva and Meehan, 2000Go). This correlates with the period of transcriptional quiescence observed during the first 12 cleavage cycles of Xenopus development. Transcription activation begins in a coordinated manner at the midblastula transition (MBT), when DNA methylation levels decrease, accompanied by changes in chromatin composition and increased activity of the basal transcription machinery (Almouzni et al., 1994Go; Almouzni and Wolffe, 1995Go; Newport and Kirschner, 1982aGo; Newport and Kirschner, 1982bGo; Veenstra et al., 1999Go).

The general model for indirect repression by DNA methylation predicts that methyl-CpG binding proteins mediate silencing in pre-MBT embryos by recruiting enzymatic complexes that modify local chromatin structure (Jones et al., 1998Go; Nan et al., 1998Go; Wade et al., 1999Go). This results in a closed heterochromatic structure that is refractory to transcription (Jaenisch and Bird, 2003Go). Conversely, loss of DNA methylation can lead to a relaxation in chromatin-based silencing mechanisms in somatic cells such that the threshold for gene activation and consequent developmental potential is altered (Jaenisch and Bird, 2003Go; Meehan, 2003Go). In Xenopus, as in mice, inactivation of the maintenance DNA methyltransferase xDnmt1 results in hypomethylation of genomic DNA, ectopic expression of normally silent genes and embryonic lethality (Jackson-Grusby et al., 2001Go; Stancheva and Meehan, 2000Go). xDnmt1 deficient embryos exhibit premature gene expression at least two cell cycles earlier than normal (prior to the MBT), implying that the correct timing of zygotic activation is regulated in part by the repressive effect of DNA methylation during early blastula stages (Stancheva and Meehan, 2000Go).

In mammals, three repressor proteins, MeCP2, MBD1 and MBD2, bind methylated CpGs via a conserved motif called the methyl-CpG binding domain (Cross et al., 1997Go; Hendrich and Bird, 1998Go). The MBD motif is ~70 amino acids long and is found in a diverse number of nuclear proteins, only a subset of which can bind methylated DNA (Hendrich and Tweedie, 2003Go). In vitro and transient transfection experiments provide good evidence that MeCP2, MBD1 and MBD2 act as transcriptional repressors of methylated reporter templates (Nan et al., 1997Go; Ng et al., 1999Go; Ng et al., 2000Go). In addition, chromatin immunoprecipitation (ChIP) experiments localise MeCP2, MBD2 and MBD1 to methylated and silenced genes. The chromatin of these genes is also hypoacetylated and contains H3 that is methylated on lysine 9 (H3K9Me), both hallmarks of inactive chromatin (Ballestar et al., 2003Go; Gregory et al., 2001Go). A number of histone deacetylases (HDAC) and histone methyltransferases (HMT) are associated with MeCP2, MBD1, MBD3 and DNA methyltransferases. This reinforces the mechanistic link between DNA methylation and specific histone modifications in promoting gene silencing (Jaenisch and Bird, 2003Go).

Mbd2–/–-derived embryonic cells have a reduced ability to repress methylated reporter genes in transient transfection assays, and the activation threshold of specific genes is altered upon differentiation (Hendrich et al., 2001Go; Hutchins et al., 2002Go). However, the expectation that MeCP/MBDs might act as global repressors of transcription from methylated templates in vivo was not supported: the absence of MeCP2, MBD1 or MBD2 function does not disrupt specific programs of developmental gene expression in mice (including X-chromosome inactivation), nor does it phenocopy the effects of Dnmt1 inactivation (Chen et al., 2001Go; Guy et al., 2001Go; Hendrich et al., 2001Go; Tudor et al., 2002Go; Zhao et al., 2003Go). Only MBD3 is required for early murine development, but as this MBD does not actually bind methylated DNA, MBD3–/– embryo lethality is probably the result of its role as a core component of the NuRD/MeCP1 transcription repressor complex (Hendrich et al., 2001Go).

A very different methylated DNA-dependent binding domain was identified in the transcriptional repressor kaiso (ZBTB33 Human Gene Nomenclature Database), which binds methyl CpGs through a zinc-finger (ZF) motif (Prokhortchouk et al., 2001Go). Kaiso recognizes DNA sequences that contain at least two methyl-CpGs, and represses transcription from reporter templates in a methyl-CpG-dependent manner (Prokhortchouk et al., 2001Go; Yoon et al., 2003Go). It was originally discovered in a two-hybrid screen using the cell adhesion co-factor p120ctn as bait (Daniel and Reynolds, 1999Go). Like the armadillo-related protein ß-catenin, to which it is structurally homologous, p120ctn interacts with the cytoplasmic domain of the transmembrane cell adhesion molecule E-cadherin. Kaiso could possibly mediate p120ctn/E-cadherin signalling to the nucleus to regulate the expression of methylated target genes. In HeLa cells, kaiso mediates silencing of the MTA2 gene by interacting with the N-CoR co-repressor complex via its POZ domain (Yoon et al., 2003Go). A Xenopus homologue, xKaiso, has recently been described (Kim et al., 2002Go). We noted that its expression pattern matched that of xDnmt1 (A.R. and R.M., unpublished), which hinted that it could have a potential role in regulating transcription silencing in pre-MBT embryos (Stancheva and Meehan, 2000Go).

We wished to determine the binding specificity of xKaiso and its ability to act as a methylation-dependent repressor, and to investigate its role in transcriptional silencing during early amphibian development. We show that xKaiso has a similar, if not more pronounced preference for methylated DNA compared with its mammalian counterpart. Depletion of xKaiso function in Xenopus embryos results in premature activation of pre-MBT zygotic transcription. The depletion phenotype can be rescued by overexpression of wild-type human kaiso, but not by a mutant lacking a functional methyl-CpG binding domain. Our analysis suggests that xKaiso is essential for methylation-dependent transcriptional silencing in early amphibian embryos.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Plasmids and recombinant proteins
GST-xKaiso ZF encoded the xKaiso zinc fingers (amino acids 470-609; AY044336) cloned in frame into pGEX-4T1. GST-hKaiso and GST-C552RhKaiso fusions were cloned into pGEX-2T. Point mutation C552R was generated by QuikChange® Site-Directed Mutagenesis (Stratagene) using GGGGAGCGAAGGTATCAGCGTTTGGCCTGTGGC and reverse complement primer. Proteins were expressed in BL-21 cells and purified on GST Sepharose.

EMSA experiments
Binding reactions were as described using 5% PAGE in 0.3 x TBE to resolve DNA-protein complexes with Non-Sm and Me-Sm probes (Prokhortchouk et al., 2001Go) and the human matrilysin (Hmat) oligo (Daniel et al., 2002Go).

Methyl CpG-dependent repression test
The ability of xKaiso to repress transcription from a methylated reporter gene using Mbd2–/– cells was performed as described previously (Hendrich et al., 2001Go; Prokhortchouk et al., 2001Go).

Protein extracts and immunoblots
Total protein extracts for western blotting were prepared from staged wild-type eggs, and wild-type and KMO-injected blastulae and gastrulae as described (Stancheva et al., 2001Go). Extracts were run in 10% SDS-polyacrylamide gels and electro-transferred to PVDF membrane. xKaiso was detected by a monoclonal antibody against the conserved N-terminal domain of mouse kaiso (Zymed, clone 6F). Anti-mouse HRP-conjugated IgGs were used as secondary antibodies.

