|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online January 16, 2004
doi: 10.1242/10.1242/dev.00954


1 Max-Planck Institute for Immunobiology, Stuebeweg 51, D-79108 Freiburg,
Germany
2 Leiden Institute of Biology, Wassenaarseweg 64, 2333 AL Leiden, The
Netherlands
Authors for correspondence (e-mail:
j.bakkers{at}niob.knaw.nl
and
hammerschmid{at}immunbio.mpg.de)
Accepted 29 October 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Hyaluronan, Has, Dg42, Rac1, Cell migration, Convergence extension, Adaxial cells, Slow muscle, Sclerotome, Germ cells, Metastasis, Zebrafish
| Introduction |
|---|
|
|
|---|
Numerous functions have been associated with HA in cell proliferation, cell
adhesion and cell migration (for reviews, see
Lee and Spicer, 2000
;
Toole, 2001
). Some of these
can be attributed to the ability of HA to create and fill space by organizing
and modifying the ECM. Other roles are related to its ability to interact and
signal through cell surface or cytoplasmic receptors, such as CD44 or RHAMM.
Different cellular responses can be induced via various signal transduction
pathways, involving the GTPases Ras, RhoA and Rac (reviewed by
Lee and Spicer, 2000
;
Toole, 2001
;
Turley et al., 2002
). In the
case of Rac1, which can be activated by CD44 via the nucleotide exchange
factor Tiam1 (Bourguignon et al.,
2000
), these responses include the local reorganization of the
cytoskeleton and lamellipodia formation
(Oliferenko et al., 2000
).
Most of the experiments addressing the functions of HA have been carried
out in vitro. Comparably few in vivo analyses have been reported, most of
which deal with the role of HA in cancer. It was shown that most malignant
solid tumors contain elevated HA levels (reviewed by
Toole, 2001
). In addition, Has
overexpression promotes fibrosarcoma and mammary carcinoma growth
(Kosaki et al., 1999
), whereas
perturbation of endogenous HA interactions inhibits mammary carcinoma growth
(Peterson et al., 2000
).
Furthermore, HA-induced clustering of CD44
(Yu and Stamenkovic, 2000
),
and overexpression of RHAMM (Hall et al.,
1995
), lead to enhanced invasiveness of tumor cells and
metastasis. Together, these data indicate an important role of HA in promoting
cell proliferation and migration in malignant tumor cells.
To study the role of HA during normal vertebrate development, Has2
has been knocked out in mouse. Has2 deficient embryos die during
midgestation (E9.5-E10), exhibiting reduced body size and severe cardiac and
vascular abnormalities (Camenisch et al.,
2000
). In the developing heart, Has2 and HA are required
for an epithelial-to-mesenchymal transformation, and subsequent migration of
endothelial cells at the atrioventricular boundary during early steps of heart
valve formation. However, it remains unclear whether, being also involved in
other morphogenetic and migratory processes that take place in vertebrate
embryos, HA and Has proteins might have more widespread roles.
In this paper we focus on the essential role of zebrafish has2 for
cell migrations during zebrafish gastrulation. Based on cell tracing analyses,
three different morphogenetic movements of gastrulation have been
distinguished, epiboly, involution, and convergent extension (CE)
(Warga and Kimmel, 1990
).
During CE, cells from lateral regions of the gastrula embryo move towards the
dorsal side (convergence), which extends accordingly (extension). Initially,
convergence and extension were supposed to be closely linked, driven by
mediolateral cell-cell intercalations
(Warga and Kimmel, 1990
).
Indeed, several mutants were isolated in which both convergence and extension
are affected, such as knypek/glypican6
(Topczewski et al., 2001
) and
trilobite/strabismus
(Jessen et al., 2002
;
Park and Moon, 2001
). However,
a recent study of cell behavior within the notochord of no tail
(ntl) mutant embryos shows that extension can be driven by mechanisms
other than convergence (Glickmann et al., 2003). According to this notion,
mediolateral intercalation is largely restricted to dorsal regions, driving
extension and narrowing of the axis, whereas convergence of lateral cells
entails migration of individual cells and small groups of cells without any
cell rearrangements (reviewed by
Wallingford et al., 2002
;
Myers et al., 2002b
;
Solnica-Krezel and Cooper,
2002
).
Mutant analysis has revealed some of the signaling pathways that are
involved in instructing cellular CE behavior. Although the non-canonical Wnt
signals Wnt11 and Wnt5, mutated in silberblick/wnt11 and
pipetail/wnt5 mutant embryos, respectively
(Heisenberg et al., 2000
;
Rauch et al., 1997
;
Wallingford et al., 2002
), are
required for both convergence and extension movements, Bone morphogenetic
proteins (Bmps) appear to be essential for convergence only. In bmp
mutant embryos, convergence is blocked, whereas extension is normal or even
elevated, resulting in the characteristic cylinder shape of the mutant embryo
(Myers et al., 2002a
).
However, in addition to cell movements, Bmps also determine differential cell
fates along the dorsoventral axis of gastrula embryos, and it is currently
unclear how these two roles are interconnected (for a review, see
Hammerschmidt and Mullins,
2002
; Myers et al.,
2002b
).
Here we show that Has2 is specifically required for the migration of lateral cells driving dorsal convergence. By contrast, extension within the axial and paraxial mesoderm is normal in has2 morphant embryos, but blocked upon has2 overexpression. The loss of dorsal convergence in has2 morphants results in a cylinder shape of the embryos, similar to that of bmp mutants. However, in contrast to bmp mutants, has2 morphants do not display a dorsalization of cell fates. Thus, has2 allows us to genetically dissect convergence and extension as two separate morphogenetic movements of gastrulation, specifically regulating active cell migration of converging lateral cells independent of dorsoventral cell fate specification. In addition, we show that the effect of Has2 on dorsal convergence is mediated by the small GTPase Rac1, promoting lamellipodia outgrowth. This indicates that HA regulates migrating cells during embryogenesis and tumor invasion by activating the same signal transduction pathway.
| Materials and methods |
|---|
|
|
|---|
Generation of constructs, mRNA synthesis and microinjection
has2 was amplified with primers containing EcoRI and
XhoI restriction sites from full-length cDNA using Cloned
Pfu DNA polymerase (Stratagene), and cloned into pCS2+ to create a
pCS2-has2 expression construct. Human caRac1 G12V was obtained from
the Guthrie cDNA Resource Center (Sayre, PA)
(Lennon et al., 1996
), and was
re-cloned by BamHI and XhoI digest into pCS2+ to create
pCS2-caRac1G12V. Capped RNA was prepared with the Message Machine kit
(Ambion). RNA was dissolved in water, and 1 nl per embryo was injected at
indicated concentrations as described
(Hammerschmidt et al.,
1999
).