Kaiso – p120 catenin interaction test
p120 mouse cDNA (forms 1A and 3A) was cloned into pFASTBAC1 vector (Invitrogen) from pMS2-p1201A and pMS2-p1203A (provided by Dr Al Reynolds). The proteins (1A and 3A – co-transfected) were expressed in Sf9 insect cells using the Bac-to-Bac Baculovirus Expression System (Invitrogen). Cell extracts were added to GST-Kaiso Sepharose, incubated for 1 hour at room temperature, washed three times with PBS. Bound proteins were eluted with glutathione and resolved by SDS-PAGE, blotted and visualised with antibodies specific either to p120 catenin (mAb clone 15D2) or to kaiso (ZF6).

Embryos and microinjections
Xenopus embryos were obtained from in vitro fertilized wild-type and albino eggs or by natural mating of sexually mature frogs. They were grown, staged and microinjected according to standard procedures (Stancheva and Meehan, 2000Go). At the two-cell stage, the embryos were injected into the animal half of the embryos with 0.5-10 ng/cell of xKaiso morpholino oligo (KMO), GATCAGCTTTTTTGTCTCCATGTCT; xDnmt1 morpholino oligo (DMO), GGACAGGCGTGAAACAGACTCGGC; or control morpholino, CGCTCAGCTCCTCCATGTCTGCCGC (Gene-Tools); and/or 200-750 pg of sense capped RNA synthesized in vitro (T3/T7 Cap-Scribe kit, Boehringer). Whole-embryo run-on experiments with [{alpha}-35S]UTP incorporation were performed using 5 ng KMO-injected and wild-type embryos, as described (Stancheva and Meehan, 2000Go). The whole-mount TUNEL staining of embryos was as described previously (Hensey and Gautier, 1998Go).

RT-PCR analysis
RNA was isolated as described previously (Stancheva and Meehan, 2000Go). cDNA was synthesised from five embryos using Superscript II reverse transcriptase (RT) (Invitrogen). RT-PCR was performed over a range of cDNA dilutions and PCR cycles to ensure exponential amplification. xODC was used as a loading control, and cDNA was synthesised in the absence of RT to control for genomic DNA contamination. Primer sequences used were: xBEF-U, 5'-CCGAAACAGCTTCCAGACAA-3'; xBEF-L, 5'-TGAAAGGAAAGCAGACGCTC-3'; xDRAK1-U, 5'-ACCGAGAGGAGGAAGTCACT-3'; xDRAK-L, 5'-GGCTTAAAGGAAACAAGTCC-3'; xOct-25-U, 5'-TAATGGAGAGATGCTTGATG-3'; xOct-25-L, 5'-TTCTCTATGTTCGTCCTCC-3'; xODC-U, 5'-GGAGCTGCAAGTTTGGAGA-3'; xODC-L, 5'-TCAGTTGCCAGTGTGGTC-3'.

Magex array hybridisation and analysis
cDNA filters were obtained from Viagenx (Canada). Arrays were probed as described previously with minor modifications (Helbing et al., 2003Go). In brief, Xenopus total RNA was isolated and cDNA was synthesised using the SuperSMART kit (Clontech, USA) (Barnett et al., 1998Go). cDNA was amplified in the exponential phase by PCR using 21-23 cycles at an annealing temperature of 63°C. cDNA probes were labelled with [{alpha}-32P]dCTP by random priming using the HexaLabel kit (Fermentas, UK). Arrays were hybridised in Church & Gilbert hybridisation solution (0.5 M Na2HPO4, 7% SDS, 1 mM EDTA, pH 7.2) at 65°C and washed to high stringency in 40 mM Na2HPO4, 1% SDS at 65°C. Images were acquired using AIDA software and the FLA2000 phosphorimager. Scanalyze (Eisen et al., 1998Go) was used to acquire gene spot intensities and non-signal backgrounds. Data across hybridisation experiments were normalised to the 18S rRNA spots intensity.

CpG island analysis
DNA sequences were analysed using the CpG island analysis tool at the Potential Promoter Regulatory Element Database (http://idealab.cs.uiowa.edu/cgi-bin/HPD/cg.cgi). The following parameters were used: minimum CpG island length 200 bp, minimum CpG content 0.5, and observed/expected CpG ratio 0.6. The genes from the MAGEX array were divided into three groups: genes containing (1) a CpG-rich region within first 100 bp of cDNA sequence; (2) CpG-rich region(s) outside the first 100 bp of cDNA sequence; and (3) no CpG-rich regions.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
xKaiso is a methyl-CpG dependent transcription repressor
We identified a Xenopus EST with homology to mammalian kaiso and subsequent sequencing showed it to be full length (AY044336). Comparison of the evolutionary conserved mammalian and xKaiso sequences reveals a domain-specific divergence in the amino acid sequence of the third zinc finger, which has only 61% similarity to human kaiso, compared with 90% for the other zinc fingers (Fig. 1A). Because this could possibly affect the sequence recognition of the ZF domain, we performed electrophoretic mobility shift assays (EMSA) with recombinant GST proteins containing the ZF domain. We found that xKaiso ZFs preferentially bind the methylated Sm (Me-Sm) DNA sequence, which contains three methylated CpG pairs (Prokhortchouk et al., 2001Go). No band shift was observed with the non-methylated Sm (Non-Sm) oligo (Fig. 1B). Despite the amino acid divergence in the third zinc finger, the DNA-binding affinity of the xKaiso ZFs for eight other methyl-CpG containing sequences tested previously for the human homologue (Prokhortchouk et al., 2001Go) displayed the same preference for two adjacent methyl-CpGs in the substrate, as the presence of intervening nucleotides reduced binding (data not shown). However, the xKaiso ZF domain was more specific for methylated DNA than its human counterpart: it did not copy the affinity of human kaiso for the non-methylated matrilysin (Hmat) sequence in EMSA (Fig. 1B, Fig. 3I). In a competition experiment, the matrilysin oligo was at most one-tenth as efficient a competitor compared with Me-Sm itself (Fig. 1C). Together, these results suggests that the xKaiso ZF domain has a preference for methylated DNA, but differs from human kaiso in its ability to bind certain non-methylated sequences.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. xKaiso is a methyl-CpG dependent transcriptional repressor. (A) Schematic of xKaiso illustrating the BTB-POZ and zinc-finger domains and identity and similarity (in %) with human and zebrafish protein sequences. The blue box indicates a region of high homology of unknown function. The bar indicates the region used in EMSA assays. (B) EMSA experiment using recombinant ZF domain of xKaiso (KaisoZFs) (1, 2, 4, 10, 20 and 40 ng of protein) with Sm (methylated and non-methylated) or human matrilysin (Hmat) probes. Arrow indicates the xKaiso ZF specific band shift in the reaction with methylated Sm, but not with non-methylated Sm or Hmat probe. (C) EMSA experiment with xKaiso ZF, methylated (Sm) probe and non-labelled competitors: either methylated or non-methylated Sm, or Hmat, at 5x, 10x, 100x, 1000x molar excess. No competitor is added to the reaction in the first lane. xKaiso ZF specific band (arrow) completely disappears at 1000 x molar excess of methylated Sm. Non-methylated Sm oligo shows virtually no competition with the methylated Sm probe. The xKaiso ZF band in the presence of 1000 x molar excess of Hmat competitor is stronger than in the presence of 100 x molar excess of methylated non-labelled Sm oligo. (D) Methyl-CpG-dependent repression by xKaiso in a transient transfection assay. Kaiso expression constructs were co-transfected with an SV40-luciferase reporter into mouse cells that are compromised in methyl-CpG-dependent transcriptional repression (Mbd2–/–). Relative percentage (methylated reporter expression/nonmethylated reporter expression) is the average of at least three experiments. Human kaiso (hKaiso) and human MeCP2 (MeCP2) expression constructs were used as positive controls for methyl-CpG dependent transcriptional repression.