RT-PCR analyses
RT-PCR was carried out using the Titan One Tube RT-PCR kit (Roche, Basel,
Switzerland), according to the manufacturer's instructions. RNA was isolated
from dechorionated embryos using the UltraspecTM RNA isolation system
(Biotecx, Houston, USA), according to the manufacturer's instructions. The
sequence of the primers used were:
(GenBank Accession Number X77689),
5'-GGCCACGTCGACTCCGGAAAGTCC-3' and
5'-CTCAAAACGAGCCTGGCTGTAAGG-3';
RT-PCR reaction products after 20, 25, 30 and 35 cycles, were separated on
a 2% agarose gel and blotted on Hybond N+ membrane (Amersham Pharmacia
Biotech, UK). has1, has2 and ef1
DNA probes were
labeled with alkaline phosphatase by using AlkPhosDirect (Amersham), and
hybridization and detection were carried out according to the manufacturer's
instructions. has3 DNA probe was labeled with 32P by
random primed DNA synthesis.
Morpholino oligonucleotides
Morpholino oligonucleotides (MOs; Gene Tools) were dissolved in water to a
concentration of 4 mM. For injection (1 nl per embryo), MOs were diluted in
1xDanieu's buffer (Nasevicius and
Ekker, 2000
).
Sequences of MOs used were: has2 MO1 AGCAGCTCTTTGGAGATGTCCCGTT; control has2 4mm-MO AGCACCTCTATGGAGTTGTCGCGTT; has2 MO2 CGTTAGTTGAACAGGGATGCTGTCC. All MOs were injected at 0.25 mM.
In situ hybridization and immunohistochemistry
Whole-mount in situ hybridization and antibody counterstaining were carried
out as previously described (Hammerschmidt
et al., 1996
). For has2 in situ probe synthesis, plasmid
pBS-zfhas2 was linearized with XbaI and transcribed with T7 RNA
polymerase. In addition, riboprobes of the following cDNAs were used:
hgg1 (Thisse et al.,
1994
), krox20 (Oxtoby
and Jowett, 1993
), pax2.1
(Krauss et al., 1992
),
gata1 (Detrich et al.,
1995
), myoD (Weinberg
et al., 1996
), smbpc
(Xu et al., 2000
),
sox17 (Alexander and Stainier,
1999
), twist
(Morin-Kensicki and Eisen,
1997
) and vasa (Yoon
et al., 1997
). Whole-mount immunostaining with anti-Fibronectin
(Sigma, F3648, 1:200), and anti-Laminin and anti-pan Cadherin antibodies
(Crawford et al., 2003
), was
carried out using reported concentrations and protocols as described
(Hammerschmidt et al., 1996
).
15 µm sections of stained embryos were cut, using glass knifes, after
mounting in Technovit 8100 (Haraeus-Kulzer), according to the supplier's
instructions.
HA staining
Staining was performed essentially as described by Köprunner et al.
(Köprunner et al., 2000
),
with the following modifications. After sectioning, the partially (30%)
rehydrated specimens were refixed in 4% paraformaldehyde. The sections were
incubated for 3 hours at room temperature with a 1/10 dilution of serum free
medium of HEK293 cells expressing a neurocan-alkaline phosphatase fusion
protein (generous gift from Uwe Rauch, University of Lund) in 10 mM sodium
phosphate buffer (pH 7.0), 1.5 M NaCl, 0.08% BSA.
Uncaging experiments
Embryos were injected at the 1-cell stage with 0.25% caged fluorescein
dextran (10,000 MW; Molecular probes, Eugene, USA). Uncaging was carried out
at shield stage using a Zeiss Axiophot Microscope equipped with a UV light
source, adjustable pinhole and a 40x objective. Pictures were taken at
80% epiboly and tailbud stage, and the angle for dorsal convergence or the
length of extension was measured using NIH image software.
Cell transplantations
To visualize cell shape and cellular processes in wild-type, has2
mRNA, has2 MO, caRac mRNA, dnRac1 mRNA or
double-injected embryos, donor embryos were injected with mRNA encoding
membrane-localized GFP (Moriyoshi et al.,
1996
). At the shield stage, 5-10 lateral or dorsal marginal donor
cells were transplanted into the same region of the same type of recipient
embryo (lateral wild-type®lateral wild-type; lateral has2
MO®lateral has2 MO; dorsal has2 mRNA®dorsal
has2 mRNA, and so on). To show that has2 and Rac1
act in a cell autonomous manner, heterologous transplantation of labeled
wild-type cells into has2 MO or dnRac1 mRNA-injected
recipients, or transplantation of labeled has2 MO or dnRac1
mRNA-injected cells into wild-type recipients were performed. Chimeric embryos
were mounted in 1% methylcellulose between bridged coverslips, and photos were
taken immediately after the transplantation (shield stage) and at the 80-90%
epiboly stage, using a Hamamatsu digital camera (C4742-95) and Openlab
software (Improvision).
| Results |
|---|
|
|
|---|
|
In contrast to zebrafish has2, no has1 or has3
transcripts could be detected during early developmental stages
(Fig. 1B). Expression of both
genes is initiated in 2-day-old larvae, and continues in adult tissues,
corresponding with the expression profile reported for the human and mouse
class 3 genes (Spicer and McDonald,
1998
).
The spatial expression pattern of has2 was determined using whole-mount in situ hybridization. At blastula stages, has2 transcripts are ubiquitously distributed throughout the zebrafish embryo (data not shown). Starting with the onset of gastrulation, a restricted expression pattern can be observed. At the shield stage, has2 transcripts are confined to the presumptive mesendoderm in the entire marginal zone of the embryo, with the exception of the dorsal shield (Fig. 1C). During gastrulation has2 is expressed in cells of the ventrolateral mesoderm and endoderm, whereas cells of the axial mesendoderm lack has2 transcripts (Fig. 1D,E). Towards the end of gastrulation, has2 expression becomes progressively stronger in paraxial regions of the mesoderm (Fig. 1F), whereas during segmentation stages it is predominantly expressed in adaxial cells of the head (Fig. 1G,H), the sclerotome of formed somites (Fig. 1G,I) and adaxial cells of the presomitic mesoderm (Fig. 1G,J). The trunk and tail adaxial cells will give rise to slow muscle cells (see below).
The has2 expression pattern anticipates the distribution of HA in the embryo
Has2 catalyses the synthesis of HA, which is supposed to be secreted into
the extracellular space. To determine the distribution of HA in zebrafish
embryos, sections of late gastrula and early segmentation embryos were stained
with the Hyaluronan-binding protein Neurocan, coupled to alkaline phosphatase
(Rauch et al., 1992
;
Köprunner et al., 2000
).
Although at late gastrula stages, HA levels were too low to be detected (data
not shown), the HA distribution in 10-somite stage embryos perfectly reflects
the expression pattern of has2, with high HA levels in the somites
and the presomitic mesoderm, whereas neural tube and notochord are devoid of
HA (Fig. 2A).
|
|
|
Has2 is required for dorsal convergence, but not for extension
In order to directly study the effect of Has2 on convergent extension
movements, lateral marginal (mesoderm and endoderm) cells located 90° from
the dorsal shield were labeled by un-caging a fluorescent dye at the onset of
gastrulation (6 hpf), and movement of labeled cells was followed until
gastrulation was completed (10.5 hpf), as previously described
(Sepich et al., 2000
;
Topczewski et al., 2001
).
has2 morphant embryos display a severely reduced movement of labeled
lateral cells towards the dorsal axis (Fig.