 



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 3. The methyl-CpG binding function of kaiso is required to rescue the xKaiso knockdown phenotype. The percentages of presented phenotypes are indicated. (A) Embryos injected with 10 ng of CMO develop normally by tadpole stage. (B) Over-expression of 750 pg wild-type human kaiso RNA does not affect normal development of Xenopus embryos. (C) Injection of 750 pg of wild-type human kaiso RNA together with 5 ng KMO leads to complete rescue of 26% of the embryos. (D) Apoptotic phenotype produced by injection of 5 ng KMO. (E) Co-injection of 750 pg of C522R human kaiso mutant RNA with 5 ng KMO cannot rescue the phenotype of xKaiso depletion. (F) Location of the kaiso mutant C522R amino acid substitution (red) in the third zinc finger, leading to loss of the ability to bind methylated DNA. (G) Protein gel of recombinant wild-type human kaiso and C522R (C>R) mutant proteins (arrow). (H) Pull-down experiment showing p120ctn (arrow) binds both wild-type human kaiso and C522R (C>R) mutant proteins in vitro, but not human kaiso protein lacking the ZF domain ({Delta}ZF). (I) EMSA experiment using recombinant C522R (C>R) mutant and wild-type human kaiso proteins with methylated (lanes 1, 4), non-methylated Sm oligos (lanes 2, 5) and human matrilysin (Hmat) oligo (lanes 3, 6) as probes. The kaiso-specific band shift is arrowed. The C522R mutant shows no DNA-binding activity.

 
xKaiso has transcription repression activity when targeted to a GAL4-responsive luciferase reporter in Xenopus embryos (Kim et al., 2002Go). We verified whether xKaiso, like human kaiso, can repress transcription in a methyl-CpG dependent manner, using murine Mbd2–/– cells that are defective in their ability to repress expression from a methylated reporter gene (Hendrich et al., 2001Go; Prokhortchouk et al., 2001Go). In this cell line, a normally silent, fully CpG-methylated reporter gene was de-repressed to ~15% of control non-methylated reporter transcription activity. Expression of either xKaiso or human kaiso in this cell line restored repression from the methylated reporter, but not from the non-methylated control (Fig. 1D, and data not shown). Thus, xKaiso shows the same ability to repress transcription from a methylated reporter gene in the Mbd2–/– cell system as its mammalian homologue (Prokhortchouk et al., 2001Go).

xKaiso is essential for Xenopus development
To analyse xKaiso function during development, we injected Xenopus two-cell stage embryos with a stabilised antisense xKaiso morpholino oligonucleotide (KMO) corresponding to the 5'-UTR and first six codons (see Materials and methods). This efficiently blocks xKaiso protein translation (Fig. 2G). Injection with 10 ng of a control non-inhibitory morpholino (CMO) resulted in normal development (see Table S1 in the supplementary material; Fig. 2A). By contrast, embryos injected with 0.5-10 ng KMO morpholino failed to develop and exhibited a variety of dose-dependent phenotypes (see Table S1 in the supplementary material; Fig. 2B-E). The characteristic feature of the 5 ng KMO-injected embryos is the appearance of white apoptopic cells near the edge of the blastopore in neurulating embryos (Fig. 2B-D; Fig. 4). By stages 21-22, the KMO embryos are developmentally arrested and the embryo surface is covered with apoptotic cells that are associated with cell shedding (Fig. 2C). Injection of a low dose (0.5 ng) of KMO into two-cell stage embryos led to a less severe phenotype with a delay in blastopore closure at stage 15 (Fig. 2D); many of these embryos exhibited short axis or reduced dorsal structures (spina bifida) by tadpole stage (Fig. 2E). Phenotypically, the effect of the KMO injection was similar to that of xDnmt1 depletion (Fig. 2F) (Stancheva et al., 2001Go; Stancheva and Meehan, 2000Go). This overlap with the effects of loss of DNA methylation suggests that xKaiso may be responsible for mediating silencing of methylated genes in pre-MBT embryos, and is equally essential to their survival.



View larger version (89K):
[in this window]
[in a new window]
 
Fig. 2. The phenotypes of xKaiso-depleted embryos. (A) Embryos injected at two-cell stage with 10 ng of a control morpholino (CMO) show normal neurulation (stage 15). (B) Injection of 5 ng of the xKaiso morpholino (KMO) leads to a failure of blastopore closure and developmental arrest of neurulation at stage 15. Arrows indicate the appearance of white apoptotic cells from the borders of the blastopore. (C) Apoptotic cells (arrowed) cover almost the entire surface of embryos at stage 21 and cell shedding is present. (D) Injection of low dose (0.5 ng) of KMO causes defects of neurulation and delay of blastopore closure. Apoptotic cells are arrowed. (E) The range of phenotypes produced at low dose (0.5 ng) of KMO: 44% of embryos look normal by stage 38 (upper embryo), 29% exhibit failure to develop normal dorsal structures (spina bifida, lower embryo). Other phenotypes are intermediate. (F) Embryos injected with 10 ng of xDnmt1 morpholino (DMO) show apoptotic phenotype virtually identical to that of 5 ng KMO. (G) Western blot using anti-xKaiso antibody and whole embryonic extracts derived from wild type (WT) and 5 ng KMO-injected embryos (KMO). Stages of development are indicated above the lanes. The kaiso-specific band in KMO-injected embryos disappears by stage 10.

 



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4. The loss of xKaiso induces an apoptotic response in Xenopus embryos. Wild-type (A-C) and 5 ng KMO-injected (D-F) Xenopus embryos were assayed by TUNEL for the appearance of apoptotic cells. TUNEL-positive cells were not detectable in normal late blastula (A) and gastrula (B) embryos. Small numbers of apoptotic cells (arrowhead) appeared in 1-2% of wild-type embryos at late neurula stage (C). TUNEL-positive cells were detected in 11% and 15% of KMO-injected embryos at late blastula (D) and gastrula stages (E), respectively. More than 90% of KMO-injected embryos exhibited a general pattern of apoptosis at a stage corresponding to late neurula of normally developing embryos (F). Abbreviations: bp, blastopore; ant, anterior; post, posterior.

 
A functional methyl CpG binding domain is required to rescue KMO injected embryos
To ascertain the specificity of the KMO injection phenotype, we tried to rescue them by co-injection with human kaiso RNA, which will not bind the KMO because of sequence differences. Embryos injected at the two-cell stage with 750 pg of wild type human kaiso RNA developed normally (see Table S1 in the supplementary material, compare Fig. 3A,B). Co-injection of 5 ng KMO with 750 pg of wild type human kaiso enabled over half of the embryos (56%) to successfully complete neurulation compared with none for the KMO alone (see Table S1 in the supplementary material). By tadpole stage, 26% of KMO/750 pg wild type human kaiso injected embryos had developed normally, while 15% exhibited axial defects (see Table S1 in the supplementary material, Fig. 3C). We also attempted to rescue the KMO-induced phenotype with a mutant human kaiso RNA carrying a cysteine to arginine substitution at position 552 (C552R) in the third zinc finger (Fig. 3F). This disrupts the human kaiso DNA and methyl-CpG-dependent binding activity but not the ability to bind its interacting partner, p120ctn (Fig. 3H,I) (Daniel and Reynolds, 1999Go). Embryos injected with 5 ng of KMO and 750 pg of C522R RNA showed exactly the same phenotype as those injected with 5 ng KMO only, without any (even partial) rescue (see Table S1 in the supplementary material, Fig. 3D,E). These experiments strongly suggest that the DNA binding function of human kaiso is required to rescue KMO-injected embryos.