4D-F; see Fig. 4J
for graph; distance from dorsal axis at 10.5 hpf: wild type 20±9°,
has2 MO 63±9°; P=1x1010).
Co-injection of has2 MO together with low amounts (25 ng/µl) of
has2 mRNA, which does not contain the sequence targeted by the MOs,
results in a complete rescue of dorsal convergence and morphology of lateral
cells (Fig. 4J; distance from
dorsal axis at 10.5 hpf: 23±7°, P=0.5; and data not
shown), indicating that the effects are specific.
|
|
A role to induce lamellipodia formation in metastatic tumor cells has also
been described for the small GTPase Rac1 (reviewed by
Hall, 1998
), a component of
the HA signal transduction pathway downstream of the HA receptor CD44
(Oliferenko et al., 2000
). In
order to investigate whether Rac1 might also be involved in driving cell
migrations of converging lateral cells during zebrafish gastrulation, we
injected embryos with mRNA encoding a dominant-negative version of human RAC1.
Indeed, in injected embryos labeled lateral cells are roundish, lack
lamellipodia (n=0.3±0.63; from 29 cells in 3 embryos)
(Fig. 5C), and fail to converge
dorsally as in has2 morphant embryos (data not shown).
Has2 and Rac1 act in a cell autonomous fashion
In metastatic cancer cells, migration-stimulating signaling by HA and
secreted proteoglycans is supposed to occur in an autocrine, cell autonomous
fashion (Kosaki et al., 1999
;
Rauvala et al., 2000
). To
study whether the effect of Has2 on lamellipodia formation in lateral cells
during zebrafish gastrulation is cell autonomous or non-cell autonomous,
has2 morphant cells labeled with membrane-localized GFP were
transplanted into the lateral margin of wild-type recipients. Despite the
wild-type environment, such has2 morphant cells failed to form
lamellipodia (n=0.5±0.62; from 32 cells in 3 embryos)
(Fig. 5F). By contrast, labeled
wild-type cells transplanted into the lateral margin of has2 morphant
recipients formed lamellipodia in normal numbers (n=4.3±0.82;
from 24 cells in 3 embryos) (Fig.
5E). The same cell-autonomous effect was also observed for Rac1.
dnRac1-expressing cells transplanted into a wild-type environment
lack lamellipodia (n=0.3±0.57; from 32 cells in 3 embryos)
(Fig. 5H), whereas wild-type
cells transplanted into a host expressing dnRac1 display normal
lamellipodia formation (n=4.0±1.0; from 18 cells in 2 embryos)
(Fig. 5G).
Together, the data show that both Has2 and Rac1 affect lamellipodia formation in lateral cells in a cell autonomous fashion. This suggests that HA, the likely product of Has2 activity, does not have to be secreted far to govern cell migration. Rather, it appears to be involved in some kind of autocrine self-stimulation of migrating cells (see also Discussion).
Ectopic dorsal Has2 and constitutively active Rac1 induce supernumerary lamellipodia, blocking extension movements within the axis
In contrast to dorsal convergence, extension of the embryonic axis is
largely driven by other cell movements, such as mediolateral cell-cell
intercalation, rather than by directed cell migration
(Myers et al., 2002b
;
Wallingford et al., 2002
). As
the axial mesoderm is devoid of has2 transcripts (see
Fig. 1D), we injected
has2 mRNA into zebrafish eggs to investigate the effect of ectopic
has2 expression on the dorsal side of gastrulating embryos. Embryos
injected with threefold higher amounts of has2 mRNA (75 ng/µl)
than used for the rescue experiments (see above;
Fig. 3) form a shortened body
axis and display partial cyclopia (data not shown), similar to the phenotype
of wnt11/silberblick mutants, which are characterized by impaired
extension of axial tissue (Heisenberg et
al., 2000
).
Labeling cells in the shield of has2 mRNA-injected embryos and following their behavior during gastrulation revealed a strongly reduced extension of the axial mesoderm (Fig. 6E,F), compared with wild-type siblings (Fig. 6A,B; see Fig. 6Q for graph; dorsal extension: wild type 780±36 µm, has2 RNA 321±74 µm; P=108). Whereas wild-type cells acquire an elongated bipolar shape, forming single lamellipodia along the mediolateral axis (Fig. 6C,D), axial cells of has2 mRNA-injected embryos display no apparent mediolateral polarization (Fig. 6G). They form many lamellipodia that can point in any direction (wild type: n=0.9±0.9, from 14 cells in 2 embryos; has2 RNA: n=4.0±1.13, from 27 cells in 6 embryos; P=0.0005; Fig. 6H). Within one cell, the lamellipodia occupy a large portion of the cell surface, similar to the arrangement observed in migrating lateral cells (compare Fig. 5A with Fig. 6H). Thus, has2-expressing axial cells display the characteristics of cells undergoing active migration, rather than mediolateral cell-cell intercalation.
In agreement with our observation that loss of Has2 and loss of Rac1 function cause similar migratory defects in lateral cells, we also observed very similar effects of has2 mRNA and mRNA encoding a constitutively active version of human RAC1 (caRac1) in axial cells. Like has2 mRNA-injected embryos, embryos injected with caRac1 mRNA (10 ng/µl) display the formation of supernumerary lamellipodia in axial cells (n=5.1±0.86, from 12 cells in 2 embryos; Fig. 6P), and show a severe reduction in axis extension (Fig. 6M,N; see Fig. 6Q for graph; dorsal extension: 316±67 µm, P=104). In summary, the data suggest that Has2 and Rac1 promote dorsal convergence in lateral regions of the embryo, while they can block extension of the axis.
Has2 function can be substituted by constitutively active, and blocked by dominant-negative Rac1
To test whether Rac1 acts downstream of Has2 in a linear HA signal
transduction pathway, we carried out epistasis analyses, co-injecting either
has2 MOs with mRNA encoding constitutively active Rac1
(caRac1), or has2 mRNA with mRNA encoding dominant-negative
Rac1 (dnRac1). Indeed, we found that small amounts (2 ng/µl) of
co-injected caRac1 mRNA or larger amounts (25 ng/µl) of wild-type
Rac1 mRNA lead to a perfect rescue of has2 morphant embryos,
which show normal lamellipodia formation in lateral cells (has2 MO +
caRac1 RNA n=4.7±1.4, from 15 cells in 4 embryos;
P=0.2; Fig. 5D), and
normal convergence and extension movements
(Fig. 4G-J). Such rescued
embryos lack HA like regular has2 morphants do
(Fig. 2C), suggesting that HA
is dispensable for dorsal convergence when Rac1 is active. Furthermore, dnRac1
blocked the formation of supernumerary lamellipodia caused by ectopic
has2 mRNA (has2 RNA + dnRac1 RNA:
n=0.04±0.21, from 22 cells in 2 embryos)
(Fig. 6R,S). Together, these
data strongly suggest that Has2 promotes lamellipodia formation and cell
migration by activating the small GTPase Rac1. Biochemical studies and
analyses of potential HA receptors will be necessary to investigate whether
this effect of HA is direct, or mediated through other components of the ECM
(see Discussion).