Kaiso-depleted embryos are apoptotic
xDnmt1 depletion in Xenopus embryos results in induction of apoptosis (Stancheva et al., 2001Go). We therefore checked whether KMO-injected embryos were apoptotic, using the whole-mount TUNEL assay, a highly sensitive indicator of DNA fragmentation in situ (Hensey and Gautier, 1998Go; Stancheva et al., 2001Go). A small number (1-2%) of non-injected control embryos have low levels of apoptotic cells that are restricted mainly to the developing nervous system at later stages of neurulation (Fig. 4A-C) (Hensey and Gautier, 1998Go). By contrast, in 11% of embryos injected at the two-cell stage with 5 ng of KMO, a small number of TUNEL-positive cells already appeared at late blastula stage (Fig. 4D). Fifteen percent of KMO injected embryos showed TUNEL-positive cells at mid-gastrula stage 11, mainly restricted to the ectodermal layer (Fig. 4E). By neurulation, a general pattern of apoptosis was detected in more than 90% of KMO-injected embryos (Fig. 4F), consistent with their visible appearance (Fig. 2C), and development was arrested. Overall, the cellular apoptotic patterns caused by xKaiso depletion are similar to those observed for xDnmt1-deficient embryos, further emphasizing the functional equivalence of loss of this CpG-dependent repressor, or loss of CpG methylation itself.

Loss of xKaiso activity results in premature activation of gene expression in blastula stage embryos
Reduction in genomic levels of 5mC in Xenopus embryos results in transcription activation approximately two cycles earlier than normal (Stancheva et al., 2002Go; Stancheva and Meehan, 2000Go). We tested for premature activation of zygotic transcription in xKaiso-depleted embryos by measuring the incorporation of {alpha}-35S labelled UTP in KMO-injected and control embryos at blastula and gastrula stages (Newport and Kirschner, 1982aGo; Newport and Kirschner, 1982bGo; Stancheva and Meehan, 2000Go). As expected, control embryos begin to incorporate label above background after MBT. By contrast, 35S-UTP incorporation in xKaiso-depleted embryos was detected two cell cycles earlier (Fig. 5A), as had been previously described for xDnmt1-depleted embryos (Stancheva and Meehan, 2000Go). In diploid embryos, premature global activation has only been observed upon xDnmt1 depletion. This strongly suggests that xDnmt1 and xKaiso may participate in the same pathway to silence genes in pre-MBT embryos.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5. xKaiso depletion leads to premature activation of transcription of a subset of genes regulated by xDnmt1. (A) [{alpha}-35S]UTP incorporation detecting the activation of gene expression in wild-type (WT) and 0.5 ng KMO-injected embryos. WT and KMO-injected two-cell embryos were treated with 50 nCi [{alpha}-35S]UTP, cultured in parallel and collected at the same developmental stage. (B) RNA derived from wild type, 5 ng KMO and 5 ng DMO (xDnmt1 morpholino) injected embryos at stage 8 were assayed by RT-PCR for the presence of transcripts of genes (xOct-25, xBef, xDrak1) regulated by xKaiso and xDnmt1, respectively, with xODC as a loading control.

 
In a cDNA screen, we have identified transcripts that are upregulated in pre-MBT embryos hypomethylated as a result of xDnmt1 depletion (D.D. and R.M., unpublished). Three examples (xOct-25, xBef and xDrak) are shown in Fig. 5B; derepression also occurred in KMO-injected embryos but was less marked than that observed for xDnmt1 depletion. All transcripts that were upregulated in KMO-injected blastula embryos were also upregulated in DMO embryos (D.D. and R.M., unpublished).

xKaiso is a genome wide repressor of transcription in the developing embryo
Our results suggest that the methyl-CpG-dependent repression function of xKaiso is required to maintain transcriptional silence in pre-MBT Xenopus embryos. To explore the capacity of xKaiso as a general transcription repressor, we screened a Xenopus cDNA mini-array with cDNA probes synthesized from pre-MBT stage 8 wild-type embryos (WT8), and xKaiso morpholino-injected (KMO8) and xKaiso morpholino/human kaiso mRNA co-injected (KMO8rescue) embryos. The fold expression changes between KMO8:WT8 and KMO8rescue:WT8 were computed using ScanAlyze and compared using a threshold of 1.5-fold expression change (Fig. 6A; Table S2 in the supplementary material). Fifty-seven genes (13%) were misregulated in the KMO:WT8 experiments, of which 55 (96%) were upregulated 1.5-fold or more in KMO8 embryos, and two genes [Mad2 and p33 ringo (ls26)] exhibited a decrease in expression relative to WT8 embryos (Fig. 6A). Many (25/55) of the genes upregulated in KMO8 were in the range of a 5- to 10-fold increase. We observed a similar change in expression pattern for this gene set in xDnmt1-deficient embryos (D.D. and R.M., unpublished). By sharp contrast, the overexpression of the 55 genes analysed in the KMO8:WT8 comparison was largely neutralised in KMO8rescue embryos. Only 18 (31%) of the genes were greater than 1.5 upregulated (e.g. GemH1, xMEK2, CycA1 and CycB2 in Fig. 6A,B). Six genes (11%) were essentially expressed at similar levels, while expression of the remainder (58%) was reduced in KMO8rescue embryos. This suggests that the rescued embryos have reduced levels of ectopic gene activation compared with xKaiso-depleted embryos.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 6. Depletion of xKaiso relieves transcriptional silence but can be rescued by overexpression of human kaiso mRNA. (A) Two array experiment comparisons were performed: WT8 versus KMO8 and WT8 versus KMO8rescue. The x-axis shows 57 genes that were differentially expressed over a minimum 1.5-fold threshold, and the y-axis shows the fold expression changes. Genes that are elevated in KMO8 or KMO8rescue relative to wild-type expression are shown in blue, and downregulated genes in red. (B) A representative array region showing the expression changes of five genes [Histone H1 (H1), Geminin H (GemH), cyclin A1 (CycA1), cyclin B2 (CycB2) and MEK1 (MEK1)], which are also indicated on the graph of genes shown in A. H1 expression was not rescued in KMO8rescue embryos, whereas CycB2 is, and GemH, MEK1 and CycA1 have reduced expression levels.

 
The 55 genes that were up-regulated in the KMO:WT experiments did not represent 13% of genes across the board. Some functional categories, such as `cell growth control' (27% of genes affected, P<0.0003) and `chromatin/DNA structure' (15%, P<0.02), were enriched over twofold relative to the input array, whereas others, in particular `transcription' (6%, P<0.0003), were significantly underrepresented (Fig. 7A,B). This is in marked contrast to the genes showing increased levels of expression at normal MBT (Altmann et al., 2001Go), where approximately half of the genes are involved in transcription (24%), regulatory functions (17%) and signal transduction (10%). After MBT, a greater number of the downregulated genes were involved with energy metabolism (16%) and significantly fewer genes serve regulatory functions (2%) (Altmann et al., 2001Go), whereas downregulated genes were an exception in the KMO:WT set (Fig. 7B).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 7. xKaiso-repressed genes: functional categories. (A) The 429 input (Total) genes and 55 genes upregulated relative to WT in Kaiso-depleted embryos (KMO/WT) were categorized as described (http://www.viagenx.ca/) and their distributions shown in separate pie charts. The numbers refer to the percentages of genes in each functional category in the left/right chart respectively. (B) CpG island analysis of the input (Total) and KMO/WT upregulated genes is shown in separate pie charts. Colour coding for the different groupings and their percentages of the total in each chart are shown on the right.