Has2 is required for proper migration of presumptive slow muscle cells, sclerotomal cells and primordial germ cells
To study the general relevance of cell migration regulation by HA, we
investigated whether Has2 is also required during other developmental
processes involving cell migration. After gastrulation, has2
expression is maintained and/or upregulated in adaxial and sclerotomal cells
of the somites (see Fig. 1).
The adaxial cells display a very striking migratory behavior. After somite
regionalization into a dorsal and a ventral half, they leave their adaxial
locations and migrate to the lateral walls of the somites, where they become
slow muscle cells (Devoto et al.,
1996
; Stickney et al.,
2000
). During this migration, different routes can be taken,
either along the horizontal myoseptum, or through the presumptive fast muscle
tissue, the major component of the somites. A similar directional migration
has been reported for sclerotomal cells. Initially located in ventromedial
positions of the somites, they migrate dorsally into adaxial regions
(Morin-Kensicki and Eisen,
1997
; Stickney et al.,
2000
), eventually surrounding the entire neural tube to form the
vertebral column (Morin-Kensicki et al.,
2002
).
To study whether Has2 is involved in these migratory processes, weakly
affected has2 morphant embryos that had survived early segmentation
stages were stained for smbpc mRNA, a marker for specified
postmigratory slow muscle cells (Xu et
al., 2000
), or for twist mRNA, a marker for premigratory
and migrating sclerotomal cells
(Morin-Kensicki and Eisen,
1997
; Stickney et al.,
2000
). Whereas in control embryos
(Fig. 7A,C),
smbpc-positive cells are located in the lateral walls of the somites,
smbpc-positive cells of has2 morphants are largely confined
to adaxial regions and the horizontal myoseptum, with a few isolated cells
stuck within the presumptive fast muscle tissue
(Fig. 7B,D). Similarly,
sclerotomal cells of has2 morphant embryos fail to migrate dorsally
as in control embryos (Fig.
7E), but remain in ventrolateral positions of the somites
(Fig. 7F). Together, these data
suggest that expression of has2 in adaxial and sclerotomal cells is
essential for their migration during somite reorganization. However,
has2 does not appear to be required for the specification of cells.
Thus, despite their failed migration, adaxial cells acquire slow muscle
characteristics in ectopic locations.
|
Together, these data show that in addition to dorsal convergence during gastrulation, has2 is required for proper migration of several mesodermal cell types during later steps of zebrafish development.
| Discussion |
|---|
|
|
|---|
Has2 helps to dissect the cellular events driving convergence and extension independent of cell fate determination
According to current understanding, convergent extension (CE) movements of
gastrulating zebrafish embryos involve different cellular events, depending on
the position of cells along the dorsoventral axis
(Myers et al., 2002b
;
Wallingford et al., 2002
).
Convergence of lateral cells towards the dorsal shield is regarded as an
active migration of individual or small groups of cells along a
chemoattractant gradient. This view is largely based on microscopic
observations, revealing that ventral and lateral mesodermal cells at the onset
of gastrulation meander without much directionality, whereas their movement
becomes faster and more directed when they get closer to the shield during
gastrulation (Myers et al.,
2002a
; Jessen et al.,
2002
; Trinkaus,
1998
). Dorsally, cells not only pile up on each other, leading to
a thickening of the axis, but also undergo mediolateral intercalations,
leading to axis extension. Dorsal migration of lateral cells and mediolateral
intercalation of dorsal cells might involve both shared and distinct cellular
events. Thus, dorsal convergence appears to require migration of cells on the
extracellular matrix, while mediolateral intercalation might involve a tight
control of cell-cell adhesion, and a migration of cells on the surface of
neighboring cells as substrate. Another specific driving force of extension
appears to be the active anteriorwards migration of cells at the anterior edge
of the mesendoderm, also called the polster or prechordal plate
(Winklbauer and Nagel, 1991
;
Winklbauer and Selchow, 1992
;
Yamashita et al., 2002
).
Genetic evidence for such different cellular mechanisms underlying dorsal
convergence and axis extension had been rather limited thus far. Impaired
convergence with normal or even enhanced extension had only been described for
mutants lacking Bmp signaling (Myers et
al., 2002a
) or the T-box transcription factor Spadetail
(Griffin et al., 1998
).
However, such mutants, in addition to CE morphogenesis, also have dramatic
defects in differential dorsoventral cell fate specification
(Hammerschmidt and Mullins,
2002
; Solnica-Krezel and
Cooper, 2002
). This is not the case for has2, which is
required for CE morphogenesis only, but not for dorsoventral patterning.
has2 morphants also differ from all previously described mutants
and morphants with defective CE, but normal dorsoventral patterning. Such
embryos show either defects in extension only
(Glickman et al., 2003
), or a
combined reduction of both convergence and extension, making it difficult to
dissect the two processes. The combination of convergence and extension
defects could have different reasons. In morphant embryos deficient in Stat3,
a transcription factor mediating cytokine signaling, convergence defects seem
to be a secondary consequence of the impaired anterior migration of the
anterior dorsal mesendoderm (Yamashita et
al., 2002
), whereas in silberblick, knypek and
trilobite mutants, and in dnrok2-injected embryos lacking
the non-canonical Wnt signal Wnt11 or its interacting partners Glypican6,
Strabismus, or RhoA-associated kinase, respectively, cellular processes shared
by dorsal migration and extension seem to be affected, such as the general
establishment of cell polarity (Heisenberg
et al., 2000
; Jessen et al.,
2002
; Topczewski et al.,
2001
; Marlow et al.,
2002
). In contrast to such genes, has2 appears to be
required for dorsal convergence only, while it has a negative effect on
cellular processes specifically involved in axis extension. Thus, forced
has2 expression in axial cells appears to transform them from
intercalating to migratory cells similar to converging lateral cells. They
form multiple lamellipodia and move. However, in contrast to lateral cells,
their movement appears random, rather than directed (J.B. and M.H.,
unpublished), suggesting that guiding cues are only present laterally, and are
missing in the axis.
In summary, our data provide evidence that during gastrulation, directed dorsal migration of cells in lateral regions and axis extension on the dorsal side are rather independent of each other. has2 seems to be selectively required for cellular events underlying dorsal convergence, such as for the aforementioned migration of cells on the ECM, whereas axis extension appears to be achieved by different means, independently of has2 (see above).
Despite the normal or even elevated extension during gastrula stages, has2 morphants later become significantly shorter than their siblings. This, however, does not necessarily mean that later extension processes require Has2. Clearly, the dorsal mesoderm itself extends normally, as indicated by the undulation of the notochord. Thus, the reduced length of the embryos during segmentation stages is more likely to be a secondary consequence of the block of convergence, indicating that later anteroposterior growth of the dorsal axis heavily depends on the immigration of cells from lateral regions. In this respect, convergence and extension are linked in the sense that convergence supplies the dorsal side with cells required to build up the embryo.