 
In previous work we demonstrated that genes that are regulated by DNA methylation at MBT contain clusters of CpGs at their promoters, so called `CpG islands', which are methylated in pre-MBT embryos (Stancheva et al., 2002Go). At present, the Xenopus laevis genome has not been sequenced. However, it is possible to identify potential CpG island regions in the 5' region of the MAGEX cDNAs based on the assumption that the initial 5'sequence (first exon) overlaps with the promoter region (Bird, 1986Go; Tykocinski and Max, 1984Go). On this basis, 30% of the genes on the MAGEX array contain potential CpG islands and 38% percent do not (Fig. 7C). The remaining 32% contains CpG rich sequences outside the 5' region. In the KMO:WT set of cDNAs, the proportion of potential CpG island containing genes is enriched (52% compared with 30%, P<0.00004; Fig. 7D). If these regions are methylated in pre-MBT embryos, then they may represent direct targets for xKaiso-dependent silencing during early development.


    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
In the developing embryo, the midblastula transition (MBT) marks the time point when dependence on maternal transcripts gives way to the start of zygotic transcription (maternal-zygotic transcription, MZT). This key event in the development of all metazoans takes place early after the first few cell divisions in mammalian embryos, but occurs at later stages in embryo species sustained on large supplies of maternal RNA. In amphibians, where the MBT was first noted (Newport and Kirschner, 1982aGo; Newport and Kirschner, 1982bGo), the transition is preceded by a period of transcriptional silence lasting 12 cell divisions. DNA methylation has a clearly identified role in the regulation of developmental gene activation at the MBT (Stancheva et al., 2001Go; Stancheva et al., 2002Go; Stancheva and Meehan, 2000Go). Loss of methylation at individual Xenopus gene promoters coincides with their zygotic activation at MBT. No changes in methylation patterns are observed for repeated sequences, genes that are inactive at MBT, or in coding regions (Stancheva et al., 2002Go). Experimentally induced depletion of DNA methylation in the developing embryo causes premature activation of zygotic gene transcription at least two cell cycles earlier than normal. This incorrect timing of the MBT leads to developmental arrest and cell death (Stancheva et al., 2001Go). Loss of DNA methylation is also deleterious to mammalian development (Jackson-Grusby et al., 2001Go; Lei et al., 1996Go).

The mechanism by which transcriptional silencing is maintained in early development is not clear. CpG methylation can directly inhibit transcription factor binding or affect nucleosome positioning (Davey et al., 2004Go; Meehan, 2003Go), but it is also a target for methyl-CpG binding domain (MBD)-containing proteins such as MeCP2, MBD1 and MBD2. However, the absence of these proteins in MeCP2-, MBD1- and MBD2-null mice does not have the same deleterious consequences as Dnmt1 depletion (Chen et al., 2001Go; Guy et al., 2001Go; Hendrich et al., 2001Go; Li et al., 1992Go; Tudor et al., 2002Go; Zhao et al., 2003Go). This could be due to functional redundancy between MBD proteins. However, this does not seem to be the case for MBD2 and MeCP2 (Guy et al., 2001Go). Possibly, the exceptionally early MZT before the first cell division in mice is functionally different from the period of transcriptional quiescence typical for other organisms (Beaujean et al., 2004aGo; Beaujean et al., 2004bGo). A further difference exists in the DNA binding ability of MBD3: Xenopus contains an MBD3 isoform that, unlike its mammalian counterpart, binds to methylated DNA (Wade et al., 1999Go). This is due to a tyrosine to phenylalanine substitution at position 29 of the MBD that is crucial for contacts with the phosphate backbone (Saito and Ishikawa, 2002Go). Alternatively, additional methyl-CpG activities could exist that mediate global silencing of methylated genes in animals.

In this work, we identify xKaiso as the likely candidate for mediating CpG methylation-dependent gene repression in the developing embryo. Kaiso is a transcription repressor with a distinct methyl-CpG binding ability contained in its zinc-finger domain. We demonstrate that despite considerable amino acid divergence in the third zinc-finger motif, xKaiso binds methylated DNA in vitro with a similar binding specificity to its mammalian counterpart, but with less non-methylated DNA sequence specificity than observed for mouse kaiso (Daniel et al., 2002Go). In addition, we show that ectopic expression of xKaiso in MBD2–/– deficient fibroblasts restores repression of a methylated reporter construct, establishing its credentials as a CpG methylation-dependent repressor, rather than a general transcription repressor (Kim et al., 2002Go). In stark contrast with the minor consequences of depletion/knockouts of MBD proteins in mouse, xKaiso is essential for normal Xenopus development. An xKaiso knockdown mimics xDnmt1 depletion in every aspect studied: embryos show precocious activation of gene expression, apoptosis and developmental arrest. The specificity of the depletion phenotype and functional conservation was demonstrated by expressing human kaiso in Xenopus KMO embryos. This rescued a high proportion of these embryos, while enabling a majority to complete neurulation. Importantly, a mutation in the third zinc finger that abolished the ability of kaiso to bind methylated DNA could not rescue the KMO phenotype. Our results strongly suggest that the main developmental changes observed after loss of CpG methylation are normally under control of the xKaiso transcriptional repressor and dependent on its methyl CpG binding domain.

Our gene array data reveal that xKaiso may control more than 10% of genes in early development. This is consistent with an important role for xKaiso in these processes, its absence leading to developmental arrest. The reported interaction with p120ctn is interesting with regard to the possible role of kaiso in the MBT. Apart from the onset of zygotic transcription, the MBT is also associated with the slowing of cell division and the onset of cell migration (Masui and Wang, 1998Go; Veenstra, 2002Go). The p120ctn interaction links E-cadherin cell adhesion with transcription in the nucleus, and loss of this connection may be responsible for the dose-dependent effects of xKaiso depletion on gastrulation movements. Loss of cell adhesion is observed with xDnmt1 as well as kaiso knockdown embryonic tissues (I.S., A.R. and R.M., unpublished). Over-expression experiments nevertheless do not support a mutual inhibition mechanism for p120ctn versus kaiso function in vivo. Milder phenotypes result from over-expression of murine p120ctn or reduction of xp120ctn in Xenopus compared with kaiso depletion (Fang et al., 2004Go; Geis et al., 1998Go; Paulson et al., 1999Go). Conversely, an excess of kaiso does not appear to disturb essential developmental processes, as our embryo controls developed normally when injected with 750 pg of wild-type human kaiso RNA. The point mutant C552R-kaiso is able to bind p120ctn, but could not rescue the depletion phenotype through a p120ctn-mediated pathway.

xKaiso depletion, like xDnmt1, causes the premature activation of gene transcription at least two cycles prior to MBT. Our results indicate that it is unlikely that the MBT is simply brought forward; rather, gene silencing is relieved outside the normal context of the MBT. This unscheduled entry into transcription is not accompanied by the increase in transcription-related gene products normally observed at the MBT (Altmann et al., 2001Go). Levels of maternal mRNA and/or cytoplasmic volume may trigger this production of transcription machinery independently (Masui and Wang, 1998Go; Veenstra, 2002Go). The premature transcription we observe could therefore be rate limiting with regards to these components.

However, it is clear that xKaiso normally represses an abundance of genes involved in cell growth and control. Only a small set of this class of genes is normally activated at MBT (Altmann et al., 2001Go). This specialisation of a methylation-dependent transcription repressor is perhaps not surprising in view of the role of DNA methylation in cancer. It is also consistent with the observation of tumours in xDnmt1-depleted, apoptosis-inactivated Xenopus embryos (Stancheva et al., 2001Go). We demonstrate that apoptosis is triggered by the depletion of xKaiso, as observed with Dnmt1 depletion. Elevated expression in both xKaiso- and xDnmt1-deficient pre-MBT embryos suggest a common pathway of repression of a set of candidate genes previously implicated in MBT (Stancheva and Meehan, 2000Go). Their scheduled release from repression implies a regulatory control over the methylation-dependent repression pathway subject to developmental checkpoints by apoptosis. Receptor signalling pathways could be involved based on the recruitment of N-CoR in association with HDAC3 observed for human kaiso at the human MTA2 gene, when abnormally methylated in HeLa cells (Yoon et al., 2003Go). N-CoR is expressed at all stages of Xenopus development and may also be required to mediate transcriptional silencing in pre-MBT embryos (Koide et al., 2001Go). In addition, methylation mapping data suggest that Dnmt1 may contribute specificity by selectively maintaining CpG methylation at certain loci while total levels decrease prior to the MBT (Stancheva et al., 2002Go). It is also possible that xMBD3, which has been shown to be part of the NuRD repressor complex has a general role in developmental gene activation at MBT and preliminary analysis suggests that it is also essential for Xenopus development (D.D. and R.M., unpublished) (Iwano et al., 2004Go).

The point at which embryonic transcription initiates in mammals varies between species with MZT occurring at the end of the one-cell stage in mice, the four- to eight-cell stage in humans, and at the eight- to 16-cell stage in rabbits, sheep and cattle (Kanka, 2003Go). Amphibians, and also zebrafish (Martin et al., 1999Go), exemplify the situation where high initial levels of CpG methylation correlate with transcriptional quiescence in the presence of large supplies of maternal transcripts. In species where the MZT occurs after more than one cleavage, transcriptional silence is likely to be maintained because of a non-permissive chromatin state that may involve DNA methylation and methyl-CpG repressor proteins, such as xKaiso. Our results raise the issue of whether the global role of xKaiso in CpG-dependent transcriptional silence is specific to early development. The indications are that MBD1, MBD2 and MeCP2 are not required to regulate MZT; instead they are used at later stages of development (Jaenisch and Bird, 2003Go; Stancheva et al., 2003Go).

A key point is that CpG methylation in differentiated somatic cells is implicated in stable gene silencing that may involve the sequestering of genes in the heterochromatic (late replicating) compartment of the nucleus. This is associated with the restriction of developmental potential and maintenance of differentiation. A very different situation applies to the pre-MBT embryo, where the genome is quiescent but in fact poised to start transcription at MZT to provide a pluripotent cell type. We propose that this poised repression, which is different from stable silencing, requires xKaiso, a transcriptional repressor (rather than silencing mediator) with connections to signalling pathways that permit the scheduled release from transcriptional quiescence at MZT.


    ACKNOWLEDGMENTS
 
We thank Wendy Bickmore and Nick Hastie for helpful comments on earlier versions of the manuscript. We acknowledge the kind help of Viagenx with the array analysis. This work was supported by Wellcome Trust and CRUK project grants to R.M., a Wellcome Trust International Travelling Fellowship to A.R., and a Wellcome Senior Research Fellowship to S.P., E.P. and A.P. are supported by Russian Foundation for Basic Research grant 02-04-48457 and CRDF grant RB1 2385. Current work in R.M.'s laboratory (R.M., A.R. and D.D.) is supported by the MRC. This paper is dedicated to the memory of our late colleague and friend A. John Clark, whose lasting encouragement continues to guide our ideas.


    Footnotes
 
Supplementary material

Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/131/24/6185/DC1

* These authors contributed equally to this work Back


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 

Almouzni, G. and Wolffe, A. P. (1995). Constraints on transcriptional activator function contribute to transcriptional quiescence during early Xenopus embryogenesis. EMBO J. 14,1752 -1765.[Medline]

Almouzni, G., Khochbin, S., Dimitrov, S. and Wolffe, A. P. (1994). Histone acetylation influences both gene expression and development of Xenopus laevis. Dev. Biol. 165,654 -669.[CrossRef][Medline]

Altmann, C. R., Bell, E., Sczyrba, A., Pun, J., Bekiranov, S., Gaasterland, T. and Brivanlou, A. H. (2001). Microarray-based analysis of early development in Xenopus laevis. Dev. Biol. 236,64 -75.[CrossRef][Medline]

Ballestar, E., Paz, M. F., Valle, L., Wei, S., Fraga, M. F., Espada, J., Cigudosa, J. C., Huang, T. H. and Esteller, M. (2003). Methyl-CpG binding proteins identify novel sites of epigenetic inactivation in human cancer. EMBO J. 22,6335 -6345.[CrossRef][Medline]

Barnett, M. W., Old, R. W. and Jones, E. A. (1998). Neural induction and patterning by fibroblast growth factor, notochord and somite tissue in Xenopus. Dev. Growth Differ. 40,47 -57.[CrossRef][Medline]

Beaujean, N., Hartshorne, G., Cavilla, J., Taylor, J., Gardner, J., Wilmut, I., Meehan, R. and Young, L. (2004a). Non-conservation of mammalian preimplantation methylation dynamics. Curr. Biol. 14,R266 -R267.[CrossRef][Medline]

Beaujean, N., Taylor, J. E., McGarry, M., Gardner, J. O., Wilmut, I., Loi, P., Ptak, G., Galli, C., Lazzari, G., Bird, A., Young, L. E. and Meehan, R. R. (2004b). The effect of interspecific oocytes on demethylation of sperm DNA. Proc. Natl. Acad. Sci. USA 101,7636 -7640.[Abstract/Free Full Text]

Bird, A. P. (1986). CpG-rich islands and the function of DNA methylation. Nature 321,209 -213.[CrossRef][Medline]

Bird, A. (2002). DNA methylation patterns and epigenetic memory. Genes Dev. 16, 6-21.[Free Full Text]

Chen, R. Z., Akbarian, S., Tudor, M. and Jaenisch, R. (2001). Deficiency of methyl-CpG binding protein-2 in CNS neurons results in a Rett-like phenotype in mice. Nat. Genet. 27,327 -331.[CrossRef][Medline]

Cross, S. H., Meehan, R. R., Nan, X. and Bird, A. (1997). A component of the transcriptional repressor MeCP1 shares a motif with DNA methyltransferase and HRX proteins. Nat. Genet. 16,256 -259.[CrossRef][Medline]

Daniel, J. M. and Reynolds, A. B. (1999). The catenin p120(ctn) interacts with Kaiso, a novel BTB/POZ domain zinc finger transcription factor. Mol. Cell. Biol. 19,3614 -3623.[Abstract/Free Full Text]

Daniel, J. M., Spring, C. M., Crawford, H. C., Reynolds, A. B. and Baig, A. (2002). The p120(ctn)-binding partner Kaiso is a bi-modal DNA-binding protein that recognizes both a sequence-specific consensus and methylated CpG dinucleotides. Nucleic Acids Res. 30,2911 -2919.[Abstract/Free Full Text]

Davey, C. S., Pennings, S., Reilly, C., Meehan, R. R. and Allan, J. (2004). A determining influence for CpG dinucleotides on nucleosome positioning in vitro. Nucleic Acids Res. 32,4322 -4331.[Abstract/Free Full Text]