Mechanism of HA function during zebrafish gastrulation
Different modes of HA function have been suggested. In all cases, HA is
supposed to be extruded into the extracellular space directly after its
Has-catalyzed synthesis at the cytoplasmic side of the plasma membrane. Thus,
even intracellular HA binding proteins (IHABPs), such as cytoplasmic versions
of the receptor RHAMM, are supposed to bind HA after it has re-entered the
cells by endocytosis (reviewed by Lee and
Spicer, 2000
). After its secretion into the extracellular space,
HA could act to govern cell migrations in several ways. First, HA might
function as a space filling substrate, on which cells are able to move. In
addition, HA might influence the arrangement of other components of the ECM,
such as fibronectins, ligands of integrins that have been reported to regulate
Cadherin-dependent cell adhesion and convergent extension movements during
Xenopus gastrulation (Mardsen and
DeSimone, 2003
). In this case, our observed effect of
has2 during zebrafish development would be very indirect.
Alternatively, HA could act by direct signaling to migrating cells, mediated
by specific HA receptors such as CD44 and RHAMM. Such signaling can activate
different signal transduction pathways, involving transcription factors such
as Myc, Erk1 and NF
b, and various Rho GTPases, which have distinct
effects on the cytoskeleton (reviewed by
Lee and Spicer, 2000
;
Ridley, 2001
;
Turley et al., 2002
). Although
RhoA is supposed to promote the formation of cytoplasmic fibers, influencing
overall cell polarity and inducing cell body contractions, Rac1 has been
reported to have more local effects, promoting the formation and outgrowth of
lamellipodia (reviewed by Hall et al., 1998;
Ridley, 2001
).
The data obtained in our Has2 loss- and gain-of-function studies
strongly suggest that the migration of converging lateral cells during
zebrafish gastrulation is governed by a Has2-HA-Rac1 pathway. As all of our
experiments were carried out with Has2, rather than with HA, we cannot rule
out the possibility that the observed effects are due to an HA-independent,
parallel function of Has2. However, no additional roles of Has proteins have
been reported, except their ability to catalyze the synthesis of chitins,
HA-related oligosaccharides consisting of N-acetyl-glucosamine units
only. To specify which activity of Has2 is required during zebrafish
gastrulation, we carried out experiments with a mutant version of Has2,
carrying a single amino acid residue exchange in the glucuronic acid binding
pocket. This mutation has been shown to specifically block the
HA-synthesizing, but not the chitin-synthesizing activity of Has proteins
(Yoshida et al., 2000
). The
corresponding mutant version of zebrafish Has2 failed to rescue the
has2-morphant phenotype (J.B. and M.H., unpublished), indicating that
it is indeed the HA-synthesizing activity of Has2 that is required to drive
dorsal convergence in zebrafish embryos. Consistent with this notion, we found
that the loss of has2 function leads to highly reduced HA levels in
morphant embryos, according to the reported 96% reduction in HA content in
Has2 mutant mice (Camenisch et
al., 2000
). By contrast, content and distribution of other ECM
components, such as Fibronectin and Cadherins, were unaltered. In addition, we
have evidence that Has2 acts by activating the Rho GTPase Rac1, which is in
agreement with data obtained for HA in cell culture systems, showing that
local application of HA induces strong activation of Rac1, local lamellipodia
formation and cell migrations (Oliferenko
et al., 2000
; Bourguignon et
al., 2000
). In zebrafish embryos, loss and gain of function of
Rac1 has the same effects on lamellopodia formation as loss and gain of
function of Has2. Co-injection experiments combining Has2 loss of function
with Rac1 gain of function, and vice versa, further show that Rac1 is
epistatic to Has2, suggesting that Rac1 acts downstream of, rather than in
parallel to, Has2. Together with the aforementioned data obtained in tissue
culture, our results strongly suggest that dorsal migration of converging
lateral cells in zebrafish embryos is regulated by HA through activation of
Rac1.
We do not know as yet how the activation of Rac1 by HA is achieved.
Clearly, Rac1 can be activated by many different transmembrane
receptors with different ligand specificities (reviewed by
Ridley, 2001
). However, as we
failed to detect any changes in the composition of the ECM of has2
morphants, except the loss of HA, we favor a model according to which the
effect of HA on Rac1 activation and cell migration is quite direct, mediated
by binding to HA transmembrane receptors such as CD44.
HA appears to act as an autocrine signal
In all studied systems, no activation of Rac1 independent of extracellular
signaling has been reported (reviewed by
Ridley, 2001
). This is
important for the interpretation of our finding that Has2 like Rac1
acts in a cell autonomous fashion. Given the epistatic relationship of
Has2 and Rac1 (see above), we conclude that HA acts as an autocrine or
extracellular signal with an extremely short-range effect, rather than as a
cytoplasmic trigger. Such an autocrine effect would allow a differential
cellular regulation of migratory behavior within tissues, because
has2-positive cells would only activate themselves, not neighboring
cells. This appears particularly important when certain cell types invade or
pass tissues of stationary cells. One example are the has2-positive
presumptive slow muscle cells, which on their way to the lateral walls of the
somites migrate through the has2-negative tissue of presumptive fast
muscle (Fig. 7).
The cell autonomous fashion of Has2 action also indicates that the broadly discussed role of HA to fill the extracellular space is not relevant for cell migrations during zebrafish gastrulation. This notion is further supported by our finding that Rac1 can rescue the migratory defects of has2 morphant embryos in the absence of detectable levels of HA. In summary, the data suggest that HA has not a structural but an instructive function. Rather than preparing the extracellular space as a substrate for migrating cells, it appears to induce cells to migrate.
Parallels between HA function in embryogenesis and tumor invasion
Most of the previous studies concerning the roles of HA and HA signaling
pathways had been carried out with tumor cells lines. There are many lines of
in vitro and in vivo evidence that HA signaling plays a crucial role in
governing the metastatic potential of malignant tumor cells, transmitted via
the HA receptors CD44 and RHAMM, and with Rac1 as one of the intracellular
effectors (Lee and Spicer,
2000
; Toole, 2001
;
Turley et al., 2002
).
Our findings that both Has2 and Rac1 are required in a linear pathway to
govern lamellipodia formation and active cell migration during zebrafish
gastrulation suggests that the same HA signaling pathway might be used to
drive cell migrations during both normal development and tumor invasion. In
support of this notion, HA-regulated embryonic and tumor cells are similar in
several other respects. As reported here for migrating lateral cells in the
zebrafish gastrula, Has2 protein appears to promote metastasis of tumor cells
in a cell autonomous fashion. Thus, in vivo tumorigenicity of cells is
enhanced after cell transfection with Has2
(Kosaki et al., 1999
),
indicating that Has2 and HA are required as an autostimulus in migrating cells
themselves. Similar autocrine effects promoting tumor invasion have also been
described for other secreted proteoglycans (see
Rauvala et al., 2000
). In
addition, Has2-dependent migrating cells in zebrafish embryos share
morphological similarities with metastatic tumor cells. In contrast to
Has2-independent migrating embryonic cell types, such as cells at the leading
edge of the hypoblast during involution, all Has2-dependent cells migrate as
small groups of cells or individual cells. In particular the Has2-dependent
migration of adaxial cells through the somites
(Devoto et al., 1996
;
Stickney et al., 2000
) is very
reminiscent of tissue invasion by metastatic cancer cells. If the mechanisms
of the HA-dependent migration of Has2-expressing cells during zebrafish
embryogenesis can indeed be compared with tumor invasion, a systematic search
for additional genes involved in these processes in zebrafish might be helpful
to shed further light onto the mechanisms of metastasis.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Alexander, J. and Stainier, D. Y. (1999). A
molecular pathway leading to endoderm formation in zebrafish. Curr.
Biol. 9,1147
-1157.[CrossRef][Medline]
Bourguignon, L. Y. W., Zhu, H., Shao, L., Zhu, D. and Chen, Y.
W. (2000). CD44 interaction with Tiam1 promotes Rac1
signaling and hyaluronic acid-mediated breast tumor cell migration.
J. Biol. Chem. 275,1829
-1838.
Camenisch, T. D., Spicer, A. P., Brehm-Gibson, T., Biesterfeldt,
J., Augustine, M. L., Calabro, A., Kubalak, S., Klewer, S. E. and
McDonald, J. A. (2000). Disruption of hyaluronan synthase-2
abrogates normal cardiac morphogenesis and hyaluronan-mediated transformation
of epithelium to mesenchyme. J. Clin. Invest.
106,349
-360.[Medline]
Crawford, B. D., Henry, C. A., Clason, T. A., Becker, A. L. and
Hille, M. B. (2003). Activity and distribution of
Paxillin, Focal adhesion kinase, and Cadherin indicate cooperative roles
during zebrafish morphogenesis. Mol. Biol. Cell
14,3065
-3081.
DeAngelis, P. L. (1999). Hyaluronan synthases:
fascinating glycosyltransferases from vertebrates, bacterial pathogens, and
algal viruses, Cell. Mol. Life Sci.
56,670
-682.[CrossRef][Medline]
Detrich, H. W., Kieran, M. W., Chan, F. Y., Barone, L. M., Yee,
K., Rundstadler, J. A. and Zon, L. I. (1995).
Intra-embryonic hematopoietic cell migration during vertebrate development.
Proc. Natl. Acad. Sci. USA
92,10713
-10717.
Devoto, S. H., Melancon, E., Eisen, J. S. and Westerfield,
M. (1996). Identification of separate slow and fast muscle
precursor cells in vivo, prior to somite formation.
Development 122,3371
-3380.[Abstract]
Glickman, N. S., Kimmel, C. B., Jones, M. A. and Adams, R.
J. (2003). Shaping the zebrafish notochord.
Development 130,873
-887.
Griffin, K. J., Amacher, S. L., Kimmel, C. B. and Kimelman,
D. (1998). Molecular identification of spadetail: regulation
of zebrafish trunk and tail mesoderm formation by T-box genes.
Development 125,3379
-3388.[Abstract]
Hall, A. (1998). Rho GTPases and the actin
cytoskeleton. Science
279,509
-514.
Hall, C. L., Yang, B., Yang, X., Zhang, S., Turley, M., Samuel,
S., Lange, L. A., Wang, C., Curpen, G. D., Savani, R. C. et al.
(1995). Overexpression of the hyaluronan receptor RHAMM is
transforming and also required for H-ras transformation.
Cell 82,19
-28.[CrossRef][Medline]
Hammerschmidt, M., Pelegri, F., Mullins, M. C., Kane, D. A.,
Brand, M., van Eeden, F. J. M., Furutani-Seiki, M., Granato, M., Haffter, P.,
Heisenberg, C.-P. et al. (1996). Mutations affecting
morphogenesis during gastrulation and tail formation in the zebrafish,
Danio rerio. Development
123,143
-151.[Abstract]
Hammerschmidt, M., Blader, P. and Strähle, U.
(1999). Strategies to perturb zebrafish development.
Methods Cell Biol. 59,87
-115.[Medline]
Hammerschmidt, M. and Mullins, M. (2002).
Dorsoventral patterning in the zebrafish: Bone morphogenetic proteins and
beyond. In Results and Problems in Cell Differentiation: Pattern
formation in Zebrafish, Vol. 40 (ed. L.
Solnica-Krezel), pp. 72-95. Berlin:
Springer-Verlag.
Heisenberg, C.-P., Tada, M., Rauch, G.-J., Saude, L., Concha, M.
L., Geisler, R., Stemple, D. L., Smith, J. C. and Wilson, S. W.
(2000). Silberblick/Wnt11 mediates convergent extension movements
during zebrafish gastrulation. Nature
405, 76-81.[CrossRef][Medline]
Jessen, J. R., Topczewski, J., Bingham, S., Sepich, D. S.,
Marlow, F., Chandrasekhar, A. and Solnica-Krezel, L.
(2002). Zebrafish trilobite identifies new roles for Strabismus
in gastrulation and neuronal movements. Nat. Cell
Biol. 4,610
-615.[Medline]
Kimmel, C. B., Warga, R. M. and Schilling, T. F.
(1990). Origin and organization of the zebrafish fate map.
Development 108,581
-594.
Köprunner, M., Müllegger, J. and Lepperdinger, G.
(2000). Synthesis of hyaluronan of distinctly different chain
length is regulated by differential expression of Xhas1 and 2 during early
development of Xenopus laevis. Mech. Dev.
90,275
-278.[CrossRef][Medline]
Kosaki, R., Watanabe, K. and Yamaguchi, Y.
(1999). Overproduction of hyaluronan by expression of the
hyaluronan synthase has2 enhances anchorage-independent growth and
tumorigenicity. Cancer Res.
59,1141
-1145.
Krauss, S., Maden, M., Holder, N. and Wilson, S. W.
(1992). Zebrafish Pax(b) is involved in the formation of
the midbrain-hindbrain boundary. Nature
360, 87-89.[CrossRef][Medline]
Lee, J. Y. and Spicer, A. P. (2000).
Hyaluronan: a multifunctional, megaDalton, stealth molecule. Curr.
Opin. Cell Biol. 12,581
-586.[CrossRef][Medline]
Lennon, G., Auffray, C., Polymeropoulos, M. and Soares, M.
B. (1996). The I.M.A.G.E. Consortium: an integrated molecular
analysis of genomes and their expression. Genomics
33,151
-152.[CrossRef][Medline]
Mardsen, M. and DeSimone, D. W. (2003).
Integrin-ECM interactions regulate cadherin-dependent cell adhesion and are
required for convergent extension in Xenopus. Curr.