Eisen, M. B., Spellman, P. T., Brown, P. O. and Botstein, D. (1998). Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA 95,14863 -14868.[Abstract/Free Full Text]

Fang, X., Ji, H., Kim, S. W., Park, J. I., Vaught, T. G., Anastasiadis, P. Z., Ciesiolka, M. and McCrea, P. D. (2004). Vertebrate development requires ARVCF and p120 catenins and their interplay with RhoA and Rac. J. Cell Biol. 165, 87-98.[Abstract/Free Full Text]

Geis, K., Aberle, H., Kuhl, M., Kemler, R. and Wedlich, D. (1998). Expression of the Armadillo family member p120cas1B in Xenopus embryos affects head differentiation but not axis formation. Dev. Genes Evol. 207,471 -481.[CrossRef][Medline]

Gregory, R. I., Randall, T. E., Johnson, C. A., Khosla, S., Hatada, I., O'Neill, L. P., Turner, B. M. and Feil, R. (2001). DNA methylation is linked to deacetylation of histone H3, but not H4, on the imprinted genes Snrpn and U2af1-rs1. Mol. Cell. Biol. 21,5426 -5436.[Abstract/Free Full Text]

Guy, J., Hendrich, B., Holmes, M., Martin, J. E. and Bird, A. (2001). A mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome. Nat. Genet. 27,322 -326.[CrossRef][Medline]

Helbing, C. C., Werry, K., Crump, D., Domanski, D., Veldhoen, N. and Bailey, C. M. (2003). Expression profiles of novel thyroid hormone-responsive genes and proteins in the tail of Xenopus laevis tadpoles undergoing precocious metamorphosis. Mol. Endocrinol. 17,1395 -1409.[Abstract/Free Full Text]

Hendrich, B. and Bird, A. (1998). Identification and characterization of a family of mammalian methyl-CpG binding proteins. Mol. Cell. Biol. 18,6538 -6547.[Abstract/Free Full Text]

Hendrich, B. and Tweedie, S. (2003). The methyl-CpG binding domain and the evolving role of DNA methylation in animals. Trends Genet. 19,269 -277.[CrossRef][Medline]

Hendrich, B., Guy, J., Ramsahoye, B., Wilson, V. A. and Bird, A. (2001). Closely related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse development. Genes Dev. 15,710 -723.[Abstract/Free Full Text]

Hensey, C. and Gautier, J. (1998). Programmed cell death during Xenopus development: a spatio-temporal analysis. Dev. Biol. 203,36 -48.[CrossRef][Medline]

Hutchins, A. S., Mullen, A. C., Lee, H. W., Sykes, K. J., High, F. A., Hendrich, B. D., Bird, A. P. and Reiner, S. L. (2002). Gene silencing quantitatively controls the function of a developmental trans-activator. Mol. Cell 10, 81-91.[CrossRef][Medline]

Iwano, H., Nakamura, M. and Tajima, S. (2004). Xenopus MBD3 plays a crucial role in an early stage of development. Dev. Biol. 268,416 -428.[CrossRef][Medline]

Jackson-Grusby, L., Beard, C., Possemato, R., Tudor, M., Fambrough, D., Csankovszki, G., Dausman, J., Lee, P., Wilson, C., Lander, E. and Jaenisch, R. (2001). Loss of genomic methylation causes p53-dependent apoptosis and epigenetic deregulation. Nat. Genet. 27,31 -39.[CrossRef][Medline]

Jaenisch, R. and Bird, A. (2003). Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat. Genet. Suppl. 33,245 -254.

Jones, P. L., Veenstra, G. J., Wade, P. A., Vermaak, D., Kass, S. U., Landsberger, N., Strouboulis, J. and Wolffe, A. P. (1998). Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat. Genet. 19,187 -191.[CrossRef][Medline]

Kanka, J. (2003). Gene expression and chromatin structure in the pre-implantation embryo. Theriogenology 59,3 -19.[CrossRef][Medline]

Kim, S. W., Fang, X., Ji, H., Paulson, A. F., Daniel, J. M., Ciesiolka, M., van Roy, F. and McCrea, P. D. (2002). Isolation and characterization of XKaiso, a transcriptional repressor that associates with the catenin Xp120(ctn) in Xenopus laevis. J. Biol. Chem. 277,8202 -8208.[Abstract/Free Full Text]

Koide, T., Downes, M., Chandraratna, R. A., Blumberg, B. and Umesono, K. (2001). Active repression of RAR signaling is required for head formation. Genes Dev. 15,2111 -2121.[Abstract/Free Full Text]

Lei, H., Oh, S. P., Okano, M., Juttermann, R., Goss, K. A., Jaenisch, R. and Li, E. (1996). De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development 122,3195 -3205.[Abstract]

Li, E., Bestor, T. H. and Jaenisch, R. (1992). Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69,915 -926.[CrossRef][Medline]

Martin, C. C., Laforest, L., Akimenko, M. A. and Ekker, M. (1999). A role for DNA methylation in gastrulation and somite patterning. Dev. Biol. 206,189 -205.[CrossRef][Medline]

Masui, Y. and Wang, P. (1998). Cell cycle transition in early embryonic development of Xenopus laevis. Biol. Cell 90,537 -548.[CrossRef][Medline]

Meehan, R. R. (2003). DNA methylation in animal development. Semin. Cell Dev. Biol. 14, 53-65.[CrossRef][Medline]

Nan, X., Campoy, F. J. and Bird, A. (1997). MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin. Cell 88,471 -481.[CrossRef][Medline]

Nan, X., Ng, H. H., Johnson, C. A., Laherty, C. D., Turner, B. M., Eisenman, R. N. and Bird, A. (1998). Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 393,386 -389.[CrossRef][Medline]

Newport, J. and Kirschner, M. (1982a). A major developmental transition in early Xenopus embryos: I. characterization and timing of cellular changes at the midblastula stage. Cell 30,675 -686.[CrossRef][Medline]

Newport, J. and Kirschner, M. (1982b). A major developmental transition in early Xenopus embryos: II. Control of the onset of transcription. Cell 30,687 -696.[CrossRef][Medline]

Ng, H. H., Zhang, Y., Hendrich, B., Johnson, C. A., Turner, B. M., Erdjument-Bromage, H., Tempst, P., Reinberg, D. and Bird, A. (1999). MBD2 is a transcriptional repressor belonging to the MeCP1 histone deacetylase complex. Nat. Genet. 23, 58-61.[Medline]

Ng, H. H., Jeppesen, P. and Bird, A. (2000). Active repression of methylated genes by the chromosomal protein MBD1. Mol. Cell. Biol. 20,1394 -1406.[Abstract/Free Full Text]

Paulson, A. F., Fang, X., Ji, H., Reynolds, A. B. and McCrea, P. D. (1999). Misexpression of the catenin p120(ctn)1A perturbs Xenopus gastrulation but does not elicit Wnt-directed axis specification. Dev. Biol. 207,350 -363.[CrossRef][Medline]

Prokhortchouk, A., Hendrich, B., Jorgensen, H., Ruzov, A., Wilm, M., Georgiev, G., Bird, A. and Prokhortchouk, E. (2001). The p120 catenin partner Kaiso is a DNA methylation-dependent transcriptional repressor. Genes Dev. 15,1613 -1618.[Abstract/Free Full Text]

Saito, M. and Ishikawa, F. (2002). The mCpG-binding domain of human MBD3 does not bind to mCpG but interacts with NuRD/Mi2 components HDAC1 and MTA2. J. Biol. Chem. 277,35434 -35439.[Abstract/Free Full Text]