Biol. 13,1182
-1191.[CrossRef][Medline]
Marlow, F., Topczewski, J., Sepich, D. S. and Solnica-Krezel,
L. (2002). Zebrafish Rho Kinase 2 acts downstream of Wnt11 to
mediate cell polarity and effective convergence and extension movements.
Curr. Biol. 12,876
-884.[CrossRef][Medline]
Morin-Kensicki, E. M. and Eisen, J. S. (1997).
Sclerotome development and peripheral nervous system segmentation in embryonic
zebrafish. Development
124,159
-167.[Abstract]
Morin-Kensicki, E. M., Melancon, E. and Eisen, J. S.
(2002). Segmental relationship between somites and vertebral
column in zebrafish. Development
129,3851
-3860.
Moriyoshi, K., Richards, L. J., Akazawa, C. and O'Leary, D.
D. (1996). Labeling neural cells using adenoviral gene
transfer of membrane-targeted GFP. Neuron
16,255
-260.[CrossRef][Medline]
Mullins, M. C., Hammerschmidt, M., Kane, D. A., Odenthal, J.,
Brand, M., Eeden van, F. J. M., Furutani-Seiki, M., Granato, M.,
Haffter, P., Heisenberg, C.-P. et al. (1996). Genes
establishing dorsoventral pattern formation in the zebrafish embryo: the
ventral specifying genes. Development
123, 81-93.[Abstract]
Myers, D., Sepich, D. S. and Solnica-Krezel, L.
(2002a). BMP activity gradient regulates convergence and
extension movements during zebrafish gastrulation. Dev.
Biol. 243,81
-98.[CrossRef][Medline]
Myers, D. C., Sepich, D. S. and Solnica-Krezel, L.
(2002b). Convergence and extension in vertebrate gastrulae: cell
movements according to or in search of identity. Trends
Genet. 18,447
-455.[CrossRef][Medline]
Nasevicius, A. and Ekker, S. C. (2000).
Effective targeted gene `knockdown' in zebrafish. Nat.
Genet. 26,216
-220.[CrossRef][Medline]
Oliferenko, S., Kaverina, I., Small, J. V. and Huber, L. A.
(2000). Hyaluronic acid (HA) binding to CD44 activates Rac1 and
induces lamellipodia outgrowth. J. Cell Biol.
148,1159
-1164.
Oxtoby, E. and Jowett, T. (1993). Cloning of
the zebrafish Krox-20 (Krx-20) and its expression during hindbrain
development. Nucl. Acids Res.
21,1087
-1095.
Park, M. and Moon, R. T. (2001). The planar
cell-polarity gene stbm regulates cell behaviour and cell fate in
vertebrate embryos. Nat. Cell Biol.
4, 20-25.
Peterson, R. M., Yu, Q., Stamenkovic, I. and Toole, B. P.
(2000). Perturbation of hyaluronan by soluble CD44 inhibits
growth of murine mammary ascites cells in ascites. Am. J.
Pathol. 156,2159
-2167.
Rauch, G.-J., Hammerschmidt, M., Blader, P., Schauerte, H. E.,
Strähle, U., Ingham, P. W., McMahon, A. P. and Haffter, P.
(1997). Wnt5 is required for tail formation in the zebrafish
embryo. CSH Symp. Quant. Biol.
62,227
-233.
Rauch, U., Karthikeyan, L., Maurel, P., Margolis, R. U. and
Margolis, R. K. (1992). Cloning and primary structure
of neurocan, a developmentally regulated, aggregating chondroitin sulfate
proteoglycan of brain. J. Biol. Chem.
267,19536
-19547.
Rauvala, H., Huttunen, H. J., Fages, C., Kaksonen, M., Kinnunen,
T., Imai, S., Raulo, E. and Kilpeläinen, I.
(2000). Heparin-binding proteins HB-GAM (pleiotropin) and
amphoterin in the regulation of cell motility. Matrix
Biol. 19,377
-387.[CrossRef][Medline]
Raz, E. and Hopkins, N. (2002). Primordial
gem-cell development in zebrafish. In Results and Problems in Cell
Differentiation: Pattern formation in Zebrafish, Vol.40
(ed. L. Solnica-Krezel), pp166
-179. Berlin: Springer-Verlag.
Ridley, A. J. (2001). Rho GTPases and cell
migration. J. Cell Sci.
114,2713
-2722.
Rosa, F., Sargent, T. D., Rebbert, M. L., Michaels, G. S.,
Jamrich, M., Grunz, H., Jonas, E., Winkles, J. A. and Dawid, I. B.
(1988). Accumulation and decay of DG42 gene products follow a
gradient pattern during Xenopus development. Dev.
Biol. 129,114
-123.[CrossRef][Medline]
Semino, C. E., Specht, C., Raimondi, A. and Robbins, P. W.
(1996). Homologs of the Xenopus developmental gene DG42
are present in zebrafish and mouse and are involved in the synthesis of
nod-like chitin oligosaccharides during early embryogenesis. Proc.
Natl. Acad. Sci. USA 93,4548
-4553.
Sepich, D. S., Myers D. C., Short, R., Topczewski, J., Marlow,
F. and Solnica-Krezel, L. (2000). Role of the
zebrafish trilobite locus in gastrulation movements of convergence
and extension. Genesis
27,159
-173.[CrossRef][Medline]
Solnica-Krezel, L., Stemple, D. L., Mountcastle-Shah, E.,
Rangini, Z., Neuhauss, S. C. F., Malicki, J., Schier, A., Stanier, D.
Y. R., Zwartkruis, F., Abdelilah, S. and Driever, W. (1996).
Mutations affecting cell fates and cellular rearrangements during gastrulation
in the zebrafish. Development
123, 67-80.[Abstract]
Solnica-Krezel, L. and Cooper, M. S. (2002).
Cellular and genetic mechanisms of convergence and extension. InResults and Problems in Cell Differentiation: Pattern formation in
Zebrafish
, Vol. 40 (ed. L. Solnica-Krezel), pp.136
-165. Berlin: Springer-Verlag.
Spicer, A. P. and McDonald, J. A. (1998).
Characterization and molecular evolution of a vertebrate hyaluronan synthase
gene family. J. Biol. Chem.
273,1923
-1932.
Stickney, H. L., Barresi, M. J. F. and Devoto, S.
(2000). Somite development in zebrafish. Dev.
Dyn. 219,287
-303.[CrossRef][Medline]
Thisse, C., Thisse, B., Halpern, M. E. and Postlethwait, J.
H. (1994). goosecoid expression in neuroectoderm and
mesendoderm is disrupted in zebrafish cyclops gastrulas.
Dev. Biol. 164,420
-429.[CrossRef][Medline]
Toole, B. P. (2001). Hyaluronan in
morphogenesis. Semin. Cell. Dev. Biol.
12, 79-87.[CrossRef][Medline]
Topczewski, J., Sepich, D. S., Myers, D. C., Walker, C., Amores,
A., Lele, Z., Hammerschmidt, M., Postlethwait, J. and Solnica-Krezel,
L. (2001). The zebrafish glypican knypek controls
cell polarity during gastrulation movements of convergent extension.
Dev. Cell 1,251
-264.[CrossRef][Medline]
Trinkaus, J. P. (1998). Gradient in convergent
cell movement during Fundulus gastrulation. J. Exp.
Zool. 281,328
-335.[CrossRef][Medline]
Turley, E. A., Noble, P. W. and Bourguignon, L. Y.
(2002). Signaling properties of hyaluronan receptors.
J. Biol. Chem. 277,4589
-4592.
van Eeden, F. J., Granato, M., Schach, U., Brand, M.,
Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P.,
Jiang, Y. J., Kane, D. A. et al. (1996). Mutations affecting
somite formation and patterning in the zebrafish, Danio rerio.Development 123,153
-164.[Abstract]
Wallingford, J. B., Fraser, S. E. and Harland, R. M.
(2002). Convergent extension: the molecular control of polarized
cell movement during embryonic development. Dev. Cell
2, 695-706.[CrossRef][Medline]
Warga, R. M. and Kimmel, C. B. (1990). Cell
movements during epiboly and gastrulation in zebrafish.
Development 108,569
-580.
Webb, D. J., Parsons, J. T. and Horwitz, A. F.
(2002). Adhesion assembly, disassembly and turnover in migrating
cells over and over and over again. Nat. Cell.
Biol. 4,E97
-E100.[CrossRef][Medline]
Weinberg, E. S., Allende, L. M., Kelly, C. S., Abdelhamid, A.,
Murakami, T., Andermann, P., Doerre, O. G., Grunwald, D. J. and
Riggleman, B. (1996). Developmental regulation of zebrafish
myoD in wild-type, no tail and spadetail embryos.
Development 122,271
-280.[Abstract]
Winklbauer, R. and Nagel, M. (1991).
Directional mesoderm cell migration in the Xenopus gastrula.
Dev. Biol. 148,1
-17.[CrossRef][Medline]
Winklbauer, R. and Selchow, A. (1992). Motile
behaviour and protrusive activity of migratory mesoderm cells from
Xenopus gastrula. Dev. Biol.
150,335
-351.[CrossRef][Medline]
Xu, Y., He, J., Wang, X., Lim, T. M. and Gong, Z.
(2000). A synchronous activation of 10 muscle-specific protein
(MSP) genes during zebrafish somitogenesis. Dev. Dyn.
219,201
-215.[CrossRef][Medline]
Yamashita, S., Miyagi, C., Carmany-Rampey, A., Shimizu, T.,
Fujii, R., Schier, A. F. and Hirano, T. (2002). Stat3
controls cell movements during zebrafish gastrulation. Dev.
Cell 2,363
-375.[CrossRef][Medline]
Yoon, C., Kawakami, K. and Hopkins, N. (1997).
Zebrafish vasa homologue RNA is localized to the cleavage planes of
2- and 4-cell-stage embryos and is expressed in the primordial germ cells.
Development 124,3157
-3165.[Abstract]
Yoshida, M., Itano, N., Yamada, Y. and Kimato, K.
(2000). In vitro synthesis of hyaluronan by a single protein
derived from mouse HAS1 gene and characterization of amino acid residues
essential for activity. J. Biol. Chem.
275,497
-506.
Yu, Q. and Stamenkovic, I. (2000). Cell
surface-localized matrix metalloprotease-9 activates TGF-beta and promotes
tumor invasion and angiogenesis. Genes Dev.
14,163
-176.
Related articles in Development:
This article has been cited by other articles:
![]() |
D. C. Weiser, R. H. Row, and D. Kimelman Rho-regulated Myosin phosphatase establishes the level of protrusive activity required for cell movements during zebrafish gastrulation Development, July 15, 2009; 136(14): 2375 - 2384. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hammerschmidt and D. Wedlich Regulated adhesion as a driving force of gastrulation movements Development, November 15, 2008; 135(22): 3625 - 3641. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lemeer, C. Jopling, J. Gouw, S. Mohammed, A. J. R. Heck, M. Slijper, and J. den Hertog Comparative Phosphoproteomics of Zebrafish Fyn/Yes Morpholino Knockdown Embryos Mol. Cell. Proteomics, November 1, 2008; 7(11): 2176 - 2187. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. Matthews, L. Marchant, C. Carmona-Fontaine, S. Kuriyama, J. Larrain, M. R. Holt, M. Parsons, and R. Mayor Directional migration of neural crest cells in vivo is regulated by Syndecan-4/Rac1 and non-canonical Wnt signaling/RhoA Development, May 15, 2008; 135(10): 1771 - 1780. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Weiser, U. J. Pyati, and D. Kimelman Gravin regulates mesodermal cell behavior changes required for axis elongation during zebrafish gastrulation Genes & Dev., June 15, 2007; 21(12): 1559 - 1571. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Hamilton, S. F. Fard, F. F. Paiwand, C. Tolg, M. Veiseh, C. Wang, J. B. McCarthy, M. J. Bissell, J. Koropatnick, and E. A. Turley The Hyaluronan Receptors CD44 and Rhamm (CD168) Form Complexes with ERK1,2 That Sustain High Basal Motility in Breast Cancer Cells J. Biol. Chem., June 1, 2007; 282(22): 16667 - 16680. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kultti, K. Rilla, R. Tiihonen, A. P. Spicer, R. H. Tammi, and M. I. Tammi Hyaluronan Synthesis Induces Microvillus-like Cell Surface Protrusions J. Biol. Chem., June 9, 2006; 281(23): 15821 - 15828. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. C. Leskow, B. A. Holloway, H. Wang, M. C. Mullins, and M. G. Kazanietz The zebrafish homologue of mammalian chimerin Rac-GAPs is implicated in epiboly progression during development PNAS, April 4, 2006; 103(14): 5373 - 5378. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Vigetti, M. Ori, M. Viola, A. Genasetti, E. Karousou, M. Rizzi, F. Pallotti, I. Nardi, V. C. Hascall, G. De Luca, et al. Molecular Cloning and Characterization of UDP-glucose Dehydrogenase from the Amphibian Xenopus laevis and Its Involvement in Hyaluronan Synthesis J. Biol. Chem., March 24, 2006; 281(12): 8254 - 8263. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ori, M. Nardini, P. Casini, R. Perris, and I. Nardi XHas2 activity is required during somitogenesis and precursor cell migration in Xenopus development Development, February 15, 2006; 133(4): 631 - 640. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Moussian, E. Tang, A. Tonning, S. Helms, H. Schwarz, C. Nusslein-Volhard, and A. E. Uv Drosophila Knickkopf and Retroactive are needed for epithelial tube growth and cuticle differentiation through their specific requirement for chitin filament organization Development, January 1, 2006; 133(1): 163 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsui, A. Raya, Y. Kawakami, C. Callol-Massot, J. Capdevila, C. Rodriguez-Esteban, and J. C. Izpisua Belmonte Noncanonical Wnt signaling regulates midline convergence of organ primordia during zebrafish development Genes & Dev., January 1, 2005; 19(1): 164 - 175. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||