Stancheva, I. and Meehan, R. R. (2000). Transient depletion of xDnmt1 leads to premature gene activation in Xenopus embryos. Genes Dev. 14,313 -327.[Abstract/Free Full Text]

Stancheva, I., Hensey, C. and Meehan, R. R. (2001). Loss of the maintenance methyltransferase, xDnmt1, induces apoptosis in Xenopus embryos. EMBO J. 20,1963 -1973.[CrossRef][Medline]

Stancheva, I., El Maarri, O., Walter, J., Niveleau, A. and Meehan, R. R. (2002). DNA methylation at promoter regions regulates the timing of gene activation in Xenopus laevis embryos. Dev. Biol. 243,155 -165.[CrossRef][Medline]

Stancheva, I., Collins, A. L., Van, d. V., I, Zoghbi, H. and Meehan, R. R. (2003). A mutant form of MeCP2 protein associated with human Rett syndrome cannot be displaced from methylated DNA by notch in Xenopus embryos. Mol. Cell 12,425 -435.[CrossRef][Medline]

Tudor, M., Akbarian, S., Chen, R. Z. and Jaenisch, R. (2002). Transcriptional profiling of a mouse model for Rett syndrome reveals subtle transcriptional changes in the brain. Proc. Natl. Acad. Sci. USA 99,15536 -15541.[Abstract/Free Full Text]

Tykocinski, M. L. and Max, E. E. (1984). CG dinucleotide clusters in MHC genes and in 5' demethylated genes. Nucleic Acids Res. 12,4385 -4396.[Abstract/Free Full Text]

Veenstra, G. J. (2002). Early embryonic gene transcription in Xenopus. Adv. Dev. Biol. Biochem. 12, 85-105.

Veenstra, G. J., Destree, O. H. and Wolffe, A. P. (1999). Translation of maternal TATA-binding protein mRNA potentiates basal but not activated transcription in Xenopus embryos at the midblastula transition. Mol. Cell. Biol. 19,7972 -7982.[Abstract/Free Full Text]

Wade, P. A., Gegonne, A., Jones, P. L., Ballestar, E., Aubry, F. and Wolffe, A. P. (1999). Mi-2 complex couples DNA methylation to chromatin remodelling and histone deacetylation. Nat. Genet. 23,62 -66.[Medline]

Yoon, H. G., Chan, D. W., Reynolds, A. B., Qin, J. and Wong, J. (2003). N-CoR mediates DNA methylation-dependent repression through a methyl CpG binding protein Kaiso. Mol. Cell 12,723 -734.[CrossRef][Medline]

Zhao, X., Ueba, T., Christie, B. R., Barkho, B., McConnell, M. J., Nakashima, K., Lein, E. S., Eadie, B. D., Willhoite, A. R., Muotri, A. R., Summers, R. G., Chun, J., Lee, K. F. and Gage, F. H. (2003). Mice lacking methyl-CpG binding protein 1 have deficits in adult neurogenesis and hippocampal function. Proc. Natl. Acad. Sci. USA 100,6777 -6782.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related articles in Development:

Staying silent in early development

Development 2004 131: e2405. [Full Text]  



This article has been cited by other articles:


Home page
DevelopmentHome page
A. Ruzov, B. Shorning, O. Mortusewicz, D. S. Dunican, H. Leonhardt, and R. R. Meehan
MBD4 and MLH1 are required for apoptotic induction in xDNMT1-depleted embryos
Development, July 1, 2009; 136(13): 2277 - 2286.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. Ruzov, E. Savitskaya, J. A. Hackett, J. P. Reddington, A. Prokhortchouk, M. J. Madej, N. Chekanov, M. Li, D. S. Dunican, E. Prokhortchouk, et al.
The non-methylated DNA-binding function of Kaiso is not required in early Xenopus laevis development
Development, March 1, 2009; 136(5): 729 - 738.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. Ruzov, J. A. Hackett, A. Prokhortchouk, J. P. Reddington, M. J. Madej, D. S. Dunican, E. Prokhortchouk, S. Pennings, and R. R. Meehan
The interaction of xKaiso with xTcf3: a revised model for integration of epigenetic and Wnt signalling pathways
Development, March 1, 2009; 136(5): 723 - 727.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
C. Baroux, D. Autran, C.S. Gillmor, D. Grimanelli, and U. Grossniklaus
The Maternal to Zygotic Transition in Animals and Plants
Cold Spring Harb Symp Quant Biol, February 9, 2009; (2009) sqb.2008.73.053v1.
[Abstract] [PDF]


Home page
Cancer Res.Home page
E. C. Lopes, E. Valls, M. E. Figueroa, A. Mazur, F.-G. Meng, G. Chiosis, P. W. Laird, N. Schreiber-Agus, J. M. Greally, E. Prokhortchouk, et al.
Kaiso Contributes to DNA Methylation-Dependent Silencing of Tumor Suppressor Genes in Colon Cancer Cell Lines
Cancer Res., September 15, 2008; 68(18): 7258 - 7263.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
D. S. Dunican, A. Ruzov, J. A. Hackett, and R. R. Meehan
xDnmt1 regulates transcriptional silencing in pre-MBT Xenopus embryos independently of its catalytic function
Development, April 1, 2008; 135(7): 1295 - 1302.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
A. F. Schier
The Maternal-Zygotic Transition: Death and Birth of RNAs
Science, April 20, 2007; 316(5823): 406 - 407.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. W. Rupon, S. Z. Wang, K. Gaensler, J. Lloyd, and G. D. Ginder
Methyl binding domain protein 2 mediates {gamma}-globin gene silencing in adult human betaYAC transgenic mice
PNAS, April 25, 2006; 103(17): 6617 - 6622.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. Heasman
Patterning the early Xenopus embryo.
Development, April 1, 2006; 133(7): 1205 - 1217.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Angrisano, F. Lembo, R. Pero, F. Natale, A. Fusco, V. E. Avvedimento, C. B. Bruni, and L. Chiariotti
TACC3 mediates the association of MBD2 with histone acetyltransferases and relieves transcriptional repression of methylated promoters
Nucleic Acids Res., January 12, 2006; 34(1): 364 - 372.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
G. J. P. Filion, S. Zhenilo, S. Salozhin, D. Yamada, E. Prokhortchouk, and P.-A. Defossez
A Family of Human Zinc Finger Proteins That Bind Methylated DNA and Repress Transcription
Mol. Cell. Biol., January 1, 2006; 26(1): 169 - 181.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Prokhortchouk, O. Sansom, J. Selfridge, I. M. Caballero, S. Salozhin, D. Aithozhina, L. Cerchietti, F. G. Meng, L. H. Augenlicht, J. M. Mariadason, et al.
Kaiso-Deficient Mice Show Resistance to Intestinal Cancer
Mol. Cell. Biol., January 1, 2006; 26(1): 199 - 208.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
A K E Swales and N Spears
Genomic imprinting and reproduction
Reproduction, October 1, 2005; 130(4): 389 - 399.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Soubry, J. van Hengel, E. Parthoens, C. Colpaert, E. Van Marck, D. Waltregny, A. B. Reynolds, and F. van Roy
Expression and Nuclear Location of the Transcriptional Repressor Kaiso Is Regulated by the Tumor Microenvironment
Cancer Res., March 15, 2005; 65(6): 2224 - 2233.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
dev.01549v1
131/24/6185    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Development
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruzov, A.
Right arrow Articles by Meehan, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruzov, A.
Right arrow Articles by Meehan, R. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?